Search Results

Search found 22246 results on 890 pages for 'microsoft expression'.

Page 349/890 | < Previous Page | 345 346 347 348 349 350 351 352 353 354 355 356  | Next Page >

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Casting in mixed type calculations in C?

    - by yCalleecharan
    Hi, If I define these variables: double x0, xn, h; int n; and I have this mathematical expression: h = (xn - x0)/n; Is it necessary that I cast n into double prior doing the division for maximum accuracy like in h = (xn - x0)/ (double) n; I wrote a program to check the above but both expressions give the same answers. I understand that C will promote the integer to double type as variables xn and x0 are of type double but strangely enough in a book, the second expression with casting was emphasized. Thanks a lot...

    Read the article

  • Lambda "if" statement?

    - by AndyC
    I have 2 objects, both of which I want to convert to dictionarys. I use toDictionary<(). The lambda expression for one object to get the key is (i = i.name). For the other, it's (i = i.inner.name). In the second one, i.name doesn't exist. i.inner.name ALWAYS exists if i.name doesn't. Is there a lambda expression I can use to combine these two? Basically to read as: "if i.name exists then set id to i.name, else set id to i.inner.name". Many thanks.

    Read the article

  • How to choose programaticaly the column to be queried by Linq using PropertyInfo???

    - by Richard77
    Hello, I would like to control how linq querries my database programaticaly. For instance, I'd like to query the column X, column Y, or column Z, depending on some conditions. First of all, I've created an array of all the properties inside my class called myPropertyInfo. Type MyType = (typeOf(MyClass)); PropertyInfo[] myPropertyInfo = myType.GetProperties( BindingFlags.Public|BindingFlags.Instance); The myPropertyInfo array allows me to access each property details (Name, propertyType, etc) through the index*[i]* Now, how can I use the above information to control how linq queries my DB? Here's a sample of a querry I'd like to exploit. var myVar = from tp in db.MyClass select tp.{expression}; Expression using myPropertyInfo[i] to choose which property(column) to query. I'm not sure if that's the way of doing it, but if there's another way to do so, I'll be glad to learn. Thanks for helping.

    Read the article

  • How to make validation for a textbox that accept only comma(,) & digit in asp.net application?

    - by prateeksaluja20
    I am working on a website. I am using C# 2008. I want to make a text box that accept only numbers & comma(,). for example-919981424199,78848817711,47171111747 or there may be a single number like 919981424199. I was able to do one thing My text box only containing number by using this Regular Expression validation.in its property-Validation Expression i wrote "[0-9]+". This is working but now my requirement is to send bulk SMS & each number is separated by (,). I tried a lot but not getting the ans. so please help me to sort out this problem.

    Read the article

  • How to create a NSPredicate to find entries with leading numerical value?

    - by Toastor
    Hello, I'm using NSPredicates to fetch entities based on a name attribute. Creating a predicate for names beginning with letters was easy (@"name BEGINSWITH %@", searchLetter), however now I'd like to fetch all entities with a name that begins with a numerical value, or rather a non-alphabetical number. What would be the appropriate predicate expression here? Right now I don't want to get too deep into predicate programming, as this is all I need right now and time flies. So, please, don't point me to the Predicate Programming Guide, I just need that expression.. :) Thanks alot guys!

    Read the article

  • Looking for another regex explanation

    - by Sam
    In my regex expression, I was trying to match a password between 8 and 16 character, with at least 2 of each of the following: lowercase letters, capital letters, and digits. In my expression I have: ^((?=.*\d)(?=.*[a-z])(?=.*[A-Z])(?=.*\d)(?=.*[a-z])(?=.*[A-Z]).{8,16})$ But I don't understand why it wouldn't work like this: ^((?=\d)(?=[a-z])(?=[A-Z])(?=\d)(?=[a-z])(?=[A-Z]){8,16})$ Doesnt ".*" just meant "zero or more of any character"? So why would I need that if I'm just checking for specific conditions? And why did I need the period before the curly braces defining the limit of the password? And one more thing, I don't understand what it means to "not consume any of the string" in reference to "?=".

