Search Results

Search found 10751 results on 431 pages for 'fast forward'.

Page 344/431 | < Previous Page | 340 341 342 343 344 345 346 347 348 349 350 351  | Next Page >

  • Optimal Serialization of Primitive Types

    - by Greg Dean
    We are beginning to roll out more and more WAN deployments of our product (.Net fat client w/ IIS hosted Remoting backend). Because of this we are trying to reduce the size of the data on the wire. We have overridden the default serialization by implementing ISerializable (similar to this), we are seeing anywhere from 12% to 50% gains. Most of our efforts focus on optimizing arrays of primitive types. I would like to know if anyone knows of any fancy way of serializing primitive types, beyond the obvious? For example today we serialize an array of ints as follows: [4-bytes (array length)][4-bytes][4-bytes] Can anyone do significantly better? The most obvious example of a significant improvement, for boolean arrays, is putting 8 bools in each byte, which we already do. Note: Saving 7 bits per bool may seem like a waste of time, but when you are dealing with large magnitudes of data (which we are), it adds up very fast. Note: We want to avoid general compression algorithms because of the latency associated with it. Remoting only supports buffered requests/responses(no chunked encoding). I realize there is a fine line between compression and optimal serialization, but our tests indicate we can afford very specific serialization optimizations at very little cost in latency. Whereas reprocessing the entire buffered response into new compressed buffer is too expensive.

    Read the article

  • Makefile for DOS/Windows and Cygwin

    - by Thomas Matthews
    I need to have a makefile work under DOS (Windows) and Cygwin. I having problems with the makefile detecting the OS correctly and setting appropriate variables. The objective is to set variables for the following commands, then invoke the commands in rules using the variables: Delete file: rm in Cygwin, del in DOS. Remove directory: rmdir (different parameters in Cygwin and DOS) Copy file: cp in Cygwin, copy in DOS. Testing for file existance: test in Cygwin, IF EXIST in DOS. Listing contents of a file: cat in Cygwin, type in DOS. Here is my attempt, which always uses the else clause: OS_KIND = $(OSTYPE) #OSTYPE is an environment variable set by Cygwin. ifeq ($(OS_KIND), cygwin) ENV_OS = Cygwin RM = rm -f RMDIR = rmdir -r CP = cp REN = mv IF_EXIST = test -a IF_NOT_EXIST = ! test -a LIST_FILE = cat else ENV_OS = Win_Cmd RM = del -f -Q RMDIR = rmdir /S /Q IF_EXIST = if exist IF_NOT_EXIST = if not exist LIST_FILE = type endif I'm using the forward slash character, '/', as a directory separator. This is a problem with the DOS command, as it is interpreting it as program argument rather than a separator. Anybody know how to resolve this issue? Edit: I am using make with Mingw in both Windows Console (DOS) and Cygwin.

    Read the article

  • Linq to SQL with INSTEAD OF Trigger and an Identity Column

    - by Bob Horn
    I need to use the clock on my SQL Server to write a time to one of my tables, so I thought I'd just use GETDATE(). The problem is that I'm getting an error because of my INSTEAD OF trigger. Is there a way to set one column to GETDATE() when another column is an identity column? This is the Linq-to-SQL: internal void LogProcessPoint(WorkflowCreated workflowCreated, int processCode) { ProcessLoggingRecord processLoggingRecord = new ProcessLoggingRecord() { ProcessCode = processCode, SubId = workflowCreated.SubId, EventTime = DateTime.Now // I don't care what this is. SQL Server will use GETDATE() instead. }; this.Database.Add<ProcessLoggingRecord>(processLoggingRecord); } This is the table. EventTime is what I want to have as GETDATE(). I don't want the column to be null. And here is the trigger: ALTER TRIGGER [Master].[ProcessLoggingEventTimeTrigger] ON [Master].[ProcessLogging] INSTEAD OF INSERT AS BEGIN SET NOCOUNT ON; SET IDENTITY_INSERT [Master].[ProcessLogging] ON; INSERT INTO ProcessLogging (ProcessLoggingId, ProcessCode, SubId, EventTime, LastModifiedUser) SELECT ProcessLoggingId, ProcessCode, SubId, GETDATE(), LastModifiedUser FROM inserted SET IDENTITY_INSERT [Master].[ProcessLogging] OFF; END Without getting into all of the variations I've tried, this last attempt produces this error: InvalidOperationException Member AutoSync failure. For members to be AutoSynced after insert, the type must either have an auto-generated identity, or a key that is not modified by the database after insert. I could remove EventTime from my entity, but I don't want to do that. If it was gone though, then it would be NULL during the INSERT and GETDATE() would be used. Is there a way that I can simply use GETDATE() on the EventTime column for INSERTs? Note: I do not want to use C#'s DateTime.Now for two reasons: 1. One of these inserts is generated by SQL Server itself (from another stored procedure) 2. Times can be different on different machines, and I'd like to know exactly how fast my processes are happening.

