Search Results

Search found 4934 results on 198 pages for 'finding'.

Page 34/198 | < Previous Page | 30 31 32 33 34 35 36 37 38 39 40 41  | Next Page >

  • Finding images on the web

    - by Britt
    I sent someone a photo of me and they replied that this particular photo was all over the web. How do I find out where this photo is and is there any way that I can see if there are other photos of myself that someoe has shared without my knowledge? I am very worried about this and want to find out where these pictures are please help me!

    Read the article

  • finding the maximum in series

    - by peril brain
    I need to know a code that will automatically:- search a specific word in excel notes it row or column number (depends on data arrangement) searches numerical type values in the respective row or column with that numeric value(suppose a[7][0]or a[0][7]) it compares all other values of respective row or column(ie. a[i][0] or a[0][i]) sets that value to the highest value only if IT HAS GOT NO FORMULA FOR DERIVATION i know most of coding but at a few places i got myself stuck... i'm writing a part of my program upto which i know: using System; using System.Collections.Generic; using System.Linq; using System.Text; using System.IO; using System.Threading; using Microsoft.Office.Interop; using Excel = Microsoft.Office.Interop.Excel; Excel.Application oExcelApp; namespace a{ class b{ static void main(){ try { oExcelApp = (Excel.Application)System.Runtime.InteropServices.Marshal.GetActiveObject("Excel.Application"); ; if(oExcelApp.ActiveWorkbook != null) {Excel.Workbook xlwkbook = (Excel.Workbook)oExcelApp.ActiveWorkbook; Excel.Worksheet ws = (Excel.Worksheet)xlwkbook.ActiveSheet; Excel.Range rn; rn = ws.Cells.Find("maximum", Type.Missing, Excel.XlFindLookIn.xlValues, Excel.XlLookAt.xlPart,Excel.XlSearchOrder.xlByRows, Excel.XlSearchDirection.xlNext, false, Type.Missing, Type.Missing); }}} now ahead of this i only know tat i have to use cell.value2 ,cell.hasformula methods..... & no more idea can any one help me with this..

    Read the article

  • Finding out inside which iframe a script is executing

    - by juandopazo
    I have a page with several iframes. One of this iframes has a page from a different domain. Inside this iframe there's another iframe with a page from the parent domain. my page from mydomain.com -> an iframe -> iframe "#foo" from another-domain.com> -> iframe "#bar" from mydomain.com -> another iframe I need to get a reference to the "#foo" node inside the main page. The security model should allow me to do that because "#bar" has the same domain as the main page. So what I'm doing is iterating through the window.top array and comparing each element to the window object which is currently the "#bar" window object. My test code looks like: for (var i = 0; i < top.length; i++) { for (var j = 0; j < top[i].length; j++) { if (top[i][j] == window) { alert("The iframe number " + i + " contains me"); } } } This works fine in all browsers, but Internet Explorer 6 throws a security error when accesing top[i][j]. Any ideas on how to solve this on IE6? Thanks!

    Read the article

  • MSTest Not Finding New Tests

    - by Blake Blackwell
    Using VS2010, I can't seem to add additional test methods. If I set up my project like this [TestMethod] public void Test1() { Assert.AreNotEqual(0,1); } [TestMethod] public void Test2() { Assert.AreNotEqual(0,1); } The only test that shows up in my Test View is Test1. How do I make sure Test2 gets in to that list?

    Read the article

  • Python finding repeating sequence in list of integers?

    - by tijko
    I have a list of lists and each list has a repeating sequence. I'm trying to count the length of repeated sequence of integers in the list: list_a = [111,0,3,1,111,0,3,1,111,0,3,1] list_b = [67,4,67,4,67,4,67,4,2,9,0] list_c = [1,2,3,4,5,6,7,8,9,0,1,2,3,4,5,6,7,8,9,0,23,18,10] Which would return: list_a count = 4 (for [111,0,3,1]) list_b count = 2 (for [67,4]) list_c count = 10 (for [1,2,3,4,5,6,7,8,9,0]) Any advice or tips would be welcome. I'm trying to work it out with re.compile right now but, its not quite right.

