Search Results

Search found 15698 results on 628 pages for 'keep alive'.

Page 345/628 | < Previous Page | 341 342 343 344 345 346 347 348 349 350 351 352  | Next Page >

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • Which web containers install themselves well as a Windows service?

    - by Thorbjørn Ravn Andersen
    We have had a web application product for several years, and used Tomcat to deploy it under Windows as it registers itself as a Windows service so it starts and stops automatically. We may now happen to need more JEE facilitites than is provided by Tomcat (we are very tempted by the JEE 6 things in the container) so the question is which Open Source JEE containers works well as Windows services. Since Glassfish is the only JEE 6 implementation right now, it would be nice if it works well, but I'd like to hear experiences and not just what I can read from brochures. If not, what else do people use? EDIT: This goes for web containers too, and not just JEE containers. We will probably keep the necessary stack included until we find the right container and it gets JEE6 support. EDIT: I want this to work as distributed. I'm not interested in manually hacking wrappers etc., but want the installation process to handle the creation and removal of the service.

    Read the article

  • Server Security

    - by mahatmanich
    I want to run my own root server (directly accessible from the web without a hardware firewall) with debian lenny, apache2, php5, mysql, postfix MTA, sftp (based on ssh) and maybe dns server. What measures/software would you recomend, and why, to secure this server down and minimalize the attack vector? Webapplications aside ... This is what I have so far: iptables (for gen. packet filtering) fail2ban (brute force attack defense) ssh (chang default, port disable root access) modsecurity - is really clumsy and a pain (any alternative here?) ?Sudo why should I use it? what is the advantage to normal user handling thinking about greensql for mysql www.greensql.net is tripwire worth looking at? snort? What am I missing? What is hot and what is not? Best practices? I like "KISS" - Keep it simple secure, I know it would be nice! Thanks in advance ...

    Read the article

  • Move asp.net website to subfolder/subdomain

    - by brz dot net
    What is the effective way to deploy an asp.net website in subfolder/subdomain? Actually I need to keep web.config in root directory and modify following things for this. Web.config Location tags Web.config authentication forms tag Web.sitemap Style.css Response.redirect/Server.transfer Image path Is there any way to avoid these changes? So my development work is not more different from production. Means I am expecting one place where applied changes are effective on whole site. No need to modify path on each page.

    Read the article

  • Reading DBF with VFPOLEDB driver problem.

    - by John Sheares
    I am using VFPOLEDB driver to read DBF files and I keep getting this error and I am not sure why and how to fix the problem: The provider could not determine the Decimal value. For example, the row was just created, the default for the Decimal column was not available, and the consumer had not yet set a new Decimal value. Here is the code. I call this routine to return a DataSet of the DBF file and display the data in a DataGridView. public DataSet GetDBFData(FileInfo fi, string tbl) { using (OleDbConnection conn = new OleDbConnection( @"Provider=VFPOLEDB.1;Data Source=" + fi.DirectoryName + ";")) { conn.Open(); string command = "SELECT * FROM " + tbl; OleDbDataAdapter da = new OleDbDataAdapter(command, conn); DataSet ds = new DataSet(); da.Fill(ds); return ds; } }

    Read the article

  • Is there any real benefit to using ASP.Net Authentication with ASP.Net MVC?

    - by alchemical
    I've been researching this intensely for the past few days. We're developing an ASP.Net MVC site that needs to support 100,000+ users. We'd like to keep it fast, scalable, and simple. We have our own SQL database tables for user and user_role, etc. We are not using server controls. Given that there are no server controls, and a custom membershipProvider would need to be created, where is there any benefit left to use ASP.Net Auth/Membership? The other alternative would seem to be to create custom code to drop a UniqueID CustomerID in a cookie and authenticate with that. Or, if we're paranoid about sniffers, we could encrypt the cookie as well. Is there any real benefit in this scenario (MVC and customer data is in our own tables) to using the ASP.Net auth/membership framework, or is the fully custom solution a viable route?