    Read the article

  • Why do people hate SQL cursors so much?

    - by Steven A. Lowe
    I can understand wanting to avoid having to use a cursor due to the overhead and inconvenience, but it looks like there's some serious cursor-phobia-mania going on where people are going to great lengths to avoid having to use one for example, one question asked how to do something obviously trivial with a cursor and the accepted answer proposed using a common table expression (CTE) recursive query with a recursive custom function, even though this limits the number of rows that could be processed to 32 (due to recursive call limit in sql server). This strikes me as a terrible solution for system longevity, not to mention a tremendous effort just to avoid using a simple cursor. what is the reason for this level of insane hatred? has some 'noted authority' issued a fatwa against cursors? does some unspeakable evil lurk in the heart of cursors that corrupts the morals of the children or something? wiki question, more interested in the answer than the rep thanks in advance! Related Info: http://stackoverflow.com/questions/37029/sql-server-fast-forward-cursors EDIT: let me be more precise: I understand that cursors should not be used instead of normal relational operations, that is a no-brainer. What I don't understand is people going waaaaay out of their way to avoid cursors like they have cooties or something, even when a cursor is a simpler and/or more efficient solution. It's the irrational hatred that baffles me, not the obvious technical efficiencies.

    Read the article

  • Problem with copying local data onto HDFS on a Hadoop cluster using Amazon EC2/ S3.

    - by Deepak Konidena
    Hi, I have setup a Hadoop cluster containing 5 nodes on Amazon EC2. Now, when i login into the Master node and submit the following command bin/hadoop jar <program>.jar <arg1> <arg2> <path/to/input/file/on/S3> It throws the following errors (not at the same time.) The first error is thrown when i don't replace the slashes with '%2F' and the second is thrown when i replace them with '%2F': 1) Java.lang.IllegalArgumentException: Invalid hostname in URI S3://<ID>:<SECRETKEY>@<BUCKET>/<path-to-inputfile> 2) org.apache.hadoop.fs.S3.S3Exception: org.jets3t.service.S3ServiceException: S3 PUT failed for '/' XML Error Message: The request signature we calculated does not match the signature you provided. check your key and signing method. Note: 1)when i submitted jps to see what tasks were running on the Master, it just showed 1116 NameNode 1699 Jps 1180 JobTracker leaving DataNode and TaskTracker. 2)My Secret key contains two '/' (forward slashes). And i replace them with '%2F' in the S3 URI. PS: The program runs fine on EC2 when run on a single node. Its only when i launch a cluster, i run into issues related to copying data to/from S3 from/to HDFS. And, what does distcp do? Do i need to distribute the data even after i copy the data from S3 to HDFS?(I thought, HDFS took care of that internally) IF you could direct me to a link that explains running Map/reduce programs on a hadoop cluster using Amazon EC2/S3. That would be great. Regards, Deepak.

