Search Results

Search found 35441 results on 1418 pages for 'string hashing'.

Page 350/1418 | < Previous Page | 346 347 348 349 350 351 352 353 354 355 356 357  | Next Page >

  • Generic Dictionary - Getting Conversion Error

    - by pm_2
    The following code is giving me an error: // GetDirectoryList() returns Dictionary<string, DirectoryInfo> Dictionary<string, DirectoryInfo> myDirectoryList = GetDirectoryList(); // The following line gives a compile error foreach (Dictionary<string, DirectoryInfo> eachItem in myDirectoryList) The error it gives is as follows: Cannot convert type 'System.Collections.Generic.KeyValuePair<string,System.IO.DirectoryInfo>' to 'System.Collections.Generic.Dictionary<string,System.IO.DirectoryInfo>’ My question is: why is it trying to perform this conversion? Can I not use a foreach loop on this type of object?

    Read the article

  • suppose there is a class which contains 4 data fields.i have to read these value from xml file and s

    - by SunilRai86
    suppose there is a class which contains 4 fields.i have to read these value from xml file and set that value to fields the xml file is like that <Root> <Application > <AppName>somevalue</AppName> <IdMark>somevalue</IdMark> <ClassName>ABC</ClassName> <ExecName>XYZ</ExecName> </Application> <Application> <AppName>somevalue</AppName> <IdMark>somevalue</IdMark> <ClassName>abc</ClassName> <ExecName>xyz</ExecName> </Application> </Root> now i have to read all the values from xml file and set each value to particular fields. i hav done reading of the xml file and i saved the retrieved value in arraylist. the code is like that public class CXmlFileHook { string appname; string classname; string idmark; string execname; string ctor; public CXmlFileHook() { this.appname = "Not Set"; this.idmark = "Not Set"; this.classname = "Not Set"; this.execname = "Not Set"; this.ctor = "CXmlFileHook()"; } public void readFromXmlFile(string path) { XmlTextReader oRreader = new XmlTextReader(@"D:\\Documents and Settings\\sunilr\\Desktop\\MLPACK.xml"); //string[] strNodeValues = new string[4] { "?","?","?","?"}; ArrayList oArrayList = new ArrayList(); while (oRreader.Read()) { if (oRreader.NodeType == XmlNodeType.Element) { switch (oRreader.Name) { case "AppName": oRreader.Read(); //strNodeValues[0] =oRreader.Value; oArrayList.Add(oRreader.Value); break; case "IdMark": oRreader.Read(); //strNodeValues[1] = oRreader.Value; oArrayList.Add(oRreader.Value); break; case "ClassName": oRreader.Read(); //strNodeValues[2] = oRreader.Value; oArrayList.Add(oRreader.Value); break; case "ExecName": oRreader.Read(); //strNodeValues[3] = oRreader.Value; oArrayList.Add(oRreader.Value); break; } } } Console.WriteLine("Reading from arraylist"); Console.WriteLine("-------------------------"); for (int i = 0; i < oArrayList.Count; i++) { //Console.WriteLine("Reading from Sting[]"+ strNodeValues[i]); Console.WriteLine(oArrayList[i]); } //this.appname = strNodeValues[0]; //this.idmark = strNodeValues[1]; //this.classname = strNodeValues[2]; //this.execname = strNodeValues[3]; this.appname = oArrayList[0].ToString(); this.idmark = oArrayList[1].ToString(); this.classname = oArrayList[2].ToString(); this.execname = oArrayList[3].ToString(); } static string vInformation; public void showCurrentState(string path) { FileStream oFileStream = new FileStream(path, FileMode.Append, FileAccess.Write); StreamWriter oStreamWriter = new StreamWriter(oFileStream); oStreamWriter.WriteLine("****************************************************************"); oStreamWriter.WriteLine(" Log File "); oStreamWriter.WriteLine("****************************************************************"); CXmlFileHook oFilehook = new CXmlFileHook(); //Type t = Type.GetType(this._classname); //Type t = typeof(CConfigFileHook); DateTime oToday = DateTime.Now; vInformation += "Logfile created on : "; vInformation += oToday + Environment.NewLine; vInformation += "Public " + Environment.NewLine; vInformation += "----------------------------------------------" + Environment.NewLine; vInformation += "Private " + Environment.NewLine; vInformation += "-----------------------------------------------" + Environment.NewLine; vInformation += "ctor = " + this.ctor + Environment.NewLine; vInformation += "appname = " + this.appname + Environment.NewLine; vInformation += "idmark = " + this.idmark + Environment.NewLine; vInformation += "classname = " + this.classname + Environment.NewLine; vInformation += "execname = " + this.execname + Environment.NewLine; vInformation += "------------------------------------------------" + Environment.NewLine; vInformation += "Protected" + Environment.NewLine; vInformation += "------------------------------------------------" + Environment.NewLine; oStreamWriter.WriteLine(vInformation); oStreamWriter.Flush(); oStreamWriter.Close(); oFileStream.Close(); } } here i set set the fields according to arraylist index but i dont want is there any another solution for this....

    Read the article

  • Why does this MSDN example for Func<> delegate have a superfluous Select() call?

    - by Dan
    The MSDN gives this code example in the article on the Func Generic Delegate: Func<String, int, bool> predicate = ( str, index) => str.Length == index; String[] words = { "orange", "apple", "Article", "elephant", "star", "and" }; IEnumerable<String> aWords = words.Where(predicate).Select(str => str); foreach (String word in aWords) Console.WriteLine(word); I understand what all this is doing. What I don't understand is the Select(str => str) bit. Surely that's not needed? If you leave it out and just have IEnumerable<String> aWords = words.Where(predicate); then you still get an IEnumerable back that contains the same results, and the code prints the same thing. Am I missing something, or is the example misleading?

    Read the article

  • replace \n and \r\n with <br /> in java

    - by Bala R
    This has been asked several times for several languages but I can't get it to work. I have a string like this String str = "This is a string.\nThis is a long string."; And I'm trying to replace the \n with <br /> using str = str.replaceAll("(\r\n|\n)", "<br />"); but the \n is not getting replaced. I tried to use this RegEx Tool to verify and I see the same result. The input string does not have a match for "(\r\n|\n)". What am i doing wrong ?

    Read the article

  • Normalizing Strings using Regexes

    - by RasputinJones
    How do I match this string "1 & 2" from this string "Foo Bar 1 & 2"? How do I match this string "1, 2 & 3" from this string "Foo Baz 1, 2 & 3"? Trying to split out "Foo Bar" from the string using regexes while using the presence of "1 & 2" or "1, 2 & 3" as conditionals to normalize these strings into "Foo Bar 1" and "Foo Bar 2" or "Foo Baz 1", "Foo Baz 2" and "Foo Baz 3" respectively.

    Read the article

  • Passing parameters among views in a navigation frame INSIDE a custom control

    - by NetWriter
    I created a silverlight 3 application with a navigation frame and 3 views: search, add and edit. I used the app file to pass parameters among the 3 pages, eg: ((App)Application.Current).SNIPSELECTED = currentSnip; Then in the receiving page: currentSnip = ((App)Application.Current).SNIPSELECTED; currentSnip is a SnipItem object: public class SnipItem { public string itemID {get;set;} public string category {get;set;} public string itemDescription {get;set;} public string codeSnip {get;set;} } This worked fine until I decided to make this entire application into a user control and put that inside a second silverlight application with its own navigation frame and app file. The app files are getting confused. The first app file with all my parameter passing is not being read. I know how to pass a simple parameter between views in the first application without the app file (in a query string), but how about these custom types like my currentSnip above?

    Read the article

  • NSString inheritance

    - by Stef
    Hi, I'm doing an useless thing for my first step in Obj-C @interface String : NSString { int m_isnull; } - (id) init; - (int) isNull; @end @implementation String - (id) init { self = [super init]; m_isnull=1; return self; } - (int) isNull { return m_isnull; } @end test : String *a; a=@"ok"; Works fine, but just 2 little questions 1) When I'm compiling I have this warning warning: incompatible Objective-C types assigning 'struct NSString *', expected 'struct String *' I don't know how to avoid it !? 2) a=@"ok" is a fastest way to initialize a string, but when I'm debugging, I don't stop by at my init constructor why ?