    Read the article

  • Asp.net fileupload control postback problems

    - by Spooky2010
    using ASP.net, vs2008 C#. Im using a FileUpload control on a webform. The uploading of a file (ie PDF dcouments) to a server directory works ok. I have on the webform a "preview" button that the user can use to preview the PDF file after they have selected it via the Fileupload browse feature. I do this by if (this.FileUpload1.HasFile) { localURL = FileUpload1.PostedFile.FileName; // use this to preview file. Other methods are restricted by local security requirements Process.Start(localURL); } My problems is that after the button click Postback occurs the location of the selected file disappears from the textbox part of the Fileupload control. How can i keep this info there, so the user does not have to browse again and instead can just click upload to upload the file. Any help appreciated thanks

    Read the article

  • Merge items in nanoc

    - by Gordon Potter
    I have been trying to use nanoc for generating a static website. I need to organize a complex arrangement pages I want to keep my content DRY. How does the concept of includes or merges work within the nanoc system? I have read the docs but I can't seem to find what I want. For example: how can I take two partial content items and merge them together into a new content item. In staticmatic you can do some like the following inside your page. = partial('partials/shared/navigation') How would a similar convention work within nanoc?

    Read the article

  • Jersey, Spring, Tomcat and Security Annotations

    - by jr
    I need to secure a simple jersey RESTful API in a Tomcat 6.0.24 container. I'd like to keep the authentication with Basic Authentication using the tomcat-users.xml file to define the users and roles (this is for now, like I said its small). Now, for authorization I'd like to be able to use the JSR 250 annotations like @RolesAllowed, @PermitAll, @DenyAll, etc. I cannot for the life of me figure out how to wire this all up together. I really don't want to go spring-security route, since I need something very simple at the current time. Can someone point me in the right direction.

    Read the article

  • BufferedReader.readLine() gives error java.net.SocketException: Software caused connection abort: re

    - by javatcp
    I am trying to code my program such that until the buffered reader gets something in readLine() from my tcp client it should keep running in the while loop checking but I get this error as soon as the program executes Mar 31, 2010 11:03:36 PM deswash.DESWashView$5 run SEVERE: null java.net.SocketException: Software caused connection abort: recv failed at java.net.SocketInputStream.socketRead0(Native Method) at java.net.SocketInputStream.read(SocketInputStream.java:129) at sun.nio.cs.StreamDecoder.readBytes(StreamDecoder.java:264) at sun.nio.cs.StreamDecoder.implRead(StreamDecoder.java:306) at sun.nio.cs.StreamDecoder.read(StreamDecoder.java:158) at java.io.InputStreamReader.read(InputStreamReader.java:167) at java.io.BufferedReader.fill(BufferedReader.java:136) at java.io.BufferedReader.readLine(BufferedReader.java:299) at java.io.BufferedReader.readLine(BufferedReader.java:362) at deswash.DESWashView$5.run(DESWashView.java:448) the second line in the following code throws the error while(running){ String temp = in.readLine(); if(!(temp.equals(null))){ int inid = Integer.parseInt(temp); stationList.add(inid); } }

    Read the article

  • How to map old paths to Drupal paths

    - by kidrobot
    I'm converting a Wordpress blog to Drupal and need to map the WP paths to the new Drupal ones. What's the best practice for doing this? There are only around a hundred pages to map. I've been experimenting with the URL Alter module, which provides an alternative to messing with custom_url_rewrite functions settings.php but keep getting 404. Waiting to hear back from the module maintainer if this is what the module is intended for. In the meantime I am wondering how others do this? Should I be using .htaccess?

    Read the article

  • Cost of using ASP.NET

    - by Mackristo
    One thing that I keep hearing in reference to ASP.NET and MSFT technologies is that they cost money to use. Often when they are being compared to open source languages someone will mention that one factor in favor of open source is that it's free (to an extent). My question is, when does ASP.NET actually cost money to use in terms of using the proprietary technology? Understandably there are the hosting fees, but I'm curious about the fees outside of these hosting fees. I'm especially curious about this as it relates one-person smaller-site development (non-team/large enterprise). Any help is appreciated. (edits) Some excellent answers. Much appreciated The projects that I'm looking to use the technologies for would be personal sites and very small business sites (1 or 2). The intent would of course be that these projects get much bigger. It seems that for commercial production, fees will apply. What about just basic dynamic "shared hosting" sites that provide information?