    Read the article

  • Help with C puzzle

    - by Javier Badia
    I found a site with some complicated C puzzles. Right now I'm dealing with this: The following is a piece of C code, whose intention was to print a minus sign 20 times. But you can notice that, it doesn't work. #include <stdio.h> int main() { int i; int n = 20; for( i = 0; i < n; i-- ) printf("-"); return 0; } Well fixing the above code is straight-forward. To make the problem interesting, you have to fix the above code, by changing exactly one character. There are three known solutions. See if you can get all those three. I cannot figure out how to solve. I know that it can be fixed by changing -- to ++, but I can't figure out what single character to change to make it work.

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • jquery image hover popup cant detect browser edge and change its direction

    - by Salman
    hi guys i am trying to implement jquery image hover popup but facing a problem when the popup is closer to browser edge it goes beyond its edge i want it to change its direction when it finds that space is not enough to show that popup, i have see this effect in many plugins where popups, tooltips and drop down menus change their direction if they are close to browser window edge can any one guide me in right direction here is the screen shot for reference http://img512.imageshack.us/img512/4990/browseredge.png here is the jquery hover code function imagePreview(){ /* CONFIG */ xOffset = 10; yOffset = 30; // these 2 variable determine popup's distance from the cursor // you might want to adjust to get the right result /* END CONFIG */ $("a.preview").hover(function(e){ this.t = this.title; this.title = ""; var c = (this.t != "") ? "<br>" + this.t : ""; var newName = this.name; //console.log(this.name); newName=newName.replace("/l/","/o/"); //console.log(newName); $("body").append("<p id='preview'><img src='"+ this.name +"' alt='Image preview' style='margin-bottom:5px;'>"+ c +"</p>"); $("#preview img").error(function () { $("#preview img").attr("src" ,newName).css({'width': '400px', 'height': 'auto'}); }); $("#preview") .css("top",(e.pageY - xOffset) + "px") .css("left",(e.pageX + yOffset) + "px") .fadeIn("fast"); }, function(){ this.title = this.t; $("#preview").remove(); }); $("a.preview").mousemove(function(e){ $("#preview") .css("top",(e.pageY - xOffset) + "px") .css("left",(e.pageX + yOffset) + "px"); }); }; any help will be appriciated Thanks Salman

    Read the article

  • iPhone OpenGL Splash Screen? How?

    - by Kyle
    My app is based pretty much on the EAGLView in the SDK. It doesn't incorporate a ViewController. Rather it simply inits GL and starts painting immediately.. Currently, my app will load a very small PNG and displays it as quickly as possible. On a 3GS this is rather instant, but on a 3G it can take about 2 seconds. In the latter case of the 3G, the user is looking at a black screen for that time. Is this behavior allowed by Apple? Is there any way to alter this SDK example so that it makes use of 'default.png'? It doesn't seem so straight forward to me. I want my user to see an image as quickly as possible, and I also don't want to be rejected for such a little quirk like this as well. In the guidelines, they encourage you to use default.png for standard applications to show a sort of mockup of the interface while it actually loads. I want to initialize OpenGL, and ALSO display this. This default.png is loaded before the app screen launches. This is EXACLTY what I want to make use of. Any help is appreciated. Thanks!

    Read the article

  • Cross-platform game development: ease of development vs security

    - by alcuadrado
    Hi, I'm a member and contributor of the Argentum Online (AO) community, the first MMORPG from Argentina, which is Free Software; which, although it's not 3D, it's really addictive and has some dozens of thousands of users. Really unluckily AO was developed in Visual Basic (yes, you can laugh) but the former community, so imagine, the code not only sucks, it has zero portability. I'm planning, with some friends to rewrite the client, and as a GNU/Linux frantic, want to do it cross-platform. Some other people is doing the same with the server in Java. So my biggest problem is that we would like to use a rapid development language (like Java, Ruby or Python) but the client would be pretty insecure. Ruby/Python version would have all it's code available, and the Java one would be easily decompilable (yes, we have some crackers in the community) We have consider the option to implement the security module in C/C++ as a dynamic library, but it can be replaced with a custom one, so it's not really secure. We are also considering the option of doing the core application in C++ and the GUI in Ruby/Python. But haven't analysed all it's implications yet. But we really don't want to code the entire game in C/C++ as it doesn't need that much performance (the game is played at 18fps on average) and we want to develop it as fast as possible. So what would you choose in my case? Thank you!