    Read the article

  • Problem in populating a dictionary object using Enumerable.Range() (C#3.0)

    - by Newbie
    If I do for (int i = 0; i < appSettings.Count; i++) { string key = appSettings.Keys[i]; euFileDictionary.Add(key, appSettings[i]); } It is working fine. When I am trying the same thing using Enumerable.Range(0, appSettings.Count).Select(i => { string Key = appSettings.Keys[i]; string Value = appSettings[i]; euFileDictionary.Add(Key, Value); }).ToDictionary<string,string>(); I am getting a compile time error The type arguments for method 'System.Linq.Enumerable.Select(System.Collections.Generic.IEnumerable, System.Func)' cannot be inferred from the usage. Try specifying the type arguments explicitly. Any idea? Using C#3.0 Thanks

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • How to validate phone number(US format) in Java?

    - by Maxood
    I just want to know where am i wrong here: import java.io.*; class Tokens{ public static void main(String[] args) { //String[] result = "this is a test".split(""); String[] result = "4543 6546 6556".split(""); boolean flag= true; String num[] = {"0","1","2","3","4","5","6","7","8","9"}; String specialChars[] = {"-","@","#","*"," "}; for (int x=1; x<result.length; x++) { for (int y=0; y<num.length; y++) { if ((result[x].equals(num[y]))) { flag = false; continue; } else { flag = true; } if (flag == true) break; } if (flag == false) break; } System.out.println(flag); } }

    Read the article

  • parse json news feed array android

    - by user1827260
    I have an json feed from bbc in this format { "name": "ticker", "entries": [ { "headline": "text", "prompt": "LATEST", "isBreaking": "false", "mediaType": "Standard", "url": "" }, { "headline": "text", "prompt": "LATEST", "isBreaking": "false", "mediaType": "Standard", "url": "" }, etc........... My code is as follows: ArrayList mylist = new ArrayList(); JSONObject json = JSONfunctions.getJSONfromURL("http:/......"); try{ JSONArray item = json.getJSONArray("entries"); for (int i = 0; i<item.length(); i++) { HashMap<String, String> map = new HashMap<String, String>(); JSONObject e = item.getJSONObject(i); JSONObject title = e.JSONObject("headline"); map.put("title", "Title:" + e.getString("headline"); } It gives me the error "java.lang.String cannot be converted to JSONObject" I also tried leaving out JSONObject title = e.JSONObject("headline"); and it gives me a path error (note

    Read the article

  • Obtaining Index value of dictionary

    - by Maudise
    I have a piece of code which looks at the following public Test As Dictionary(Of String, String()) Which is brought in tester = New Dictionary(Of String, String()) tester.add("Key_EN", {"Option 1_EN", "Option 2_EN", "Option 3_EN"}) tester.add("Key_FR", {"Option 1_FR", "Option 2_FR", "Option 3_FR"}) tester.add("Key_DE", {"Option 1_DE", "Option 2_DE", "Option 3_DE"}) There's then a combo box which looks at the following dim Language as string Language = "_EN" ' note this is done by a drop down combo box to select _EN or _FR etc. cboTestBox.items.AddRange(tester("Key" & Language)) What I need to be able to do is to see what index position the answer is in and convert it back to the Key_EN. So, for example _DE is selected, then the options of "Option 1_DE", "Option 2_DE", "Option 3_DE" would be displayed. If they chose Option 3_DE then I need to be able to convert this to Option 3_EN. Many thanks Maudise

    Read the article

  • Python "string_escape" vs "unicode_escape"

    - by Mike Boers
    According to the docs, the builtin string encoding string_escape: Produce[s] a string that is suitable as string literal in Python source code ...while the unicode_escape: Produce[s] a string that is suitable as Unicode literal in Python source code So, they should have roughly the same behaviour. BUT, they appear to treat single quotes differently: >>> print """before '" \0 after""".encode('string-escape') before \'" \x00 after >>> print """before '" \0 after""".encode('unicode-escape') before '" \x00 after The string_escape escapes the single quote while the Unicode one does not. Is it safe to assume that I can simply: >>> escaped = my_string.encode('unicode-escape').replace("'", "\\'") ...and get the expected behaviour?

    Read the article

  • Java spliting strings

    - by N0b
    Hi I've got a Java problem. I'm trying split a string when ever a " " occurs, for example the sentence test abc. Then move the first letter in each word from first to last. I got the moving the letter to work on the original string using String text = JOptionPane.showInputDialog(null,"Skriv in en normal text:"); char firstLetter = text.charAt(0); normal = text.substring(1,text.length()+0) + firstLetter; So my question is how would I split the string then start moving the letters around in each part of the cut string? Thanks in advance

    Read the article

  • Validate NSString

    - by Chris
    I am validating an NSString to ensure that the string does not contain apostrophes. The code I'm using to do this is NSCharacterSet * invalidNumberSet = [NSCharacterSet characterSetWithCharactersInString:@"'"]; NSScanner * scanner = [NSScanner scannerWithString:string]; NSString * scannerResult; [scanner setCharactersToBeSkipped:nil]; [scanner scanUpToCharactersFromSet:invalidNumberSet intoString:&scannerResult]; if(![string isEqualToString:scannerResult]) { return 2; } Returning 2 represents an error. This code works, except for the case where the string is an apostrophe. To get around this issue, I added the following code above the preceding block. if([string isEqualToString:@"'"]); { return 2; } This code is evaluating to true, regardless of the input. I need to either prevent the first block from crashing with the input of ', or get the second block to work. What am I missing?

    Read the article

  • programming help

    - by user208639
    class Person holds personal data Its constructor receives 3 parameters, two Strings representing first and last names and an int representing age public Person(String firstName, String lastName, int age) { its method getName has no parameters and returns a String with format "Lastname, Firstname" its method getAge takes no parameters and returns an int representing the current age its method birthday increases age value by 1 and returns the new age value Create the class Person and paste the whole class into the textbox below public class Person { public Person(String first, String last, int age) { getName = "Lastname, Firstname"; System.out.print(last + first); getAge = age + 1; return getAge; System.out.print(getAge); birthday = age + 1; newAge = birthday; return newAge; } } im getting errors such as "cannot find symbol - variable getName" but when i declare a variable it still not working, i also wanted to ask if i am heading in the right direction or is it all totally wrong? im using a program called BlueJ to work on.