    Read the article

  • Mapping Drive Error - System Error 1808

    - by Julian Easterling
    A vendor is attempting to map and preserve a network drive using nt authority/system; so it stays persistent when the interactive session of the server is lost. They were able to do this on one server (Windows 2008 R2) but not a second computer (also Windows 2008 R2). D:\PsExec.exe -s cmd.exe PsExec v1.98 - Execute processes remotely Copyright (C) 2001-2010 Mark Russinovich Sysinternals - www.sysinternals.com Microsoft Windows [Version 6.1.7600] Copyright (c) 2009 Microsoft Corporation. all rights reserved. C:\Windows\system32>whoami nt authority\system C:\Windows\system32>net use New connections will be remembered. Status Local Remote Network -------------------------------------------------------------------- OK X: \\netapp1\share1 Microsoft Windows Network The command completed successfully. C:\Windows\system32>net use q: \\netapp1\share1 System error 1808 has occurred. The account used is a computer account. Use your global user account or local user account to access this server. C:\Windows\system32> I am unsure on how to set up a "machine account mapping" which will preserve the drive letter of the Netapp path being mapped, so that the service account running a Windows service can continue to access the share after interactive logon has expired on the server. Since they were able to do this on one server but not another, I'm not sure how to troubleshoot the problem? Any suggestions?

    Read the article

  • What is my miniport's service name?

    - by Ian Boyd
    i am trying to query the physical sector size of my drive using fsutil: C:\Windows\system32>fsutil fsinfo ntfsinfo c: NTFS Volume Serial Number : 0x78cc11b2cc116c1e Version : 3.1 Number Sectors : 0x000000003a382fff Total Clusters : 0x00000000074705ff Free Clusters : 0x00000000022fc29b Total Reserved : 0x00000000000007d0 Bytes Per Sector : 512 Bytes Per Physical Sector : <Not Supported> Bytes Per Cluster : 4096 Bytes Per FileRecord Segment : 1024 Clusters Per FileRecord Segment : 0 Mft Valid Data Length : 0x00000000305c0000 Mft Start Lcn : 0x00000000000c0000 Mft2 Start Lcn : 0x0000000003a382ff Mft Zone Start : 0x0000000006951940 Mft Zone End : 0x0000000006951c80 RM Identifier: 19B22CBE-570D-19DE-9C72-CD758F800DDC You can see that the Bytes Per Physical Sector value is Not Supported: Bytes Per Physical Sector : <Not Supported> In KB Article Microsoft support policy for 4K sector hard drives in Windows, Microsoft says: If fsutil.exe continues to display "Bytes Per Physical Sector : " after you apply the latest storage driver and the required hotfixes, make sure that the following registry path exists: HKLM\CurrentControlSet\Services\<miniport’s service name>\Parameters\Device\ Name: EnableQueryAccessAlignment Type: REG_DWORD Value: 1: Enable The only thing i don't know is what my Miniport's service name is. What is my miniport's service name. i know that my SATA drives are in AHCI mode, and AHCI uses the msahci driver service: Is that my miniport service? "MSAHCI"? See also Hitachi - Advanced Format Technology Brief RMPrepUSB - Advanced Format (4K sector) hard disks Microsoft support policy for 4K sector hard drives in Windows OSR Online - Advance Disk Format support in Storport Virtual Mniport diver Default cluster size for NTFS, FAT, and exFAT Wikipedia - Advanced Format

    Read the article

  • Can't successfully run Sharepoint Foundation 2010 first time configuration

    - by Robert Koritnik
    I'm trying to run the non-GUI version of configuration wizard using power shell because I would like to set config and admin database names. GUI wizard doesn't give you all possible options for configuration. I run this command: New-SPConfigurationDatabase -DatabaseName "Sharepoint2010Config" -DatabaseServer "developer.pleiado.pri" -AdministrationContentDatabaseName "Sharepoint2010Admin" -DatabaseCredentials (Get-Credential) -Passphrase (ConvertTo-SecureString "%h4r3p0int" -AsPlainText -Force) Of course all these are in the same line. I've broken them down into separate lines to make it easier to read. When I run this command I get this error: New-SPConfigurationDatabase : Cannot connect to database master at SQL server a t developer.pleiado.pri. The database might not exist, or the current user does not have permission to connect to it. At line:1 char:28 + New-SPConfigurationDatabase <<<< -DatabaseName "Sharepoint2010Config" -Datab aseServer "developer.pleiado.pri" -AdministrationContentDatabaseName "Sharepoint 2010Admin" -DatabaseCredentials (Get-Credential) -Passphrase (ConvertTo-SecureS tring "%h4r3p0int" -AsPlainText -Force) + CategoryInfo : InvalidData: (Microsoft.Share...urationDatabase: SPCmdletNewSPConfigurationDatabase) [New-SPConfigurationDatabase], SPExcep tion + FullyQualifiedErrorId : Microsoft.SharePoint.PowerShell.SPCmdletNewSPCon figurationDatabase I created two domain accounts: SPF_DATABASE - database account SPF_ADMIN - farm account I'm running powershell console as domain administrator. I've tried to run SQL Management studio as domain admin and created a dummy database and it worked wothout a problem. I'm running: Windows 7 x64 on the machine where Sharepoint Foundation 2010 should be installed and also has preinstalled SQL Server 2008 R2 Windows Server 2008 R2 Server Core is my domain controller I've installed Sharepoint according to MS guides http://msdn.microsoft.com/en-us/library/ee554869%28office.14%29.aspx installing all additional patches that are related to my configuration. Any ideas what should I do to make it work?