    Read the article

  • Looking for a .Net ORM

    - by SLaks
    I'm looking for a .Net 3.5 ORM framework with a rather unusual set of requirements: I need to create and alter tables at runtime with schemas defined by my end-users. (Obviously, that wouldn't be strongly-typed; I'm looking for something like a DataTable there) I also want regular strongly-typed partial classes for rows in non-dynamic tables, with custom validation and other logic. (Like normal ORMs) I want to load the entire database (or some entire tables) once, and keep it in memory throughout the life of the (WinForms) GUI. (I have a shared SQL Server with a relatively slow connection) I also want regular LINQ support (like LINQ-to-SQL) for ASP.Net on the shared server (which has a fast connection to SQL Server) In addition to SQL Server, I also want to be able to use a single-file database that would support XCopy deployment (without installing SQL CE on the end-user's machine). (Probably Access or SQLite) Finally, it has to be free (unless it's OpenAccess) I'll probably have to write it myself, as I don't think there is an existing ORM that meets these requirements. However, I don't want to re-invent the wheel if there is one, hence this question. I'm using VS2010, but I don't know when my webhost (LFC) will upgrade to .Net 4.0

    Read the article

  • Getting Google results in Java? Need help!

    - by Cris Carter
    Hello. Right now, I'm trying to get the results from Google in Java, by searching for a term. I'm using a desktop program, not an applet. That in itself isn't complicated. but then Google gave me a 403 error. Anyways, I added referrer and User Agent and then it worked. Now, my problem is that I don't get the results page from Google. Instead, I get their script which gets the results page. My code right now simply uses a GET request on "http://www.google.com/search?q=" + Dork; Then it outputs each line. Here is what I get when I run my program: <.!doctype html<.head<.titledork - Google Search<./title<.scriptwindow.google={kEI:"9myaS-Date).getTime()}}};try{}catch(u){}window.google.jsrt_kill=1; align:center}#logo{display:block;overflow:hidden;position:relative;width:103px;height:37px; <./ script<./div Lots of stuff like that. I shortened it (A LOT) and put in dots to fit it here. So my big question is: How do I turn this whole mess into the nice results page I get when searching Google with a browser? Any help would be seriously appreciated, and I really need the answer fast. Also, please keep in mind that I do NOT want to use Google's API for this. Thanks in advance!

    Read the article

  • CSS Menu disappear

    - by WtFudgE
    Hi, I created a menu in html/css but where I wanted the subitems to be shown on parent item hover. The problem is when I hover on it in IE it only shows it's subitems when I hover on the text in the menu item, If I hover over the element and not the text the subitems disappear again. So if I hover and want to move my mouse to my submenu the submenu disappears unless I'm fast enough. This is very annoying, does anyone know how I can solve this? MY menu code is like so: <ul id="leftnav"> Item1 SubItem1 SubItem2 SubItem3 Item2 SubItem1 SubItem2 SubItem3 The menu should be a left sided menu which shows it's subitems only on hover, so I used css to achieve this with the following code: #leftnav, #leftnav ul { padding: 0; margin: 0; } #leftnav ul li { margin-left: 102px; position: relative; top: -19px; /*sets the childitems on the same height as the parent item*/ } #leftnav li { float: left; width: 100px; } #leftnav ul { position: absolute; width: 100px; left: -1000px; /*makes it disappear*/ } #leftnav li:hover ul, #leftnav li.ie_does_hover ul { left: auto; } #leftnav a { display: block; height: 15px; margin-top: 2px; margin-bottom: 2px; } Since this only works with firefox I also had to insert a javascript to get this to work in IE using code: <script language="JavaScript"> sfHover = function() { var sfElsE = document.getElementById("leftnav").getElementsByTagName("LI"); for (var i=0; i<sfElsE.length; i++) { sfElsE[i].onmouseover=function() { this.className+=" ie_does_hover"; } sfElsE[i].onmouseout=function() { this.className=this.className.replace(new RegExp(" ie_does_hover\\b"), ""); } } } if (window.attachEvent) window.attachEvent("onload", sfHover); </script> Many many many thanks for replies