    Read the article

  • Android strange behavior with listview and custom cursor adapter

    - by Michael Little
    I have a problem with a list view and a custom cursor adapter and I just can't seem to figure out what is wrong with my code. Basically, in my activity I call initalize() that does a bunch of stuff to handle getting the proper data and initializing the listview. On first run of the activity you can see from the images that one of the items is missing from the list. If I go to another activity and go back to this activity the item that was missing shows up. I believe it has something to do with setContentView(R.layout.parent). If I move that to my initialize() then the item never shows up even when returning from another activity. So, for some reason, returning from another activity bypasses setContentView(R.layout.parent) and everything works fine. I know it's impossible for me to bypass setContentView(R.layout.parent) so I need to figure out what the problem is. Also, I did not include the layout because it is nothing more then two textviews. Also, the images I have attached do not show that the missing item is the last one on the list. Custom Cursor Adapter: public class CustomCursorAdapter extends SimpleCursorAdapter { private Context context; private int layout; public CustomCursorAdapter (Context context, int layout, Cursor c, String[] from, int[] to) { super(context, layout, c, from, to); this.context = context; this.layout = layout; } public View newView(Context context, Cursor cursor, ViewGroup parent) { LayoutInflater inflater = LayoutInflater.from(context); final View view = inflater.inflate(layout, parent, false); return view; } @Override public void bindView(View v, Context context, Cursor c) { if (c.getColumnName(0).matches("section")){ int nameCol = c.getColumnIndex("section"); String section = c.getString(nameCol); TextView section_text = (TextView) v.findViewById(R.id.text1); if ((section.length() > 0)) { section_text.setText(section); } else { //so we don't have an empty spot section_text.setText(""); section_text.setVisibility(2); section_text.setHeight(1); } } else if (c.getColumnName(0).matches("code")) { int nameCol = c.getColumnIndex("code"); String mCode = c.getString(nameCol); TextView code_text = (TextView) v.findViewById(R.id.text1); if (code_text != null) { int i = 167; byte[] data = {(byte) i}; String strSymbol = EncodingUtils.getString(data, "windows-1252"); mCode = strSymbol + " " + mCode; code_text.setText(mCode); code_text.setSingleLine(); } } if (c.getColumnName(1).matches("title")){ int nameCol = c.getColumnIndex("title"); String mTitle = c.getString(nameCol); TextView title_text = (TextView) v.findViewById(R.id.text2); if (title_text != null) { title_text.setText(mTitle); } } else if (c.getColumnName(1).matches("excerpt")) { int nameCol = c.getColumnIndex("excerpt"); String mExcerpt = c.getString(nameCol); TextView excerpt_text = (TextView) v.findViewById(R.id.text2); if (excerpt_text != null) { excerpt_text.setText(mExcerpt); excerpt_text.setSingleLine(); } } } The Activity: public class parent extends ListActivity { private static String[] TITLE_FROM = { SECTION, TITLE, _ID, }; private static String[] CODE_FROM = { CODE, EXCERPT, _ID, }; private static String ORDER_BY = _ID + " ASC"; private static int[] TO = { R.id.text1, R.id.text2, }; String breadcrumb = null; private MyData data; private SQLiteDatabase db; CharSequence parent_id = ""; @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); data = new MyData(this); db = data.getReadableDatabase(); setContentView(R.layout.parent); initialize(); } public void initialize() { breadcrumb = null; Bundle bun = getIntent().getExtras(); TextView tvBreadCrumb; tvBreadCrumb = (TextView)findViewById(R.id.breadcrumb); if (bun == null) { //this is the first run tvBreadCrumb.setText(null); tvBreadCrumb.setHeight(0); parent_id = "0"; try { Cursor cursor = getData(parent_id); showSectionData(cursor); } finally { data.close(); } } else { CharSequence state = bun.getString("state"); breadcrumb = bun.getString("breadcrumb"); tvBreadCrumb.setText(breadcrumb); CharSequence code = bun.getString("code"); parent_id = code; if (state.equals("chapter")) { try { Cursor cursor = getData(parent_id); showSectionData(cursor); } finally { data.close(); } } else if (state.equals("code")) { try { Cursor cursor = getCodeData(parent_id); showCodeData(cursor); } finally { data.close(); } } } } @Override public void onStart() { //initialize(); super.onResume(); } @Override public void onResume() { initialize(); super.onResume(); } private Cursor getData(CharSequence parent_id) { Cursor cTitles = db.query(TITLES_TABLE_NAME, TITLE_FROM, "parent_id = " + parent_id, null, null, null, ORDER_BY); Cursor cCodes = db.query(CODES_TABLE_NAME, CODE_FROM, "parent_id = " + parent_id, null, null, null, ORDER_BY); Cursor[] c = {cTitles, cCodes}; Cursor cursor = new MergeCursor(c); startManagingCursor(cursor); return cursor; } private Cursor getCodeData(CharSequence parent_id2) { Bundle bun = getIntent().getExtras(); CharSequence intent = bun.getString("intent"); CharSequence searchtype = bun.getString("searchtype"); //SQLiteDatabase db = data.getReadableDatabase(); if (intent != null) { String sWhere = null; if(searchtype.equals("code")) { sWhere = "code LIKE '%"+parent_id2+"%'"; } else if(searchtype.equals("within")){ sWhere = "definition LIKE '%"+parent_id2+"%'"; } //This is a search request Cursor cursor = db.query(CODES_TABLE_NAME, CODE_FROM, sWhere, null, null, null, ORDER_BY); startManagingCursor(cursor); return cursor; } else { Cursor cursor = db.query(CODES_TABLE_NAME, CODE_FROM, "parent_id = "+ parent_id2, null, null, null, ORDER_BY); startManagingCursor(cursor); return cursor; } } private void showSectionData(Cursor cursor) { CustomCursorAdapter adapter= new CustomCursorAdapter(this, R.layout.item, cursor, TITLE_FROM, TO); setListAdapter(adapter); } private void showCodeData(Cursor cursor) { CustomCursorAdapter adapter = new CustomCursorAdapter(this, R.layout.item, cursor, CODE_FROM, TO); setListAdapter(adapter); Bundle bun = getIntent().getExtras(); CharSequence intent = bun.getString("intent"); if (intent != null) { Cursor cursor1 = ((CursorAdapter)getListAdapter()).getCursor(); startManagingCursor(cursor1); TextView tvBreadCrumb; tvBreadCrumb = (TextView)findViewById(R.id.breadcrumb); tvBreadCrumb.setText(cursor1.getCount() + " Records Found"); //cursor1.close(); //mdl } }

    Read the article

  • Programming an Android Button to update EditText views

    - by bergler77
    Ok guys, I have a button in android that i'm trying to use to update 8 EditText Views with different random numbers. Everything works up until I click the button. It appears I am missing a resource according to the debugger, but I'm not sure what. I've tried several different ways of implementing the button. Here is what I have after looking at several posts. import java.util.Random; import android.os.Bundle; import android.view.View; import android.view.View.OnClickListener; import android.widget.Button; import android.widget.EditText; public class MyCharNewChar extends MyCharActivity { private OnClickListener randomButtonListener = new OnClickListener(){ public void onClick(View v) { //Button creates a set of random numbers and updates the values //of the EditText views. Random rand = new Random(); int STR = 1 + rand.nextInt(12); int AGI = 1 + rand.nextInt(12); int DEX = 1 + rand.nextInt(12); int WIS = 1 + rand.nextInt(12); int INT = 1 + rand.nextInt(12); int CON = 1 + rand.nextInt(12); int HP = 1 + rand.nextInt(20); int AC = 1 + rand.nextInt(6); EditText str = (EditText) findViewById(R.id.str); str.setText(STR); EditText agi = (EditText) findViewById(R.id.agi); agi.setText(AGI); EditText dex = (EditText) findViewById(R.id.dex); dex.setText(DEX); EditText wis = (EditText) findViewById(R.id.wis); wis.setText(WIS); EditText intel = (EditText) findViewById(R.id.intel); intel.setText(INT); EditText con = (EditText) findViewById(R.id.con); con.setText(CON); EditText hp = (EditText) findViewById(R.id.baseHP); hp.setText(HP); EditText ac = (EditText) findViewById(R.id.baseAC); ac.setText(AC); } }; @Override public void onCreate(Bundle savedInstanceState){ super.onCreate(savedInstanceState); setContentView(R.layout.newchar); Button randomButton = (Button) findViewById(R.id.randomButton); randomButton.setOnClickListener(randomButtonListener); } } Here is the xml: <?xml version="1.0" encoding="utf-8"?> <LinearLayout xmlns:android="http://schemas.android.com/apk/res/android" android:id="@+id/linearlayoutNew1" android:layout_width="match_parent" android:layout_height="match_parent" android:orientation="vertical" android:background="@drawable/background" > <TextView android:id="@+id/newCharLabel" android:layout_width="match_parent" android:layout_height="wrap_content" android:text="@string/new_character_screen" android:textSize="24dp" android:textColor="@color/splash" android:textStyle="bold" android:gravity="center"/> <TextView android:id="@+id/nameLabel" android:layout_width="match_parent" android:layout_height="wrap_content" android:text="@string/nameLabel" android:textSize="18dp" android:textColor="@color/splash"/> <EditText android:id="@+id/editText1" android:layout_width="match_parent" android:layout_height="wrap_content" android:ems="10" android:inputType="textPersonName" > <requestFocus /> </EditText> <TableLayout android:id="@+id/statsLayout" android:layout_width="match_parent" android:layout_height="wrap_content" android:padding="5dp"> <TableRow android:id="@+id/tableRow01" android:orientation="horizontal" android:layout_width="match_parent" android:layout_height="wrap_content" android:padding="5dp"> <TextView android:id="@+id/strLabel" android:layout_width="wrap_content" android:layout_height="wrap_content" android:text="@string/strLabel" android:textSize="18dp" android:textColor="@color/splash"/> <EditText android:id="@+id/str" android:layout_width="wrap_content" android:layout_height="wrap_content" android:ems="3" android:inputType="number" /> <TextView android:id="@+id/agiLabel" android:layout_width="wrap_content" android:layout_height="wrap_content" android:text="@string/agiLabel" android:textSize="18dp" android:textColor="@color/splash"/> <EditText android:id="@+id/agi" android:layout_width="wrap_content" android:layout_height="wrap_content" android:ems="3" android:inputType="number"/> <TextView android:id="@+id/dexLabel" android:layout_width="wrap_content" android:layout_height="wrap_content" android:text="@string/dexLabel" android:textSize="18dp" android:textColor="@color/splash"/> <EditText android:id="@+id/dex" android:layout_width="wrap_content" android:layout_height="wrap_content" android:ems="3" android:inputType="number"/> </TableRow> <TableRow android:id="@+id/tableRow02" android:orientation="horizontal" android:layout_width="match_parent" android:layout_height="wrap_content" android:padding="5dp"> <TextView android:id="@+id/intLabel" android:layout_width="wrap_content" android:layout_height="wrap_content" android:text="@string/intLabel" android:textSize="18dp" android:textColor="@color/splash"/> <EditText android:id="@+id/intel" android:layout_width="wrap_content" android:layout_height="wrap_content" android:ems="3" android:inputType="number"/> <TextView android:id="@+id/wisLabel" android:layout_width="wrap_content" android:layout_height="wrap_content" android:text="@string/wisLabel" android:textSize="18dp" android:textColor="@color/splash"/> <EditText android:id="@+id/wis" android:layout_width="wrap_content" android:layout_height="wrap_content" android:ems="3" android:inputType="number"/> <TextView android:id="@+id/conLabel" android:layout_width="wrap_content" android:layout_height="wrap_content" android:text="@string/conLabel" android:textSize="18dp" android:textColor="@color/splash"/> <EditText android:id="@+id/con" android:layout_width="wrap_content" android:layout_height="wrap_content" android:ems="3" android:inputType="number"/> </TableRow> </TableLayout> <LinearLayout android:id="@+id/linearlayoutNew02" android:layout_width="match_parent" android:layout_height="wrap_content" android:padding="5dp" android:gravity="center"> <TextView android:id="@+id/baseHPLabel" android:layout_width="wrap_content" android:layout_height="wrap_content" android:text="@string/hpLabel" android:textSize="18dp" android:textColor="@color/splash"/> <EditText android:id="@+id/baseHP" android:layout_width="wrap_content" android:layout_height="wrap_content" android:ems="3" android:inputType="number"/> <TextView android:id="@+id/baseACLabel" android:layout_width="wrap_content" android:layout_height="wrap_content" android:text="@string/acLabel" android:textSize="18dp" android:textColor="@color/splash"/> <EditText android:id="@+id/baseAC" android:layout_width="wrap_content" android:layout_height="wrap_content" android:ems="3" android:inputType="number"/> </LinearLayout> <LinearLayout android:id="@+id/linearlayoutNew03" android:layout_width="match_parent" android:layout_height="wrap_content" android:orientation="horizontal"> <Button android:id="@+id/randomButton" android:layout_width="0dp" android:layout_height="wrap_content" android:layout_weight="1" android:text="@string/randomButton" android:textSize="16dp" android:clickable="true"/> </LinearLayout> </LinearLayout> I have also tried setting the onClick in xml to setup a specific onClick method. Still the same error so I must have a problem elsewhere. Any suggestions would be great!