    Read the article

  • Can't access SQL Server 2008 from workstations, but can from server

    - by Kev
    We have an app that can use mssql2k or 2k8. We've been using 2k but I decided to try 2k8 to compare. I installed in on our win2k3 server alongside mssql2k. In the ODBC applet on the server, I was able to set up access to 2k8, and it passes the test at the end successfully, whether I tell it to use Windows Authentication or an sql login. The latter is how the app always accessed mssql2k. The app works fine from the server, but when I try it on a workstation (winxpsp3), I get a window titled, "Microsoft SQL Server Login" that says: Connection failed: SQLState: '01000' SQL Server Error: 53 [Microsoft][ODBC SQL Server Driver][DBNETLIB]ConnectionOpen (Connect()). Connection failed: SQLState: '08001' SQL Server ERror: 17 [Microsoft][ODBC SQL Server Driver][DBNETLIB]SQL Server does not exist or access denied. Then I get the ODBC login dialog, which I can't get to login correctly (I just keep getting the same error above), even copying and pasting a password after resetting it on the server, and whether "trusted" is checked or not. "Options" is disabled. The server was straight SERVERNAME for mssql2k, but for mssql2k8 it's called SERVERNAME\mssql2008. That works on the server, why not on the workstation? (Which I'm logged in as the same person on, BTW.)

    Read the article

  • Cmdlets for AD CS deployment: Install-ADcsCertificationAuthority cmdlet failing when attempting to install an offline policy CA

    - by red888
    I installed an offline root CA without issue using this command: Install-ADcsCertificationAuthority ` -OverwriteExistingKey ` <#In the case of a re-installation#> ` -AllowAdministratorInteraction ` -CACommonName ` "LAB Corporate Root CA" ` -CADistinguishedNameSuffix ` 'O=LAB Inc.,C=US' ` -CAType ` StandaloneRootCA ` -CryptoProviderName ` "RSA#Microsoft Software Key Storage Provider" ` -HashAlgorithmName ` SHA256 ` -KeyLength ` 2048 ` -ValidityPeriod ` Years ` -ValidityPeriodUnits ` 20 ` -DatabaseDirectory ` 'E:\CAData\CertDB' ` -LogDirectory ` 'E:\CAData\CertLog' ` -Verbose I installed the root CA's cert and CRl on the policy CA, installed the AD CS binaries, and attempted to run this command to install the policy CA and export a req file: Install-ADcsCertificationAuthority ` -OverwriteExistingKey ` <#In the case of a re-installation#> ` -AllowAdministratorInteraction ` -CACommonName ` "LAB Corporate Policy Internal CA" ` -CADistinguishedNameSuffix ` 'O=LAB Inc.,C=US' ` -CAType ` StandaloneSubordinateCA ` -ParentCA ` rootca ` -OutputCertRequestFile ` 'e:\polca-int.req' ` -CryptoProviderName ` "RSA#Microsoft Software Key Storage Provider" ` -HashAlgorithmName ` SHA256 ` -KeyLength ` 2048 ` -ValidityPeriod ` Years ` -ValidityPeriodUnits ` 10 ` -DatabaseDirectory ` 'E:\CAData\CertDB' ` -LogDirectory ` 'E:\CAData\CertLog' ` -Verbose When doing this I receive the following error: VERBOSE: Calling InitializeDefaults method on the setup object. Install-ADcsCertificationAuthority : At line:1 char:1 + Install-ADcsCertificationAuthority ` + ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + CategoryInfo : InvalidArgument: (:) [Install-AdcsCertificationA uthority], CertificationAuthoritySetupException + FullyQualifiedErrorId : ValidateParameters,Microsoft.CertificateServices .Deployment.Commands.CA.InstallADCSCertificationAuthority Is there a parameter I am entering incorrectly or something?