    Read the article

  • How do I change apache2 DocumentRoot (default snow leopard install) and not get "You don't have perm

    - by David Peek
    I'm trying to point DocumentRoot at a directory in my user folder. While I can happily point DocumentRoot at /Library/WebServer/Documents and ~/Sites I keep getting "You don't have permission to access / on this server." when I point it anywhere else. OK, I just found a solution mid-question (stack overflow is just that good) by changing the user/group apache runs under to myuser/admin. I'm sure there must be a better way though. Surely some kind of permissions magic on the directory I'm pointing at?

    Read the article

  • MSBuild Extension Pack Zip the folders and subfolders

    - by ManojTrek
    I have to Zip my folders and subfolders Using MSbuild, I was looking at the MSBuild Extension pack, and tried this <ItemGroup> <ZipFiles Include="\Test\Web\**\*.*" > <Group>Release</Group> </ZipFiles> </ItemGroup> <MSBuild.ExtensionPack.Compression.Zip TaskAction="Create" CompressFiles="@(ZipFiles)" ZipFileName="$(WorkingDir)%(ZipFiles.Group).zip"/> When I do this it just keep adding all the files to root, instead of adding it into the specific subfolder within the zip file. I am missing something, can anyone help here please.

    Read the article

  • Ajax.ActionLink is not POSTing

    - by Dave Hanna
    I am trying to navigate to an MVC action by POSTing rather than GETting. (The action is a DELETE, and I don't want it reachable by an external link.) I am using a link in a grid generated by Ajax.ActionLink("Remove", "Delete", new { saID = Model.Said, id = e.id }, new AjaxOptions { HttpMethod = "POST", Confirm = "Are you sure you want to delete this item?" }) Which generates the following HTML: <a href="/Equipment/Delete/102424/229933" onclick="Sys.Mvc.AsyncHyperlink.handleClick(this, new Sys.UI.DomEvent(event), { insertionMode: Sys.Mvc.InsertionMode.replace, confirm: 'Are you sure you want to delete this item?', httpMethod: 'POST' });">Remove</a> My problem is that when I click on the link, I am reaching the Delete action via a GET rather than a POST, AND the Confirm dialog is not taking place. I have been googling this for several hours and just keep getting wrapped around the axle. What am I doing wrong?

    Read the article

  • key value coding-compliant for NSObject class?

    - by 4thSpace
    I've created a singleton class that loads a plist. I keep getting this error when I try to set a value: '[ setValue:forUndefinedKey:]: this class is not key value coding-compliant for the key test.' I have one key in the plist file. The key is named "test" and has no value associated with it. I set the value like this: [[PlistManager sharedManager].plist setValue:@"the title value" forKey:@"test"]; I look at the set plist dictionary and see this from within PlistManager: po self.plistDictionary { test = ""; } I get the error just as I'm leaving PlistManager in the debugger. PlistManager is of type NSObject. So no xibs. Any ideas on what I need to do?

    Read the article

  • android soft keyboard covers editText in landscape

    - by gabi
    I have the following layout: <?xml version="1.0" encoding="utf-8"?> <RelativeLayout xmlns:android="http://schemas.android.com/apk/res/android" android:layout_width="fill_parent" android:layout_height="fill_parent"> <LinearLayout android:layout_height="wrap_content" android:layout_width="fill_parent" android:orientation="vertical" android:layout_above="@+id/edittext"> <TextView android:layout_height="wrap_content" android:layout_width="fill_parent" android:text="line1"/> <TextView android:layout_height="wrap_content" android:layout_width="fill_parent" android:text="line2"/> <TextView android:layout_height="wrap_content" android:layout_width="fill_parent" android:text="line3"/> </LinearLayout> <EditText android:id="@id/edittext" android:layout_height="wrap_content" android:layout_width="fill_parent" android:layout_margin="5dp" android:text="test" android:layout_alignParentBottom="true" android:imeOptions="flagNoExtractUi" /> </RelativeLayout> and in landscape on a Nexus one it looks like: Is there a way to fix this, but keep flag flagNoExtractUi ?