    Read the article

  • parseInt and viewflipper layout problems

    - by user1234167
    I have a problem with parseInt it throws the error: unable to parse 'null' as integer. My view flipper is also not working. Hopefully this is an easy enough question. Here is my activity: import javax.xml.parsers.SAXParser; import javax.xml.parsers.SAXParserFactory; import org.xml.sax.InputSource; import org.xml.sax.XMLReader; import android.app.Activity; import android.graphics.Color; import android.os.Bundle; import android.util.Log; import android.view.View; import android.view.View.OnClickListener; import android.widget.Button; import android.widget.LinearLayout; import android.widget.TextView; import android.widget.ViewFlipper; import xml.parser.dataset; public class XmlParserActivity extends Activity implements OnClickListener { private final String MY_DEBUG_TAG = "WeatherForcaster"; // private dataset myDataSet; private LinearLayout layout; private int temp= 0; /** Called when the activity is first created. */ //the ViewSwitcher private Button btn; private ViewFlipper flip; // private TextView tv; @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.main); layout=(LinearLayout)findViewById(R.id.linearlayout1); btn=(Button)findViewById(R.id.btn); btn.setOnClickListener(this); flip=(ViewFlipper)findViewById(R.id.flip); //when a view is displayed flip.setInAnimation(this,android.R.anim.fade_in); //when a view disappears flip.setOutAnimation(this, android.R.anim.fade_out); // String postcode = null; // public String getPostcode { // return postcode; // } //URL newUrl = c; // myweather.setText(c.toString()); /* Create a new TextView to display the parsingresult later. */ TextView tv = new TextView(this); // run(0); //WeatherApplicationActivity postcode = new WeatherApplicationActivity(); try { /* Create a URL we want to load some xml-data from. */ URL url = new URL("http://new.myweather2.com/developer/forecast.ashx?uac=gcV3ynNdoV&output=xml&query=G41"); //String url = new String("http://new.myweather2.com/developer/forecast.ashx?uac=gcV3ynNdoV&output=xml&query="+WeatherApplicationActivity.postcode ); //URL url = new URL(url); //url.toString( ); //myString(url.toString() + WeatherApplicationActivity.getString(postcode)); // url + WeatherApplicationActivity.getString(postcode); /* Get a SAXParser from the SAXPArserFactory. */ SAXParserFactory spf = SAXParserFactory.newInstance(); SAXParser sp = spf.newSAXParser(); /* Get the XMLReader of the SAXParser we created. */ XMLReader xr = sp.getXMLReader(); /* Create a new ContentHandler and apply it to the XML-Reader*/ handler myHandler = new handler(); xr.setContentHandler(myHandler); /* Parse the xml-data from our URL. */ xr.parse(new InputSource(url.openStream())); /* Parsing has finished. */ /* Our ExampleHandler now provides the parsed data to us. */ dataset parsedDataSet = myHandler.getParsedData(); /* Set the result to be displayed in our GUI. */ tv.setText(parsedDataSet.toString()); } catch (Exception e) { /* Display any Error to the GUI. */ tv.setText("Error: " + e.getMessage()); Log.e(MY_DEBUG_TAG, "WeatherQueryError", e); } temp = Integer.parseInt(xml.parser.dataset.getTemp()); if(temp <0){ //layout.setBackgroundColor(Color.BLUE); //layout.setBackgroundColor(getResources().getColor(R.color.silver)); findViewById(R.id.flip).setBackgroundColor(Color.BLUE); } else if(temp > 0 && temp < 9) { //layout.setBackgroundColor(Color.GREEN); //layout.setBackgroundColor(getResources().getColor(R.color.silver)); findViewById(R.id.flip).setBackgroundColor(Color.GREEN); } else { //layout.setBackgroundColor(Color.YELLOW); //layout.setBackgroundColor(getResources().getColor(R.color.silver)); findViewById(R.id.flip).setBackgroundColor(Color.YELLOW); } /* Display the TextView. */ this.setContentView(tv); } @Override public void onClick(View arg0) { // TODO Auto-generated method stub onClick(View arg0) { // TODO Auto-generated method stub flip.showNext(); //specify flipping interval //flip.setFlipInterval(1000); //flip.startFlipping(); } } this is my dataset: package xml.parser; public class dataset { static String temp = null; // private int extractedInt = 0; public static String getTemp() { return temp; } public void setTemp(String temp) { this.temp = temp; } this is my handler: public void characters(char ch[], int start, int length) { if(this.in_temp){ String setTemp = new String(ch, start, length); // myParsedDataSet.setTempUnit(new String(ch, start, length)); // myParsedDataSet.setTemp; } the dataset and handler i only pasted the code that involves the temp as i no they r working when i take out the if statement. However even then my viewflipper wont work. This is my main xml: <?xml version="1.0" encoding="utf-8"?> <LinearLayout xmlns:android="http://schemas.android.com/apk/res/android" android:orientation="vertical" android:layout_width="fill_parent" android:layout_height="fill_parent" android:id="@+id/linearlayout1" > <TextView android:layout_width="fill_parent" android:layout_height="wrap_content" android:textSize="25dip" android:text="Flip Example" /> <TextView android:layout_width="fill_parent" android:layout_height="wrap_content" android:textSize="25dip" android:id="@+id/tv" /> <Button android:layout_width="wrap_content" android:layout_height="wrap_content" android:textSize="25dip" android:text="Flip" android:id="@+id/btn" android:onClick="ClickHandler" /> <ViewFlipper android:layout_width="fill_parent" android:layout_height="fill_parent" android:id="@+id/flip"> <LinearLayout android:orientation="vertical" android:layout_width="fill_parent" android:layout_height="fill_parent" > <TextView android:layout_width="fill_parent" android:layout_height="wrap_content" android:textSize="25dip" android:text="Item1a" /> </LinearLayout> <TextView android:layout_width="fill_parent" android:layout_height="wrap_content" android:textSize="25dip" android:id="@+id/tv2" /> </ViewFlipper> </LinearLayout> this is my logcat: 04-01 18:02:24.744: E/AndroidRuntime(7331): FATAL EXCEPTION: main 04-01 18:02:24.744: E/AndroidRuntime(7331): java.lang.RuntimeException: Unable to start activity ComponentInfo{xml.parser/xml.parser.XmlParserActivity}: java.lang.NumberFormatException: unable to parse 'null' as integer 04-01 18:02:24.744: E/AndroidRuntime(7331): at android.app.ActivityThread.performLaunchActivity(ActivityThread.java:1830) 04-01 18:02:24.744: E/AndroidRuntime(7331): at android.app.ActivityThread.handleLaunchActivity(ActivityThread.java:1851) 04-01 18:02:24.744: E/AndroidRuntime(7331): at android.app.ActivityThread.access$1500(ActivityThread.java:132) 04-01 18:02:24.744: E/AndroidRuntime(7331): at android.app.ActivityThread$H.handleMessage(ActivityThread.java:1038) 04-01 18:02:24.744: E/AndroidRuntime(7331): at android.os.Handler.dispatchMessage(Handler.java:99) 04-01 18:02:24.744: E/AndroidRuntime(7331): at android.os.Looper.loop(Looper.java:150) 04-01 18:02:24.744: E/AndroidRuntime(7331): at android.app.ActivityThread.main(ActivityThread.java:4293) 04-01 18:02:24.744: E/AndroidRuntime(7331): at java.lang.reflect.Method.invokeNative(Native Method) 04-01 18:02:24.744: E/AndroidRuntime(7331): at java.lang.reflect.Method.invoke(Method.java:507) 04-01 18:02:24.744: E/AndroidRuntime(7331): at com.android.internal.os.ZygoteInit$MethodAndArgsCaller.run(ZygoteInit.java:849) 04-01 18:02:24.744: E/AndroidRuntime(7331): at com.android.internal.os.ZygoteInit.main(ZygoteInit.java:607) 04-01 18:02:24.744: E/AndroidRuntime(7331): at dalvik.system.NativeStart.main(Native Method) 04-01 18:02:24.744: E/AndroidRuntime(7331): Caused by: java.lang.NumberFormatException: unable to parse 'null' as integer 04-01 18:02:24.744: E/AndroidRuntime(7331): at java.lang.Integer.parseInt(Integer.java:356) 04-01 18:02:24.744: E/AndroidRuntime(7331): at java.lang.Integer.parseInt(Integer.java:332) 04-01 18:02:24.744: E/AndroidRuntime(7331): at xml.parser.XmlParserActivity.onCreate(XmlParserActivity.java:118) 04-01 18:02:24.744: E/AndroidRuntime(7331): at android.app.Instrumentation.callActivityOnCreate(Instrumentation.java:1072) 04-01 18:02:24.744: E/AndroidRuntime(7331): at android.app.ActivityThread.performLaunchActivity(ActivityThread.java:1794) I hope I have given enough information about my problems. I will be extremely grateful if anyone can help me out.