    Read the article

  • IIS6 Wildcard Mapping to ASP.NET - no file extension results in IIS 404

    - by Ian Robinson
    I'm trying to perform what I understand to be a relatively simple task. I'd like to remove the extensions from the URLs on my website. I have the proper set up in my application to handle and rewrite the URLs - the trouble is I can't get past IIS to actually get to my application without the extensions. The details: I'm running IIS6 on Windows Server 2003. I've gone into the web site for my application, gone to the home directory tab, clicked "Configuration" and added a wildcard map to the following file: c:\windows\microsoft.net\framework\v2.0.50727\aspnet_isapi.dll Which I verified is the same as what is used above in the application extensions portion by .ascx, etc. If I navigate to http://mywebsite.com/Blogs the result is as follows: HTTP/1.1 404 Not Found Content-Length: 1635 Content-Type: text/html Server: Microsoft-IIS/6.0 X-Powered-By: ASP.NET Date: Thu, 14 Jan 2010 15:04:49 GMT Which seems to be a standard IIS 404 message. If I navigate to http://mywebsite.com/Blogs.aspx I get my ASP.NET app.... How can I troubleshoot this? I feel like I've double checked everything a dozen times but to no avail. I must be missing something obvious. Update: Here are the exact instructions given by the asp.net url rewriter that I'm using: IIS 6.0 - Windows 2003 Server open property page for website / virtual directory. click the 'home directory' tab click the 'configuration' button, select the 'mappings' tab click 'insert' next to the 'Wildcard application maps' section browse to the aspnet_isapi.dll (normally at c:\windows\microsoft.net\framework\v2.0.50727\aspnet_isapi.dll) Ensure that 'check that file exists' is unchecked Click OK, OK, OK to close and apply changes Update 2: I have yet to find a resolution for this. The application does not seem to be receiving the request from IIS, any further ideas?

    Read the article

  • Cannot connect to a VPN server - authentication failed with error code 691

    - by stacker
    When trying to connect to a VPN server, I get the 691 error code on the client, which say: Error Description: 691: The remote connection was denied because the user name and password combination you provided is not recognized, or the selected authentication protocol is not permitted on the remote access server. I validated that the username and password are correct. I also installed a certification to use with the IKEv2 security type. I also validated that the VPN server support security method. But I cannot login. In the server log I get this log: Network Policy Server denied access to a user. The user DomainName\UserName connected from IP address but failed an authentication attempt due to the following reason: The remote connection was denied because the user name and password combination you provided is not recognized, or the selected authentication protocol is not permitted on the remote access server. Any idea of what can I do? Thanks in advance! Log Name: Security Source: Microsoft-Windows-Security-Auditing Date: 12/29/2010 7:12:20 AM Event ID: 6273 Task Category: Network Policy Server Level: Information Keywords: Audit Failure User: N/A Computer: VPN.domain.com Description: Network Policy Server denied access to a user. Contact the Network Policy Server administrator for more information. User: Security ID: domain\Administrator Account Name: domain\Administrator Account Domain: domani Fully Qualified Account Name: domain.com/Users/Administrator Client Machine: Security ID: NULL SID Account Name: - Fully Qualified Account Name: - OS-Version: - Called Station Identifier: 192.168.147.171 Calling Station Identifier: 192.168.147.191 NAS: NAS IPv4 Address: - NAS IPv6 Address: - NAS Identifier: VPN NAS Port-Type: Virtual NAS Port: 0 RADIUS Client: Client Friendly Name: VPN Client IP Address: - Authentication Details: Connection Request Policy Name: Microsoft Routing and Remote Access Service Policy Network Policy Name: All Authentication Provider: Windows Authentication Server: VPN.domain.home Authentication Type: EAP EAP Type: Microsoft: Secured password (EAP-MSCHAP v2) Account Session Identifier: 313933 Logging Results: Accounting information was written to the local log file. Reason Code: 16 Reason: Authentication failed due to a user credentials mismatch. Either the user name provided does not map to an existing user account or the password was incorrect.