    Read the article

  • Finding 'free' times in MySQL

    - by James Inman
    Hi, I've got a table as follows: mysql> DESCRIBE student_lectures; +------------------+----------+------+-----+---------+----------------+ | Field | Type | Null | Key | Default | Extra | +------------------+----------+------+-----+---------+----------------+ | id | int(11) | NO | PRI | NULL | auto_increment | | course_module_id | int(11) | YES | MUL | NULL | | | day | int(11) | YES | | NULL | | | start | datetime | YES | | NULL | | | end | datetime | YES | | NULL | | | cancelled_at | datetime | YES | | NULL | | | lecture_type_id | int(11) | YES | | NULL | | | lecture_id | int(11) | YES | | NULL | | | student_id | int(11) | YES | | NULL | | | created_at | datetime | YES | | NULL | | | updated_at | datetime | YES | | NULL | | +------------------+----------+------+-----+---------+----------------+ I'm essentially wanting to find times when a lecture doesn't happen - so to do this I'm thinking a query to group overlapping lectures together (so, for example, 9am-10am and 10am-11am lectures will be shown as a single 9am-11am lecture). There may be more than two lectures back-to-back. I've currently got this: SELECT l.start, l2.end FROM student_lectures l LEFT JOIN student_lectures l2 ON ( l2.start = l.end ) WHERE l.student_id = 1 AND l.start >= '2010-04-26 09:00:00' AND l.end <= '2010-04-30 19:00:00' AND l2.end IS NOT NULL AND l2.end != l.start GROUP BY l.start, l2.end ORDER BY l.start, l2.start Which returns: +---------------------+---------------------+ | start | end | +---------------------+---------------------+ | 2010-04-26 09:00:00 | 2010-04-26 11:00:00 | | 2010-04-26 10:00:00 | 2010-04-26 12:00:00 | | 2010-04-26 10:00:00 | 2010-04-26 13:00:00 | | 2010-04-26 13:15:00 | 2010-04-26 16:15:00 | | 2010-04-26 14:15:00 | 2010-04-26 16:15:00 | | 2010-04-26 15:15:00 | 2010-04-26 17:15:00 | | 2010-04-26 16:15:00 | 2010-04-26 18:15:00 | ...etc... The output I'm looking for from this would be: +---------------------+---------------------+ | start | end | +---------------------+---------------------+ | 2010-04-26 09:00:00 | 2010-04-26 13:00:00 | | 2010-04-26 13:15:00 | 2010-04-26 18:15:00 | Any help appreciated, thanks!

    Read the article

  • Finding vars from dynamically created namespaces in clojure

    - by Tom Crayford
    The following test fails: (ns clojure_refactoring.rename-fn-test (:use clojure.test)) (deftest test-fn-location (in-ns 'refactoring-test-fn-rename) (clojure.core/refer-clojure) (defn a [b] (inc b)) (in-ns 'clojure_refactoring.rename-fn-test) (is (not= (find-var 'refactoring-test-fn-rename/a) nil)) (remove-ns 'refactoring-test-fn-rename)) That is, find-var (of a var I've just created, in a namespace I've just create) returns nil. This behaviour doesn't happen at the repl, where typing out the steps of the test works just fine. Am I doing something wrong, or is this just something that doesn't work in clojure right now?

    Read the article

  • Function in c++ for finding if a word is prefix

    - by VaioIsBorn
    Let say i have some words AB, AAB, AA. AB is not a prefix to AAB but AA is a prefix to AAB because if i just add B at the end of AA it will become AAB, which is not possible with AB. So, is there any function in c++ (STL) so that i can determine of two words if one is prefix to the another ? Thanks.

    Read the article

  • Finding number of different paths

    - by peiska
    I have a game that one player X wants to pass a ball to player Y, but he can be playing with more than one player and the others players can pass the ball to Y. I want to know how many different paths can the ball take from X to Y? for example if he is playing with 3 players there are 5 different paths, 4 players 16 paths, if he is playing with 20 players there are 330665665962404000 paths, and 40 players 55447192200369381342665835466328897344361743780 that the ball can take. the number max. of players that he can play with is 500. I was thinking in using Catalan Numbers? do you think is a correct approach to solve this? Can you give me some tips.

    Read the article

  • A tool for finding duplicate code in PHP

    - by Toby
    Are there any tools available that can scan multiple .php files and report back duplicated lines/chunks of code? It doesn't have to be really smart but basically give me a starting point for manual scans to improve the codebase of some of my apps.

    Read the article

  • SQL finding overlapping of times pass midnight (across 2 days)

    - by janechii
    Hi everyone, I know there are lots of these types of questions, but i didn't see one that was similar enough to my criteria. So i'd like to ask for your help please. The fields i have are just start and end which are of time types. I cannot involve any specific dates in this. If the time ranges don't go pass midnight across day, i'd just compare two tuples as such: end1 > start2 AND start1 < end2 (end points touching are not considered overlapped here.) But when I involve time range that pass (or at) midnight, this obviously doesn't work. For example, given: start | end --------+-------- 06:00PM | 01:00AM 03:00PM | 09:00PM Without involving dates, how can i achieve this, please. My assumption is, if end is less than start, then we're involving 2 days. I'm trying to do this in plain standard SQL, so just a simple and concise logic in the WHERE clause. Thank you everyone!