    Read the article

  • Sorting and Re-arranging List of HashMaps

    - by HonorGod
    I have a List which is straight forward representation of a database table. I am trying to sort and apply some magic after the data is loaded into List of HashMaps. In my case this is the only hard and fast way of doing it becoz I have a rules engine that actually updates the values in the HashMap after several computations. Here is a sample data representation of the HashMap (List of HashMap) - {fromDate=Wed Mar 17 10:54:12 EDT 2010, eventId=21, toDate=Tue Mar 23 10:54:12 EDT 2010, actionId=1234} {fromDate=Wed Mar 17 10:54:12 EDT 2010, eventId=11, toDate=Wed Mar 17 10:54:12 EDT 2010, actionId=456} {fromDate=Sat Mar 20 10:54:12 EDT 2010, eventId=20, toDate=Thu Apr 01 10:54:12 EDT 2010, actionId=1234} {fromDate=Wed Mar 24 10:54:12 EDT 2010, eventId=22, toDate=Sat Mar 27 10:54:12 EDT 2010, actionId=1234} {fromDate=Wed Mar 17 10:54:12 EDT 2010, eventId=11, toDate=Fri Mar 26 10:54:12 EDT 2010, actionId=1234} {fromDate=Sat Mar 20 10:54:12 EDT 2010, eventId=11, toDate=Wed Mar 31 10:54:12 EDT 2010, actionId=1234} {fromDate=Mon Mar 15 10:54:12 EDT 2010, eventId=12, toDate=Wed Mar 17 10:54:12 EDT 2010, actionId=567} I am trying to achieve couple of things - 1) Sort the list by actionId and eventId after which the data would look like - {fromDate=Wed Mar 17 10:54:12 EDT 2010, eventId=11, toDate=Wed Mar 17 10:54:12 EDT 2010, actionId=456} {fromDate=Mon Mar 15 10:54:12 EDT 2010, eventId=12, toDate=Wed Mar 17 10:54:12 EDT 2010, actionId=567} {fromDate=Wed Mar 24 10:54:12 EDT 2010, eventId=22, toDate=Sat Mar 27 10:54:12 EDT 2010, actionId=1234} {fromDate=Wed Mar 17 10:54:12 EDT 2010, eventId=21, toDate=Tue Mar 23 10:54:12 EDT 2010, actionId=1234} {fromDate=Sat Mar 20 10:54:12 EDT 2010, eventId=20, toDate=Thu Apr 01 10:54:12 EDT 2010, actionId=1234} {fromDate=Wed Mar 17 10:54:12 EDT 2010, eventId=11, toDate=Fri Mar 26 10:54:12 EDT 2010, actionId=1234} {fromDate=Sat Mar 20 10:54:12 EDT 2010, eventId=11, toDate=Wed Mar 31 10:54:12 EDT 2010, actionId=1234} 2) If we group the above list by actionId they would be resolved into 3 groups - actionId=1234, actionId=567 and actionId=456. Now here is my question - For each group having the same eventId, I need to update the records so that they have wider fromDate to toDate. Meaning, if you consider the last two rows they have same actionId = 1234 and same eventId = 11. Now we can to pick the least fromDate from those 2 records which is Wed Mar 17 10:54:12 and farther toDate which is Wed Mar 31 10:54:12 and update those 2 record's fromDate and toDate to Wed Mar 17 10:54:12 and Wed Mar 31 10:54:12 respectively. Any ideas? PS: I already have some pseudo code to start with. import java.util.ArrayList; import java.util.Calendar; import java.util.Collections; import java.util.Comparator; import java.util.Date; import java.util.HashMap; import java.util.List; import org.apache.commons.lang.builder.CompareToBuilder; public class Tester { boolean ascending = true ; boolean sortInstrumentIdAsc = true ; boolean sortEventTypeIdAsc = true ; public static void main(String args[]) { Tester tester = new Tester() ; tester.printValues() ; } public void printValues () { List<HashMap<String,Object>> list = new ArrayList<HashMap<String,Object>>() ; HashMap<String,Object> map = new HashMap<String,Object>(); map.put("actionId", new Integer(1234)) ; map.put("eventId", new Integer(21)) ; map.put("fromDate", getDate(1) ) ; map.put("toDate", getDate(7) ) ; list.add(map); map = new HashMap<String,Object>(); map.put("actionId", new Integer(456)) ; map.put("eventId", new Integer(11)) ; map.put("fromDate", getDate(1)) ; map.put("toDate", getDate(1) ) ; list.add(map); map = new HashMap<String,Object>(); map.put("actionId", new Integer(1234)) ; map.put("eventId", new Integer(20)) ; map.put("fromDate", getDate(4) ) ; map.put("toDate", getDate(16) ) ; list.add(map); map = new HashMap<String,Object>(); map.put("actionId", new Integer(1234)) ; map.put("eventId", new Integer(22)) ; map.put("fromDate",getDate(8) ) ; map.put("toDate", getDate(11)) ; list.add(map); map = new HashMap<String,Object>(); map.put("actionId", new Integer(1234)) ; map.put("eventId", new Integer(11)) ; map.put("fromDate",getDate(1) ) ; map.put("toDate", getDate(10) ) ; list.add(map); map = new HashMap<String,Object>(); map.put("actionId", new Integer(1234)) ; map.put("eventId", new Integer(11)) ; map.put("fromDate",getDate(4) ) ; map.put("toDate", getDate(15) ) ; list.add(map); map = new HashMap<String,Object>(); map.put("actionId", new Integer(567)) ; map.put("eventId", new Integer(12)) ; map.put("fromDate", getDate(-1) ) ; map.put("toDate",getDate(1)) ; list.add(map); System.out.println("\n Before Sorting \n "); for(int j = 0 ; j < list.size() ; j ++ ) System.out.println(list.get(j)); Collections.sort ( list , new HashMapComparator2 () ) ; System.out.println("\n After Sorting \n "); for(int j = 0 ; j < list.size() ; j ++ ) System.out.println(list.get(j)); } public static Date getDate(int days) { Calendar cal = Calendar.getInstance(); cal.setTime(new Date()); cal.add(Calendar.DATE, days); return cal.getTime() ; } public class HashMapComparator2 implements Comparator { public int compare ( Object object1 , Object object2 ) { if ( ascending == true ) { return new CompareToBuilder() .append(( ( HashMap ) object1 ).get ( "actionId" ), ( ( HashMap ) object2 ).get ( "actionId" )) .append(( ( HashMap ) object2 ).get ( "eventId" ), ( ( HashMap ) object1 ).get ( "eventId" )) .toComparison(); } else { return new CompareToBuilder() .append(( ( HashMap ) object2 ).get ( "actionId" ), ( ( HashMap ) object1 ).get ( "actionId" )) .append(( ( HashMap ) object2 ).get ( "eventId" ), ( ( HashMap ) object1 ).get ( "eventId" )) .toComparison(); } } } }