    Read the article

  • Error While Linking Multiple C Object files in Delphi 2007

    - by Ramnish
    Hello Everyone. I am new to delphi. I was trying to add C Object files in my Delphi project and link them directly since Delphi Supports C Object Linking. I got it working when i link a single Object file. But when i try to link multiple object files, i am getting error 'Unsatisfied forward or external declaration'. I have tried this in Delphi 2007 as well as XE.So what am i doing wrong here? Working Code: function a_function():Integer;cdecl; implementation {$Link 'a.obj'} function a_function():Integer;cdecl;external; end. Error Code: function a_function():Integer;cdecl; function b_function();Integer;cdecl; function c_function();Integer;cdecl; implementation {$LINK 'a.obj'} {$LINK 'b.obj'} {$LINK 'c.obj'} function a_function():Integer;cdecl;external; function b_function();Integer;cdecl;external; function c_function();Integer;cdecl;external; end.

    Read the article

  • How can I build something like Amazon S3 in Perl?

    - by Joel G
    I am looking to code a file storage application in perl similar to amazon s3. I already have a amazon s3 clone that I found online called parkplace but its in ruby and is old also isn't built for high loads. I am not really sure what modules and programs I should use so id like some help picking them out. My requirements are listed below (yes I know there are lots but I could start simple then add more once I get it going): Easy API implementation for client side apps. (maybe REST (?) Centralized database server for the USERDB (maybe PostgreSQL (?). Logging of all connections, bandwidth used, well pretty much everything to a centralized server (maybe PostgreSQL again (?). Easy server side configuration (config file(s) stored on the servers). Web based control panel for admin(s) and user(s) to show logs. (could work just running queries from the databases) Fast High Uptime Low memory usage Some sort of load distribution/load balancer (maybe a dns based or pound or perlbal or something else (?). Maybe a cache of some sort (memcached or parlbal or something else (?). Thanks in advance

    Read the article

  • Change NSTimer interval for repeating timer.

    - by user300713
    Hi, I am running a mainLoop in Cocoa using an NSTimer set up like this: mainLoopTimer = [NSTimer scheduledTimerWithTimeInterval:1.0/fps target:self selector:@selector(mainloop) userInfo:nil repeats:YES]; [[NSRunLoop currentRunLoop] addTimer:mainLoopTimer forMode:NSEventTrackingRunLoopMode]; At Program startup I set the timeInterval to 0.0 so that the mainloop runs as fast as possible. Anyways, I would like to provide a function to set the framerate(and thus the time interval of the timer) to a specific value at runtime. Unfortunately as far as I know that means that I have to reinitialize the timer since Cocoa does not provide a function like "setTimerInterval" This is what I tried: - (void)setFrameRate:(float)aFps { NSLog(@"setFrameRate"); [mainLoopTimer invalidate]; mainLoopTimer = nil; mainLoopTimer = [NSTimer scheduledTimerWithTimeInterval:1.0/aFps target:self selector:@selector(mainloop) userInfo:nil repeats:YES]; [[NSRunLoop currentRunLoop] addTimer:mainLoopTimer forMode:NSEventTrackingRunLoopMode]; } but this throws the following error and stops the mainloop: 2010-06-09 11:14:15.868 myTarget[7313:a0f] setFrameRate 2010-06-09 11:14:15.868 myTarget[7313:a0f] * __NSAutoreleaseNoPool(): Object 0x40cd80 of class __NSCFDate autoreleased with no pool in place - just leaking 2010-06-09 11:14:15.869 myTarget[7313:a0f] * __NSAutoreleaseNoPool(): Object 0x40e700 of class NSCFTimer autoreleased with no pool in place - just leaking 0.614628 I also tried to recreate the timer using the "retain" keyword, but that didn't change anything. Any ideas about how to dynamically change the interval of an NSTimer at runtime? Thanks!