    Read the article

  • Remove the elements and contents before an element

    - by Jerry
    Hello guys I am trying to remove the elements and contents before a link inside a div when a user clicks a button. What is the best way to do it?? <div id="dialog" class="window"> //will be inserted a <select> element and few text here //but I want to clear them after the user click a button <a href="#" class="close">Close it</a> // I want to keep this <a> link. </div> My Jquery $('.model').click(function(e) { $("#dialog").empty(); //I can't use this because <a> will be deleted. Any better ideas? }); Thanks for the reply...

    Read the article

  • A strong case for WF

    - by Pita.O
    Hi guys, I have struggled for so long to find a compelling use case for workflow (ie: WF) as against regular imperative programming. Each time I fall back to the conclusion that I should just leave WF out or defer getting into it until later. But I keep having this nagging feeling that there's something am missing. Does anyone know any book that truly makes a strong case for the Workflow way? The book has to (i) teach WF well, and (ii) show using appropriate use cases that WF made an implementation easy to do than if we just did our regular straight coding. I will appreciate it.

    Read the article

  • How do I position an element so that it acts like both 'absolutely' & 'relatively' positioned at the same time? - CSS

    - by marcamillion
    You can see the implementation here: http://jsfiddle.net/BMWZd/25/ When you click on one of the names in Box#1, you will see the circle in the top left corner of the box move up and down. How do I stop that? While also, making sure that it shows in the top left corner of each of the boxes on all browser sizes? So position:absolute will keep it in one place regardless of what happens around it. But it won't put it in the exact same position (relatively) on diff browser sizes. But position:relative will. How do I get the best of both worlds?

    Read the article

  • Why can't WordPress create directories when uploading themes?

    - by Arman
    I can't workout how to solve this problem so wordpress would let me upload themes. I have a fresh copy of Fedora 17 installed on my dev machine. I then installed mysql using: yum install mysql mysql-server. Next I installed WordPress which also installs apache and php: yum install wordpress I can go to http://localhost/wordpress and see WordPress working. But when I try tried to install my theme it asked for ftp credentials. I then updated the wp-config.php file and set the FS_METHOD constant to direct. Now it doesn't ask for ftp credentials but it gives me this error: Could not create directory. /usr/share/wordpress/wp-content/themes/my-theme-name/ httpd service is running under 'apache' user and 'apache' group. The /usr/share/wordpress/ directory is recursively own by 'apache' user and 'apache' group too. I've even set the permissions to 777 (also recursively) and even then I keep getting the same error as above. How can I solve this problem?

    Read the article

  • Scrollable div on iPhone without using 2 fingers?

    - by Brad Parks
    Hi there; I've got a UIWebView embedded in my iPhone app, and I'd like to keep a locked header and footer DIV on the page at all times, with a scrollable center DIV. I know that I could do this using a header/footer that are UIView controls, but I want the header and footer to be HTML divs, as a pure HTML/JS/CSS solution will be easier to port to Android/PalmPre/AdobeAir, which is going to be on my todo list relatively soon. I can do this using techniques like the one mentioned here: http://defunc.com/blog/?p=94 But this requires that the user use 2 fingers to scroll the div, which is not satisfactory to me... Any suggestions on how to do this? Thanks, Brad