    Read the article

  • Azure Diagnostics wrt Custom Logs and honoring scheduledTransferPeriod

    - by kjsteuer
    I have implemented my own TraceListener similar to http://blogs.technet.com/b/meamcs/archive/2013/05/23/diagnostics-of-cloud-services-custom-trace-listener.aspx . One thing I noticed is that that logs show up immediately in My Azure Table Storage. I wonder if this is expected with Custom Trace Listeners or because I am in a development environment. My diagnosics.wadcfg <?xml version="1.0" encoding="utf-8"?> <DiagnosticMonitorConfiguration configurationChangePollInterval="PT1M""overallQuotaInMB="4096" xmlns="http://schemas.microsoft.com/ServiceHosting/2010/10/DiagnosticsConfiguration"> <DiagnosticInfrastructureLogs scheduledTransferLogLevelFilter="Information" /> <Directories scheduledTransferPeriod="PT1M"> <IISLogs container="wad-iis-logfiles" /> <CrashDumps container="wad-crash-dumps" /> </Directories> <Logs bufferQuotaInMB="0" scheduledTransferPeriod="PT30M" scheduledTransferLogLevelFilter="Information" /> </DiagnosticMonitorConfiguration> I have changed my approach a bit. Now I am defining in the web config of my webrole. I notice when I set autoflush to true in the webconfig, every thing works but scheduledTransferPeriod is not honored because the flush method pushes to the table storage. I would like to have scheduleTransferPeriod trigger the flush or trigger flush after a certain number of log entries like the buffer is full. Then I can also flush on server shutdown. Is there any method or event on the CustomTraceListener where I can listen to the scheduleTransferPeriod? <system.diagnostics> <!--http://msdn.microsoft.com/en-us/library/sk36c28t(v=vs.110).aspx By default autoflush is false. By default useGlobalLock is true. While we try to be threadsafe, we keep this default for now. Later if we would like to increase performance we can remove this. see http://msdn.microsoft.com/en-us/library/system.diagnostics.trace.usegloballock(v=vs.110).aspx --> <trace> <listeners> <add name="TableTraceListener" type="Pos.Services.Implementation.TableTraceListener, Pos.Services.Implementation" /> <remove name="Default" /> </listeners> </trace> </system.diagnostics> I have modified the custom trace listener to the following: namespace Pos.Services.Implementation { class TableTraceListener : TraceListener { #region Fields //connection string for azure storage readonly string _connectionString; //Custom sql storage table for logs. //TODO put in config readonly string _diagnosticsTable; [ThreadStatic] static StringBuilder _messageBuffer; readonly object _initializationSection = new object(); bool _isInitialized; CloudTableClient _tableStorage; readonly object _traceLogAccess = new object(); readonly List<LogEntry> _traceLog = new List<LogEntry>(); #endregion #region Constructors public TableTraceListener() : base("TableTraceListener") { _connectionString = RoleEnvironment.GetConfigurationSettingValue("DiagConnection"); _diagnosticsTable = RoleEnvironment.GetConfigurationSettingValue("DiagTableName"); } #endregion #region Methods /// <summary> /// Flushes the entries to the storage table /// </summary> public override void Flush() { if (!_isInitialized) { lock (_initializationSection) { if (!_isInitialized) { Initialize(); } } } var context = _tableStorage.GetTableServiceContext(); context.MergeOption = MergeOption.AppendOnly; lock (_traceLogAccess) { _traceLog.ForEach(entry => context.AddObject(_diagnosticsTable, entry)); _traceLog.Clear(); } if (context.Entities.Count > 0) { context.BeginSaveChangesWithRetries(SaveChangesOptions.None, (ar) => context.EndSaveChangesWithRetries(ar), null); } } /// <summary> /// Creates the storage table object. This class does not need to be locked because the caller is locked. /// </summary> private void Initialize() { var account = CloudStorageAccount.Parse(_connectionString); _tableStorage = account.CreateCloudTableClient(); _tableStorage.GetTableReference(_diagnosticsTable).CreateIfNotExists(); _isInitialized = true; } public override bool IsThreadSafe { get { return true; } } #region Trace and Write Methods /// <summary> /// Writes the message to a string buffer /// </summary> /// <param name="message">the Message</param> public override void Write(string message) { if (_messageBuffer == null) _messageBuffer = new StringBuilder(); _messageBuffer.Append(message); } /// <summary> /// Writes the message with a line breaker to a string buffer /// </summary> /// <param name="message"></param> public override void WriteLine(string message) { if (_messageBuffer == null) _messageBuffer = new StringBuilder(); _messageBuffer.AppendLine(message); } /// <summary> /// Appends the trace information and message /// </summary> /// <param name="eventCache">the Event Cache</param> /// <param name="source">the Source</param> /// <param name="eventType">the Event Type</param> /// <param name="id">the Id</param> /// <param name="message">the Message</param> public override void TraceEvent(TraceEventCache eventCache, string source, TraceEventType eventType, int id, string message) { base.TraceEvent(eventCache, source, eventType, id, message); AppendEntry(id, eventType, eventCache); } /// <summary> /// Adds the trace information to a collection of LogEntry objects /// </summary> /// <param name="id">the Id</param> /// <param name="eventType">the Event Type</param> /// <param name="eventCache">the EventCache</param> private void AppendEntry(int id, TraceEventType eventType, TraceEventCache eventCache) { if (_messageBuffer == null) _messageBuffer = new StringBuilder(); var message = _messageBuffer.ToString(); _messageBuffer.Length = 0; if (message.EndsWith(Environment.NewLine)) message = message.Substring(0, message.Length - Environment.NewLine.Length); if (message.Length == 0) return; var entry = new LogEntry() { PartitionKey = string.Format("{0:D10}", eventCache.Timestamp >> 30), RowKey = string.Format("{0:D19}", eventCache.Timestamp), EventTickCount = eventCache.Timestamp, Level = (int)eventType, EventId = id, Pid = eventCache.ProcessId, Tid = eventCache.ThreadId, Message = message }; lock (_traceLogAccess) _traceLog.Add(entry); } #endregion #endregion } }

    Read the article

  • Ajax, Callback, postback and Sys.WebForms.PageRequestManager.getInstance().add_beginRequest