    Read the article

  • Tasks not appearing in Mac Outlook 2011

    - by Tama
    My current workplace uses Macs and my old workplaces used Windows. In my old workplaces I heavily used Outlook's Task functionality to manage my workload. I understand that the Task functionality in Outlook 2011 for Mac is heavily limited so I was very pleased to find this useful "how-to" on making the most of Tasks. My problem is that my tasks don't appear in the Task folder, or anywhere else for that matter. Even if I search for a the title of a task I've recently found I still can't find them. After some Googling I found this forum thread that suggests it may be a problem with the Outlook database, which points to a Microsoft KB. So I went through all of the recommended steps on rebuilding/ adding a new identity using the "Microsoft Database Utility" - the theory being that if I create a new identity I can test the task creation using a "blank slate" identity. When I change the default identity to my newly created identity using the Microsoft Database Utility (have to restart the computer) Task creation still doesn't work. Any ideas appreciated, I really miss the task functionality in Outlook 2010 for Windows.

    Read the article

  • Windows Server 2008 Task Scheduler: Task Started (Task=100) but did task did not complete (Task=102) when the result code is 2

    - by MacGyver
    Can someone give me a use case for setting up a Windows Server 2008 Task Scheduler task (we'll call this "test") that completes (action completed is task=201) with an error (result code=2)? This is event trigger code for another task (called "notification" that sends out an email based on the event history of the "test" task. I've got use cases for tasks that opens a program successfully and when a program fails to find the program. I'm just trying to think of how I can test a scenario when it finds the program, but something fails with warnings or errors. /* Failed - task started but had errors (result code of 2) */ <QueryList> <Query Id="0" Path="Microsoft-Windows-TaskScheduler/Operational"> <Select Path="Microsoft-Windows-TaskScheduler/Operational"> *[ System [ Provider[@Name='Microsoft-Windows-TaskScheduler'] and (Level=0 or Level=1 or Level=2 or Level=3 or Level=4 or Level=5) and (Task = 201) ] ] and *[ EventData [ Data [ @Name='TaskName' ]='\Tasks\test' ] ] and *[ EventData [ Data [ @Name='ResultCode' ]='2' ] ] </Select> </Query> </QueryList>

    Read the article

  • Problem with MS DTC on SQL2008 win server 2k8 with linked server from sql2000 win server 2k

    - by user31648
    Hi, We have migrated our db from sql2000 win server 2k to sql2008 win server 2k8. We have linked server from sql2000 win server 2k. By our opinion the problem is with DTC and we have made a lot of setting that we found as solution for our problem, but still the problem exist. There is no any error or worning or information niether in the sql log nor in win event viewer. The application is hanging out and at the end the time out exception is shown. What we have done till now: Enable Network DTC Access with inbound and outbound with No Authentication Required on win 2k8 We have opened RPC dynamic port allocation through registry on 2k and 2k8 We have entered subkey TurnOffRpcSecurity in the registry HKEY_LOCAL_MACHINE\SOFTWARE\Microsoft\MSDTC and made it enable on 2k and 2k8 We have added exception for DTC in firewall for all entities What we have notice that when we restart SQL service and make the first try for our transaction the following is shown: "Attempting to initialize Microsoft Distributed Transaction Coordinator (MS DTC). This is an informational message only. No user action is required." and after it: "Recovery of any in-doubt distributed transactions involving Microsoft Distributed Transaction Coordinator (MS DTC) has completed. This is an informational message only. No user action is required." Does someone have any idea what else can be done in order to solve the problem? Thanks in advance. Regards, Snezana