    Read the article

  • How to get a handle on all this middleware?

    - by jkohlhepp
    My organization has recently been wrestling the question of whether we should be incorporating different middleware products / concepts into our applications. Products we are looking at are things like Pegasystems, Oracle BPM / BPEL, BizTalk, Fair Isaac Blaze, etc., etc., etc. But I'm having a hard time getting a handle on all this. Before I go forward with evaluating the usefulness (positive or negative) of these different products I'm trying to get an understanding of all the different concepts in this space. I'm overwhelmed with an alphabet soup of BPM, ESB, SOA, CEP, WF, BRE, ERP, etc. Some products seem to cover one or more of those aspects, others focus on doing one. The terms all seem very ambiguous and conflated with each other. Is there a good resource out there to get a handle on all these different middleware concepts / patterns? A book? A website? An article that sums it up well? Bonus points if there is a resource that maps the various popular products into which pattern(s) they address. Thanks, ~ Justin

    Read the article

  • How Do I make a simple .htaccess internal redirect Catch All script while forwarding POST data?

    - by RB
    I just want to catch all requests and forward them internally to my catchall page with all POST data intact Catch all page: http://www.mydomain.com/addons/redirect/catch-all.php I've tried so many combinations, but my server doesn't want to redirect internally if I specify more than catch-all.php # Internally redirect all pages to "Catch" page Options +FollowSymLinks RewriteEngine on RewriteRule (.*) /addons/redirect/catch-all.php [L] Also, do I need [L] or is it useless for internal redirects? Then, what php code would I use to grab the POST data, use it, and finally PHP redirect the page to the originally requested page Would it be done just as normal by using $_POST['variable_name']; or something different? Then, how would I go about calling the originally requested page, so I can tell PHP to header location direct them to that page? Thanks! UPDATE: Ha sick, nevermind. The condition DOES work. Here's my code: # Internally redirect all pages to "Catch" page Options +FollowSymLinks RewriteEngine on RewriteCond %{REQUEST_URI} !^/robots.txt$ RewriteCond %{REQUEST_URI} !\.(gif¦jpe?g¦png¦css¦js¦pdf¦doc¦xml)$ RewriteCond %{REQUEST_URI} !^/addons/redirect/catch-all\.php$ RewriteRule (.*)$ /addons/redirect/catch-all.php?q=$1 [L] Thanks guys for the inspiration! Now time to get that PHP to work...

    Read the article

  • Credit card system implementation?

    - by Mark
    My site is going to have a credit system that basically works a lot like a credit card. Each user has an unlimited credit limit, but at the end of each week, they have to pay it off. For example, a user might make several purchases between March 1st and 7th, and then at the end of March 7th, they would be emailed an invoice that lists all their purchases during the week and a total that is due by the 14th. If they don't pay it off, their account is simply deactivated until they do. I'm just trying to wrap my head around how to implement this. I have a list of all their purchases, that's not a problem, but I'm just trying to figure out what to do with it. On the end of the 7th day, I could set up a cronjob to generate an invoice, which would basically have an id, and due date, and then I would need another many-to-many table to link all the purchases to the invoice. Then when a user adds money to their account, I guess it's applied against their current outstanding invoice? And what if they don't pay off their invoice by the time a new invoice rolls around, so now they have 2 outstanding ones, how do I know which to apply it against? Or do I make the cronjob check for any previous outstanding invoices, cancel them, and add a new item to the new invoice as "balance forward (+interest)"? How would you apply the money against an invoice? Would each payment have to be linked to an invoice, or could I just deposit it to their account credit, and then somehow figure out whats been paid and what hasn't? What if they pay in advance, before their invoice has been generated? Do I deduct it from their credit from the invoice upon generation, or at the end of the week when its due? There are so many ways to do this... Can anyone describe what approach they would take?