    - by user338262
    Hi, I have a user control which encapsulates a NumericUpDownExtender. This UserControl implements the interface ICallbackEventHandler, because I want that when a user changes the value of the textbox associated a custom event to be raised in the server. By the other hand each time an async postback is done I shoe a message of loading and disable the whole screen. This works perfect when something is changed in for example an UpdatePanel through this lines of code: Sys.WebForms.PageRequestManager.getInstance().add_beginRequest( function (sender, args) { var modalPopupBehavior = $find('programmaticSavingLoadingModalPopupBehavior'); modalPopupBehavior.show(); } ); The UserControl is placed inside a detailsview which is inside an UpdatePanel in an aspx. When the custom event is raised I want another textbox in the aspx to change its value. So far, When I click on the UpDownExtender, it goes correctly to the server and raises the custom event, and the new value of the textbox is assigned in the server. but it is not changed in the browser. I suspect that the problem is the callback, since I have the same architecture for a UserControl with an AutoCompleteExtender which implement IPostbackEventHandler and it works. Any clues how can I solve this here to make the UpDownNumericExtender user control to work like the AutComplete one? This is the code of the user control and the parent: using System; using System.Web.UI; using System.ComponentModel; using System.Text; namespace Corp.UserControls { [Themeable(true)] public partial class CustomNumericUpDown : CorpNumericUpDown, ICallbackEventHandler { protected void Page_PreRender(object sender, EventArgs e) { if (!Page.IsPostBack) { currentInstanceNumber = CorpAjaxControlToolkitUserControl.getNextInstanceNumber(); } registerControl(this.HFNumericUpDown.ClientID, currentInstanceNumber); string strCallServer = "NumericUpDownCallServer" + currentInstanceNumber.ToString(); // If this function is not written the callback to get the disponibilidadCliente doesn't work if (!Page.ClientScript.IsClientScriptBlockRegistered("ReceiveServerDataNumericUpDown")) { StringBuilder str = new StringBuilder(); str.Append("function ReceiveServerDataNumericUpDown(arg, context) {}").AppendLine(); Page.ClientScript.RegisterClientScriptBlock(typeof(CorpNumericUpDown), "ReceiveServerDataNumericUpDown", str.ToString(), true); } nudeNumericUpDownExtender.BehaviorID = "NumericUpDownEx" + currentInstanceNumber.ToString(); ClientScriptManager cm = Page.ClientScript; String cbReference = cm.GetCallbackEventReference(this, "arg", "ReceiveServerDataNumericUpDown", ""); String callbackScript = "function " + strCallServer + "(arg, context)" + Environment.NewLine + "{" + Environment.NewLine + cbReference + ";" + Environment.NewLine + "}" + Environment.NewLine; cm.RegisterClientScriptBlock(typeof(CustomNumericUpDown), strCallServer, callbackScript, true); base.Page_PreRender(sender,e); } [System.ComponentModel.Browsable(true)] [System.ComponentModel.Bindable(true)] public Int64 Value { get { return (string.IsNullOrEmpty(HFNumericUpDown.Value) ? Int64.Parse("1") : Int64.Parse(HFNumericUpDown.Value)); } set { HFNumericUpDown.Value = value.ToString(); //txtAutoCompleteCliente_AutoCompleteExtender.ContextKey = value.ToString(); // TODO: Change the text of the textbox } } [System.ComponentModel.Browsable(true)] [System.ComponentModel.Bindable(true)] [Description("The text of the numeric up down")] public string Text { get { return txtNumericUpDown.Text; } set { txtNumericUpDown.Text = value; } } public delegate void NumericUpDownChangedHandler(object sender, NumericUpDownChangedArgs e); public event NumericUpDownChangedHandler numericUpDownEvent; [System.ComponentModel.Browsable(true)] [System.ComponentModel.Bindable(true)] [System.ComponentModel.Description("Raised after the number has been increased or decreased")] protected virtual void OnNumericUpDownEvent(object sender, NumericUpDownChangedArgs e) { if (numericUpDownEvent != null) //check to see if anyone has attached to the event numericUpDownEvent(this, e); } #region ICallbackEventHandler Members public string GetCallbackResult() { return "";//throw new NotImplementedException(); } public void RaiseCallbackEvent(string eventArgument) { NumericUpDownChangedArgs nudca = new NumericUpDownChangedArgs(long.Parse(eventArgument)); OnNumericUpDownEvent(this, nudca); } #endregion } /// <summary> /// Class that adds the prestamoList to the event /// </summary> public class NumericUpDownChangedArgs : System.EventArgs { /// <summary> /// The current selected value. /// </summary> public long Value { get; private set; } public NumericUpDownChangedArgs(long value) { Value = value; } } } using System; using System.Collections.Generic; using System.Text; namespace Corp { /// <summary> /// Summary description for CorpAjaxControlToolkitUserControl /// </summary> public class CorpNumericUpDown : CorpAjaxControlToolkitUserControl { private Int16 _currentInstanceNumber; // This variable hold the instanceNumber assignated at first place. public short currentInstanceNumber { get { return _currentInstanceNumber; } set { _currentInstanceNumber = value; } } protected void Page_PreRender(object sender, EventArgs e) { const string strOnChange = "OnChange"; const string strCallServer = "NumericUpDownCallServer"; StringBuilder str = new StringBuilder(); foreach (KeyValuePair<String, Int16> control in controlsToRegister) { str.Append("function ").Append(strOnChange + control.Value).Append("(sender, eventArgs) ").AppendLine(); str.Append("{").AppendLine(); str.Append(" if (sender) {").AppendLine(); str.Append(" var hfield = document.getElementById('").Append(control.Key).Append("');").AppendLine(); str.Append(" if (hfield.value != eventArgs) {").AppendLine(); str.Append(" hfield.value = eventArgs;").AppendLine(); str.Append(" ").Append(strCallServer + control.Value).Append("(eventArgs, eventArgs);").AppendLine(); str.Append(" }").AppendLine(); str.Append(" }").AppendLine(); str.Append("}").AppendLine(); Page.ClientScript.RegisterClientScriptBlock(typeof(CorpNumericUpDown), Guid.NewGuid().ToString(), str.ToString(), true); } str = new StringBuilder(); foreach (KeyValuePair<String, Int16> control in controlsToRegister) { str.Append(" funcsPageLoad[funcsPageLoad.length] = function() { $find('NumericUpDownEx" + control.Value + "').add_currentChanged(").Append(strOnChange + control.Value).Append(");};").AppendLine(); str.Append(" funcsPageUnLoad[funcsPageUnLoad.length] = function() { $find('NumericUpDownEx" + control.Value + "').remove_currentChanged(").Append(strOnChange + control.Value).Append(");};").AppendLine(); } Page.ClientScript.RegisterClientScriptBlock(typeof(CorpNumericUpDown), Guid.NewGuid().ToString(), str.ToString(), true); } } } and to create the loading view I use this: //The beginRequest event is raised before the processing of an asynchronous postback starts and the postback is sent to the server. You can use this event to call custom script to set a request header or to start an animation that notifies the user that the postback is being processed. Sys.WebForms.PageRequestManager.getInstance().add_beginRequest( function (sender, args) { var modalPopupBehavior = $find('programmaticSavingLoadingModalPopupBehavior'); modalPopupBehavior.show(); } ); //The endRequest event is raised after an asynchronous postback is finished and control has been returned to the browser. You can use this event to provide a notification to users or to log errors. Sys.WebForms.PageRequestManager.getInstance().add_endRequest( function (sender, arg) { var modalPopupBehavior = $find('programmaticSavingLoadingModalPopupBehavior'); modalPopupBehavior.hide(); } ); Thanks in advance! Daniel.