    Read the article

  • Remotely managing Scheduled Tasks on another computer: Access Denied

    - by Eptin
    I need to remotely create new scheduled tasks from a Windows 7 computer in my company (which according to this Microsoft TechNet article I should be able to do. http://technet.microsoft.com/en-us/library/cc766266.aspx ) From within Task Scheduler, on the menu I click Action Connect to another Computer. I browse for the remote computer's name (I use Check Names to verify that the name is correct) and then I check 'Connect as another user' and enter \Administrator and the local admin password. Whenever I try this, I get the error message Task Scheduler: You do not have permission to access this computer Firewall isn't the problem I am able to use Remote Desktop with this username & password combo, so I would expect it to work when remotely managing as well. The remote computer has firewall exceptions for Remote Scheduled Tasks Management, Remote Service Management, and Remote Desktop among other things. Heck, I even tried turning off the firewall for that individual computer and it still didn't work. More details: I have administrative remote access to several other Windows 7 Enterprise computers, though I log in as the local Administrator (whose administrative rights are only recognized by that local machine, not by the domain). The computer I am managing from is on the domain, and also has administrative rights that are recognized on the domain. More experimentation: If I go the other way around and remote-desktop into the other machine and from there open task scheduler then 'connect to another computer', I am able to connect back to my main computer using the username & password that is recognized by an administrator on the domain, and successfully schedule a task on my main computer. So it's not a company firewall issue that's preventing anything from working. The only permissions requirement Microsoft talks about is "The user credentials that you use to connect to the remote computer must be a member of the Administrators group on the remote computer". I'm logging in as an Administrator on each of the local machines, so why doesn't it work?

    Read the article

  • Windows XP SP3 client over NAT to a Windows 2008 R2 SP1 file server disconnection

    - by Patrick Pellegrino
    we just transferred a pilot group from our old(!!) Netware infrastructure to an Microsoft infrastructure. Since then, our users got problems accessing their files. They all experience disconnection from the mapped drives. The file server is access via a WAN connection by a firewall (Sonicwall) between both network and we do NAT. All clients have Windows XP SP3 and the file server is an Windows 2008 R2 SP1. On the file server I got many Event Id 2012. Many post over the Internet suggested a problem between the SMB protocol and NAT. We need a short term fix to continue to transfer users from Netware to Microsoft after what will work to remove the NATing. I found this MS KB http://support.microsoft.com/kb/2444558 that suggested a kind of workaround for Windows 7 clients but I can found anything for Windows XP. Anyone can help me with this ? We don't want to stop the project and do a network job before migrating. Regards. Update: Our few Windows 7 computers doesn't seem to have this issue.

    Read the article

  • Can't successfully run Sharepoint Foundation 2010 first time configuration

    - by Robert Koritnik
    I'm trying to run the non-GUI version of configuration wizard using power shell because I would like to set config and admin database names. GUI wizard doesn't give you all possible options for configuration (but even though it doesn't do it either). I run this command: New-SPConfigurationDatabase -DatabaseName "Sharepoint2010Config" -DatabaseServer "developer.mydomain.pri" -AdministrationContentDatabaseName "Sharepoint2010Admin" -DatabaseCredentials (Get-Credential) -Passphrase (ConvertTo-SecureString "%h4r3p0int" -AsPlainText -Force) Of course all these are in the same line. I've broken them down into separate lines to make it easier to read. When I run this command I get this error: New-SPConfigurationDatabase : Cannot connect to database master at SQL server a t developer.mydomain.pri. The database might not exist, or the current user does not have permission to connect to it. At line:1 char:28 + New-SPConfigurationDatabase <<<< -DatabaseName "Sharepoint2010Config" -Datab aseServer "developer.mydomain.pri" -AdministrationContentDatabaseName "Sharepoint 2010Admin" -DatabaseCredentials (Get-Credential) -Passphrase (ConvertTo-SecureS tring "%h4r3p0int" -AsPlainText -Force) + CategoryInfo : InvalidData: (Microsoft.Share...urationDatabase: SPCmdletNewSPConfigurationDatabase) [New-SPConfigurationDatabase], SPExcep tion + FullyQualifiedErrorId : Microsoft.SharePoint.PowerShell.SPCmdletNewSPCon figurationDatabase I created two domain accounts and haven't added them to any group: SPF_DATABASE - database account SPF_ADMIN - farm account I'm running powershell console as domain administrator. I've tried to run SQL Management studio as domain admin and created a dummy database and it worked without a problem. I'm running: Windows 7 x64 on the machine where Sharepoint Foundation 2010 should be installed and also has preinstalled SQL Server 2008 R2 database Windows Server 2008 R2 Server Core is my domain controller that just serves domain features and nothing else I've installed Sharepoint according to MS guides http://msdn.microsoft.com/en-us/library/ee554869%28office.14%29.aspx installing all additional patches that are related to my configuration. Any ideas what should I do to make it work?

    Read the article

  • Retail windows xp prof sp 2 Lost key but have the genuine cd , what to do?