    Read the article

  • display sqlite datatable in a jtable

    - by tuxou
    Hi I'm trying to display an sqlite data table in a jtable but i have an error " sqlite is type forward only" how could I display it in a jtable try { long start = System.currentTimeMillis(); Statement state = ConnectionBd.getInstance().createStatement( ResultSet.TYPE_SCROLL_INSENSITIVE, ResultSet.CONCUR_READ_ONLY ); ResultSet res = state.executeQuery("SELECT * FROM data"); ResultSetMetaData meta = res.getMetaData(); Object[] column = new Object[meta.getColumnCount()]; for(int i = 1 ; i <= meta.getColumnCount(); i++){ column[i-1] = meta.getColumnName(i); } res.last(); int rowCount = res.getRow(); Object[][] data = new Object[res.getRow()][meta.getColumnCount()]; res.beforeFirst(); int j = 1; while(res.next()){ for(int i = 1 ; i <= meta.getColumnCount(); i++) data[j-1][i-1] = res.getObject(i); j++; } res.close(); state.close(); long totalTime = System.currentTimeMillis() - start; result.removeAll(); result.add(new JScrollPane(new JTable(data, column)), BorderLayout.CENTER); result.add(new JLabel("execute in " + totalTime + " ms and has " + rowCount + " ligne(s)"), BorderLayout.SOUTH); result.revalidate(); } catch (SQLException e) { result.removeAll(); result.add(new JScrollPane(new JTable()), BorderLayout.CENTER); result.revalidate(); JOptionPane.showMessageDialog(null, e.getMessage(), "ERREUR ! ", JOptionPane.ERROR_MESSAGE); } thank you

    Read the article

  • Configure IIS7 to server static content through ASP.NET Runtime

    - by Anton Gogolev
    I searched high an low and still cannot find a definite answer. How do I configure IIS 7.0 or a Web Application in IIS so that ASP.NET Runtime will handle all requests -- including ones to static files like *.js, *.gif, etc? What I'm trying to do is as follows. We have kind of SaaSy site, which we can "skin" for every customer. "Skinnig" means developing a custom master page and using a bunch of *.css and other images. Quite naturally, I'm using VirtualPathProvider, which operates like this: public override System.Web.Hosting.VirtualFile GetFile(string virtualPath) { if(PhysicalFileExists(virtualPath)) { var virtualFile = base.GetFile(virtualPath); return virtualFile; } if(VirtualFileExists(virtualPath)) { var brandedVirtualPath = GetBrandedVirtualPath(virtualPath); var absolutePath = HttpContext.Current.Server.MapPath(brandedVirtualPath); Trace.WriteLine(string.Format("Serving '{0}' from '{1}'", brandedVirtualPath, absolutePath), "BrandingAwareVirtualPathProvider"); var virtualFile = new VirtualFile(brandedVirtualPath, absolutePath); return virtualFile; } return null; } The basic idea is as follows: we have a branding folder inside our webapp, which in turn contains folders for each "brand", with "brand" being equal to host name. That is, requests to http://foo.example.com/ should use static files from branding/foo_example_com, whereas http://bar.example.com/ should use content from branding/bar_example_com. Now what I want IIS to do is to forward all requests to static files to StaticFileHandler, which would then use this whole "infrastructure" and serve correct files. However, try as I might, I cannot configure IIS to do this.

    Read the article

  • How to dispatch a new property value in an object to the same property of two other objects

    - by WPFadvocate
    In WPF, I've three objects exposing the same DependencyProperty (let's say it's an integer). I want all three property values to remain synchronized, i.e. that whenever the int value changes in an object, this value is propagated to the two other objects. I think of multibinding to do the job, but I don't know how to detect which object changed, thus which value should be used and propagated to the other objects. Edited: here is my tentative code for multibinding, with the false hope that it would work without additional code: // create the multibinding MultiBinding mb = new MultiBinding() { Mode = BindingMode.TwoWay, UpdateSourceTrigger = UpdateSourceTrigger.PropertyChanged }; // create individual bindings to associate object_2 and object_3 to object_1 Binding b2 = new Binding() { Source = object_2, Path = new PropertyPath("X") }; Binding b3 = new Binding() { Source = object_3, Path = new PropertyPath("X") }; // add individual bindings to multibinding mb.Bindings.Add(b2); mb.Bindings.Add(b3); // bind object_2 and _3 to object_1 BindingOperations.SetBinding(object_1, TypeObject_1.XProperty, mb); But actually, there is a runtime error, saying the binding set by the last instruction is lacking a converter. But again I don't know how to write this converter (there is nothing to convert (as this is the case in the related MS sample of code linking 3 rgb properties to a color property), only to forward the value of the property changed to the two other properties). I understand I could solve the problem by creating an X_Changed event in the 3 types and then have each object registering to the two other objects event. I don't like this "manual" way and would prefer to bind the 3 properties together.