    Read the article

  • KeepAliveException when using HttpWebRequest.GetResponse

    - by Lucas
    I am trying to POST an attachment to CouchDB using the HttpWebRequest. However, when I attempt "response = (HttpWebResponse)httpWebRequest.GetResponse();" I receive a WebException with the message "The underlying connection was closed: A connection that was expected to be kept alive was closed by the server." I have found some articles stating that setting the keepalive to false and httpversion to 1.0 resolves the situation. I am finding that it does not yeilding the exact same error, plus I do not want to take that approach as I do not want to use the 1.0 version due to how it handles the connection. Any suggestions or ideas are welcome. I'll try them all until one works! public ServerResponse PostAttachment(Server server, Database db, Attachment attachment) { Stream dataStream; HttpWebResponse response = null; StreamReader sr = null; byte[] buffer; string json; string boundary = "----------------------------" + DateTime.Now.Ticks.ToString("x"); string headerTemplate = "Content-Disposition: form-data; name=\"_attachments\"; filename=\"" + attachment.Filename + "\"\r\n Content-Type: application/octet-stream\r\n\r\n"; byte[] headerbytes = System.Text.Encoding.UTF8.GetBytes(headerTemplate); byte[] boundarybytes = System.Text.Encoding.ASCII.GetBytes("\r\n--" + boundary + "\r\n"); HttpWebRequest httpWebRequest = (HttpWebRequest)WebRequest.Create("http://" + server.Host + ":" + server.Port.ToString() + "/" + db.Name + "/" + attachment.Document.Id); httpWebRequest.ContentType = "multipart/form-data; boundary=" + boundary; httpWebRequest.Method = "POST"; httpWebRequest.KeepAlive = true; httpWebRequest.ContentLength = attachment.Stream.Length + headerbytes.Length + boundarybytes.Length; if (!string.IsNullOrEmpty(server.EncodedCredentials)) httpWebRequest.Headers.Add("Authorization", server.EncodedCredentials); if (!attachment.Stream.CanRead) throw new System.NotSupportedException("The stream cannot be read."); // Get the request stream try { dataStream = httpWebRequest.GetRequestStream(); } catch (Exception e) { throw new WebException("Failed to get the request stream.", e); } buffer = new byte[server.BufferSize]; int bytesRead; dataStream.Write(headerbytes,0,headerbytes.Length); attachment.Stream.Position = 0; while ((bytesRead = attachment.Stream.Read(buffer, 0, buffer.Length)) > 0) { dataStream.Write(buffer, 0, bytesRead); } dataStream.Write(boundarybytes, 0, boundarybytes.Length); dataStream.Close(); // send the request and get the response try { response = (HttpWebResponse)httpWebRequest.GetResponse(); } catch (Exception e) { throw new WebException("Invalid response received from server.", e); } // get the server's response json try { dataStream = response.GetResponseStream(); sr = new StreamReader(dataStream); json = sr.ReadToEnd(); } catch (Exception e) { throw new WebException("Failed to access the response stream.", e); } // close up all our streams and response sr.Close(); dataStream.Close(); response.Close(); // Deserialize the server response return ConvertTo.JsonToServerResponse(json); }

    Read the article

  • Logging strategy vs. performance

    - by vtortola
    Hi, I'm developing a web application that has to support lots of simultaneous requests, and I'd like to keep it fast enough. I have now to implement a logging strategy, I'm gonna use log4net, but ... what and how should I log? I mean: How logging impacts in performance? is it possible/recomendable logging using async calls? Is better use a text file or a database? Is it possible to do it conditional? for example, default log to the database, and if it fails, the switch to a text file. What about multithreading? should I care about synchronization when I use log4net? or it's thread safe out of the box? In the requirements appear that the application should cache a couple of things per request, and I'm afraid of the performance impact of that. Cheers.

    Read the article

  • Setup GIT Server with Msysgit on Windows

    - by Tom
    Hi Guys, My friends and I are trying to setup GIT for windows using this tutorial but we just keep running into problems. I know many of you guys on this site are GIT gurus - so I was wondering whether anyone would be able to help us (and I am sure 100s of other Windows Devs who want to use GIT) write a "Setup GIT Server" guide for windows using Msysgit ? There is a comment on the guide above suggesting it cant be done with Msysgit because gitosis requires the use of an SSH Server and Bash ? Would really appreciate it if someone could do a step by step guide as there is not one available (we've search for hours)? Install Mysisgit ? Thx

    Read the article

< Previous Page | 341 342 343 344 345 346 347 348 349 350 351 352  | Next Page >