    - by AdityaGameProgrammer
    I had recently formatted my system only to find out i have lost the cd key to my original cd. i had used the option to enter the product key later. Yes, i know its a stupid thing to do but i bought the cd in 2008 from a retail store and i lost the original packaging. the actual label on the cd is includes service pack version 2002 .@2004 microsoft corporation reserved. There are some numbers on the back side of the cd in the inner ring. i cant for the life of me figure out how what is the use of the genuine cd i have with me when i cant seem to activate it. what exactly is the advantage of having the original cd in your possession in situations like this?. i have tried the unattend.txt and it doesnt contain the correct key. and there does not exist any winnnt.sif file in the cd. where on the cd or in it can i find the product id information i stay in india . and my attempts at trying the microsoft support site keeps getting me directed to page which says they had stopped support for windows xp in 2011. lets say by some miracle i do contact microsoft. what information would i have to provide them? and would they be giving me the product key for my cd key from their database? or a new key?

    Read the article

  • WHS - Windows Update Failure

    - by Kyle B.
    Clicking "Update Now..." inside my EX470 control panel for Windows Update produces the following error message: "Windows Home Server updates installation can not complete. Please try again later. If the problem persists, please restart the server." I have rebooted the server numerous times, and I have also used remote desktop to connect to the machine to perform the update this way, however the browser is unable to pull up http://windowsupdate.microsoft.com. This is very strange behavior because I am able to access all other sites (gmail.com, serverfault.com, etc). Would it be possible for someone to explain to me how I can check to see what is blocking the connection of this device, which apparently has a valid internet connection, to the Microsoft Windows Update site? note #1 Using the shortcut: %SystemRoot%\system32\wupdmgr.exe does not work either. It says "Connecting to 65.55.200.155..." but nothing ever happens. This is strange because all other sites seem fine. Also, I can connect to windowsupdate.microsoft.com on my local desktop so I know this is running as well

    Read the article

  • Networking 2 Virtual PC with one VPC as DHCP server

    - by vivek
    My host OS is Win XP Professional. The host has a real network connection via DSL and I created a second network connection using Microsoft Loopback Adapter. Internet connection sharing is enabled. The Microsoft Loopback adapter has a IP address of 192.168.0.1. I have 1 Virtual PC which has Windows Server 2003. I have setup the network connection on this VPC to use Microsoft Loopback Adapter. I setup this VPC to be the Domain Controller , DNS Server and DHCP Server. I set this to a static IP address 192.168.0.2 (on the same subnet as the MS Loopback adapter) I have a second Virtual PC which also has Windows Server 2003. The network connection on this VPC is set to "Local Only". I want this VPC to get its IP address from the 1st VPC on which I setup as a DHCP server. What i want is the 2 VPC should be in a network with one of the VPC acting as the domain controller, DNS Server and DHCP server. The second VPC shoud get its IP address from the 1st VPC. It should be a part of the domain of the 1st VPC. When i tried to make the second VPC get the IP address from the first VPC I am not succeeding. Can somebody post some suggestions on how to go about this ?

    Read the article

  • Global Address List, Multiple All Address Lists in CN=Address Lists Container

    - by Jonathan
    When my colleges (that was way before my time here) updated Exchange 2000 to 2003 a English All Address Lists appeared in addition to the German variant. The English All Address Lists have German titled GAL below it. This has just been a cosmetic problem for the last few years. Now as we are in the process of rolling out Exchange 2010 this causes some issues. Exchange 2010 picked the wrong i.e. English Address Lists Container to use. In ADSI Editor we see CN=All Address Lists,CN=Address Lists Container,CN=exchange org,CN=Microsoft Exchange,CN=Services,CN=Configuration,DC=domain and CN=Alle Adresslisten,CN=Address Lists Container,CN=exchange org,CN=Microsoft Exchange,CN=Services,CN=Configuration,DC=domain. In the addressBookRoots attribute of CN=Microsoft Exchange,CN=Services,CN=Configuration,DC=domain both address lists were stored as values. We removed the English variant from addressBookRoots and restarted all (old and new) Exchange servers. User with mailboxes on the Exchange 2003 now only sees the German variant. Exchange 2010 is still stuck with the English/Mixed variant as are Users on Exchange 2010. Our goal would be to have Outlook display the German title of All Address Lists and get rid of the wrong Address Lists Container.

    Read the article

< Previous Page | 345 346 347 348 349 350 351 352 353 354 355 356  | Next Page >