    Read the article

  • Cooperative/Non-preemptive threading avoiding threadlooks?

    - by Wayne
    Any creative ideas to avoid deadlocks on a yield or sleep with cooperative/non-preemptive multitasking without doing an O/S Thread.Sleep(10)? Typically the yield or sleep call will call back into the scheduler to run other tasks. But this can sometime produce deadlocks. Some background: This application has enormous need for speed and, so far, it's extremely fast as compared to other systems in the same industry. One of the speed techniques is cooperative/non-preemptive threading rather then the cost of a context switch from O/S threads. The high level design a priority manager which calls out to tasks depending on priority and processing time. Each task does one "iteration" of work and returns to wait its turn again in the priority queue. The tricky thing with non-preemptive threading is what to do when you want to a particular task to stop in the middle of work and wait for some other event from a different task before continuing. In this case, we have 3 tasks, A B and C where A is a controller that must synchronize the activity of B and C. First, A starts both B and C. Then B yields so C gets invoked. When C yields, A sees they are both inactive, decides it's time for B to run but not time for C yet. Well B is now stuck in a yield that has called C, so it can never run. Sincerely, Wayne

    Read the article

  • Hidden controls, iframes or divs

    - by user287745
    What happens to the controls or the iframe or the div, which are hidden? Do they get transferred to the user side? Disabled: does it get transferred to the user side? What I want is, an aspx page will be having many iframes to display different pages. There will be many div tags to display CSS formatted information. To understand what I mean by many:- I have to transfer a complete website with 30 aspx pages into one single page! I have simply combined everything resulting in one extremely huge page. My concern is that on local host it loads fast, but when on online server accessed by numerous people for education purposes, the site (ONE PAGE) WILL SLOW DOWN terribly. To overcome this I thought of using hidden and disable options. What is an improved way of achieving the above? Yes, it sounds silly but this is the requirement. Edit: Yes, I know id and server tag must be set, but what I am asking will the div tag be sent to the user's browser? One answer is no. So can I enable them using JavaScript? Like document.getElementById(id).style.visibility="visible" What if I disable them, and from coding of JavaScript enable them? Will they be loaded at the time of enabling?

    Read the article

  • Frame Accurate Browser Launchable Video Player ... ?

    - by cliftonc
    I have a requirement where I need to enable playback (full screen) of a h.264 MPEG4 (thanks for the correction!) video from a local network, launchable from a browser link on a Windows workstation, and be frame accurate. By frame accurate I mean that I need to be able to scrub through the video in the same way you would with a vtr, stop at a frame, and then move backwards and forwards frame by frame (it is for a very specific compliance requirement where have to be able to check every frame if there is something that is potentially against broadcasting guidelines). The application itself is used to capture notes while viewing the material, so the end model is for a dual monitor workstation, with a web form in one, the video playing full screen in the second (no issue launching the video and manually having to move it to the second screen), and then the user controls the video via keyboard shortcuts or a jog shuttle. I have looked at QT, but the java bindings seem to be dead or nearly so, flash isn't frame accurate, VLC given its streaming heritage seems to be only able to move forward by a frame and not backwards, and all I have left are commercial offerings that in my experience are difficult and expensive to change. Any ideas of where I should look or alternative options? Any advice appreciated!

    Read the article

< Previous Page | 340 341 342 343 344 345 346 347 348 349 350 351  | Next Page >