    Read the article

  • finding the numbers in a given range?

    - by Jamis
    Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

    Read the article

  • finding middle element of an array

    - by senthil
    Hi all, I came cross a question in my interview. Question: Array of integers will be given as the input and you should find out the middle element when sorted , but without sorting. For Example. Input: 1,3,5,4,2 Output: 3 When you sort the given input array, it will be 1,2,3,4,5 where middle element is 3. You should find this in one pass without sorting. Any solutions for this?

    Read the article

  • jQuery: Finding file size and adding it to the link

    - by Ricardo
    Let me start by saying that I'm not a jQuery guru by any means and I genuinely know this is over my head, that's why I've come to SO. Is there a way with jQuery to find the file size of a link on a page and then inject/add the text of the file size next to the link? Here's my problem On one of my pages, I have a link to my resume which is a PDF file and to improve usability it's proper to have the file type and file size next to the link so the users have the option to decide if they want to click on that link or not. So the link would read something like "Download my resume (PDF / 80KB)" The problem is that I'm constantly updating my resume and uploading a new PDF file which, of course, has a different file size so I'm always going back to the HTML and changing the text to reflect the new file size. Is there a way to automate this with jQuery... or plain JavaScript for that matter? I found this script and made a demo here in Codepen but it doesn't seem to work. Any help with this would be greatly appreciated.

    Read the article

  • Finding center of fingerprints.

    - by an_ant
    If we suppose that every fingerprint is made of concentric curves (ellipses or circles) - and I'm aware of the fact that not every fingerprint is - how can I find center of those concentric curves? Let's take this "ideal" fingerprint and try to find out its center ... My approaches were to try: Find the spectrum through columns/rows of the image and try to find columns/rows that maximize particular band of the spectrum. I thought that column going through the center would have most regular pattern of changing amplitudes - therefore, most recognizible harmonic. My second approach was to try to count the changes of black-and-white also through the columns and rows, and to maximize that amount among rows and columns also. While these methods work to the some extant, with some additional filtering, they fail, when fingerprint is "not ideal as this one is". Can you think of any different approach? Are there standard ways to do it?

    Read the article

  • Help Needed Finding a Programmer

    - by ssean
    Good Morning, I am trying to find a programmer to code a piece of custom software for my business. I plan on using this software to manage my business, and possibly sell it to other companies (in the same industry) at a later date. I've never hired a programmer before, so I'm not sure what to expect or where to begin. I know exactly what features I need, and how I want it laid out, I just need someone who can take my ideas and make it happen. This software will be used to manage customer information, and keep track of orders. What I think I need: * SQL Server or similar database that will be located at our office. * Desktop Application, that connects via LAN to the database server (cannot be browser based) * Multiple User Support (Simultaneous users accesing the system) * Needs to be scalable (currently we have 5 employees, but who knows what the future will bring) * Multi-Platform Support (Windows, Linux) I posted a job offer through elance, which seems to raise more questions than answers. How do I decide what language(s) will work best for my situation? (I have received offers for C#, Eclipse, .NET, Powerbuilder, etc. - I want to make sure that I choose the best one now, so I don't run into problems later) Does the programmer hold any rights to the software? (I plan to offer the software for sale at a later date) Any help or insight would be appreciated, and I'd be happy to clarify anything if it helps. Thanks in advance!

    Read the article

  • Finding whether a point lies inside a rectangle or not

    - by avd
    The rectangle can be oriented in any way...need not be axis aligned. Now I want to find whether a point lies inside the rectangle or not. One method I could think of was to rotate the rectangle and point coordinates to make the rectangle axis aligned and then by simply testing the coordinates of point whether they lies within that of rectangle's or not. The above method requires rotation and hence floating point operations. Is there any other efficient way to do this??

    Read the article

  • finding character in string C language

    - by iSight
    Hi, I am searching a character at first occurence in string using the following code. But, it is taking some time when the character is too long or the character that i am searching is at far extend, which makes delay in other operations. How could i tackle with this problem. The code is below here. Note: attrPtr is a char* which holds a reference to a string containing '"' character at far extend. int position = 0; char qolon = '"';//character to search while (*(attrPtr + position++) != qolon); char* attrValue = NULL; attrValue = (char*)malloc(position * sizeof(char)); strncpy(attrValue, attrPtr, position-1);

    Read the article

< Previous Page | 30 31 32 33 34 35 36 37 38 39 40 41  | Next Page >