    Read the article

  • Java homework help, Error <identifier> expected

    - by user2900126
    Help with java homework this is my assignment that I have, this assignment code I've tried. But when I try to compile it I keep getting errors which I cant seem to find soloutions too: Error says <identifier> expected for Line 67 public static void () Assignment brief To write a simple java classMobile that models a mobile phone. Details the information stored about each mobile phone will include • Its type e.g. “Sony ericsson x90” or “Samsung Galaxy S”; • Its screen size in inches; You may assume that this a whole number from the scale 3 to 5 inclusive. • Its memory card capacity in gigabytes You may assume that this a whole number • The name of its present service provider You may assume this is a single line of text. • The type of contract with service provider You may assume this is a single line of text. • Its camera resolution in megapixels; You should not assume that this a whole number; • The percentage of charge left on the phone e.g. a fully charged phone will have a charge of 100. You may assume that this a whole number • Whether the phone has GPS or not. Your class will have fields corresponding to these attributes . Start by opening BlueJ, creating a new project called myMobile which has a classMobile and set up the fields that you need, Next you will need to write a Constructor for the class. Assume that each phone is manufactured by creating an object and specifying its type, its screen size, its memory card capacity, its camera resolution and whether it has GPS or not. Therefore you will need a constructor that allows you to pass arguments to initialise these five attributes. Other fields should be set to appropriate default values. You may assume that a new phone comes fully charged. When the phone is sold to its owner, you will need to set the service provider and type of contract with that provider so you will need mutator methods • setProvider () - - to set service provider. • setContractType - - to set the type of contract These methods will be used when the phones provider is changed. You should also write a mutator method ChargeUp () which simulates fully charging the phone. To obtain information about your mobile object you should write • accessor methods corresponding to four of its fields: • getType () – which returns the type of mobile; • getProvider () – which returns the present service provider; • getContractType () – which returns its type of contract; • getCharge () – which returns its remaining charge. An accessor method to printDetails () to print, to the terminal window, a report about the phone e.g. This mobile phone is a sony Erricsson X90 with Service provider BigAl and type of contract PAYG. At present it has 30% of its battery charge remaining. Check that the new method works correctly by for example, • creating a Mobile object and setting its fields; • calling printDetails () and t=checking the report corresponds to the details you have just given the mobile; • changing the service provider and contract type by calling setprovider () and setContractType (); • calling printDetails () and checking the report now prints out the new details. Challenging excercises • write a mutator methodswitchedOnFor () =which simulates using the phone for a specified period. You may assume the phone loses 1% of its charge for each hour that it is switched on . • write an accessor method checkcharge () whichg checks the phone remaing charge. If this charge has a value less than 25%, then this method returns a string containg the message Be aware that you will soon need to re-charge your phone, otherwise it returns a string your phone charge is sufficient. • Write a method changeProvider () which simulates changing the provider (and presumably also the type of service contract). Finally you may add up to four additional fields, with appropriate methods, that might be required in a more detailed model. above is my assignment that I have, this assignment code I've tried. But when I try to oompile it I keep getting errors which I cant seem to find soloutions too: Error says <identifier> expected for Line 67 public static void () /** * to write a simple java class Mobile that models a mobile phone. * * @author (Lewis Burte-Clarke) * @version (14/10/13) */ public class Mobile { // type of phone private String phonetype; // size of screen in inches private int screensize; // menory card capacity private int memorycardcapacity; // name of present service provider private String serviceprovider; // type of contract with service provider private int typeofcontract; // camera resolution in megapixels private int cameraresolution; // the percentage of charge left on the phone private int checkcharge; // wether the phone has GPS or not private String GPS; // instance variables - replace the example below with your own private int x; // The constructor method public Mobile(String mobilephonetype, int mobilescreensize, int mobilememorycardcapacity,int mobilecameraresolution,String mobileGPS, String newserviceprovider) { this.phonetype = mobilephonetype; this.screensize = mobilescreensize; this.memorycardcapacity = mobilememorycardcapacity; this.cameraresolution = mobilecameraresolution; this.GPS = mobileGPS; // you do not use this ones during instantiation,you can remove them if you do not need or assign them some default values //this.serviceprovider = newserviceprovider; //this.typeofcontract = 12; //this.checkcharge = checkcharge; Mobile samsungPhone = new Mobile("Samsung", "1024", "2", "verizon", "8", "GPS"); 1024 = screensize; 2 = memorycardcapacity; 8 = resolution; GPS = gps; "verizon"=serviceprovider; //typeofcontract = 12; //checkcharge = checkcharge; } // A method to display the state of the object to the screen public void displayMobileDetails() { System.out.println("phonetype: " + phonetype); System.out.println("screensize: " + screensize); System.out.println("memorycardcapacity: " + memorycardcapacity); System.out.println("cameraresolution: " + cameraresolution); System.out.println("GPS: " + GPS); System.out.println("serviceprovider: " + serviceprovider); System.out.println("typeofcontract: " + typeofcontract); } /** * The mymobile class implements an application that * simply displays "new Mobile!" to the standard output. */ public class mymobile { public static void main(String[] args) { System.out.println("new Mobile!"); //Display the string. } } public static void buildPhones(){ Mobile Samsung = new Mobile("Samsung", "3.0", "4gb", "8mega pixels", "GPS"); Mobile Blackberry = new Mobile("Blackberry", "3.0", "4gb", "8mega pixels", "GPS"); Samsung.displayMobileDetails(); Blackberry.displayMobileDetails(); } public static void main(String[] args) { buildPhones(); } } any answers.replies and help would be greatly appreciated as I really lost!

    Read the article

  • 12.04 Unity 3D Not working where as Unity 2D works fine

    - by Stephen Martin
    I updated from 11.10 to 12.04 using the distribution upgrade, after that I couldn't log into using the Unity 3D desktop after logging in I would either never get unity's launcher or I would get the launcher and once I tried to do anything the windows lost their decoration and nothing would respond. If I use Unity 2D it works fine and in fact I'm using it to type this. I managed to get some info out of dmesg that looks like it's the route of whats happening. dmesg: [ 109.160165] [drm:i915_hangcheck_elapsed] *ERROR* Hangcheck timer elapsed... GPU hung [ 109.160180] [drm] capturing error event; look for more information in /debug/dri/0/i915_error_state [ 109.167587] [drm:i915_wait_request] *ERROR* i915_wait_request returns -11 (awaiting 1226 at 1218, next 1227) [ 109.672273] [drm:i915_reset] *ERROR* Failed to reset chip. output of lspci | grep vga 00:02.0 VGA compatible controller: Intel Corporation Mobile 4 Series Chipset Integrated Graphics Controller (rev 07) output of /usr/lib/nux/unity_support_test -p IN 12.04 OpenGL vendor string: VMware, Inc. OpenGL renderer string: Gallium 0.4 on llvmpipe (LLVM 0x300) OpenGL version string: 2.1 Mesa 8.0.2 Not software rendered: no Not blacklisted: yes GLX fbconfig: yes GLX texture from pixmap: yes GL npot or rect textures: yes GL vertex program: yes GL fragment program: yes GL vertex buffer object: yes GL framebuffer object: yes GL version is 1.4+: yes Unity 3D supported: no The same command in 11.10: stephenm@mcr-ubu1:~$ /usr/lib/nux/unity_support_test -p OpenGL vendor string: Tungsten Graphics, Inc OpenGL renderer string: Mesa DRI Mobile Intel® GM45 Express Chipset OpenGL version string: 2.1 Mesa 7.11 Not software rendered: yes Not blacklisted: yes GLX fbconfig: yes GLX texture from pixmap: yes GL npot or rect textures: yes GL vertex program: yes GL fragment program: yes GL vertex buffer object: yes GL framebuffer object: yes GL version is 1.4+: yes Unity 3D supported: yes stephenm@mcr-ubu1:~$ output of /var/log/Xorg.0.log [ 11.971] (II) intel(0): EDID vendor "LPL", prod id 307 [ 11.971] (II) intel(0): Printing DDC gathered Modelines: [ 11.971] (II) intel(0): Modeline "1280x800"x0.0 69.30 1280 1328 1360 1405 800 803 809 822 -hsync -vsync (49.3 kHz) [ 12.770] (II) intel(0): Allocated new frame buffer 2176x800 stride 8704, tiled [ 15.087] (II) intel(0): EDID vendor "LPL", prod id 307 [ 15.087] (II) intel(0): Printing DDC gathered Modelines: [ 15.087] (II) intel(0): Modeline "1280x800"x0.0 69.30 1280 1328 1360 1405 800 803 809 822 -hsync -vsync (49.3 kHz) [ 33.310] (II) XKB: reuse xkmfile /var/lib/xkb/server-93A39E9580D1D5B855D779F4595485C2CC66E0CF.xkm [ 34.900] (WW) intel(0): flip queue failed: Invalid argument [ 34.900] (WW) intel(0): Page flip failed: Invalid argument [ 34.900] (WW) intel(0): flip queue failed: Invalid argument [ 34.900] (WW) intel(0): Page flip failed: Invalid argument [ 34.913] (WW) intel(0): flip queue failed: Invalid argument [ 34.913] (WW) intel(0): Page flip failed: Invalid argument [ 34.913] (WW) intel(0): flip queue failed: Invalid argument [ 34.913] (WW) intel(0): Page flip failed: Invalid argument [ 34.926] (WW) intel(0): flip queue failed: Invalid argument [ 34.926] (WW) intel(0): Page flip failed: Invalid argument [ 34.926] (WW) intel(0): flip queue failed: Invalid argument [ 34.926] (WW) intel(0): Page flip failed: Invalid argument [ 35.501] (WW) intel(0): flip queue failed: Invalid argument [ 35.501] (WW) intel(0): Page flip failed: Invalid argument [ 35.501] (WW) intel(0): flip queue failed: Invalid argument [ 35.501] (WW) intel(0): Page flip failed: Invalid argument [ 41.519] [mi] Increasing EQ size to 512 to prevent dropped events. [ 42.079] (EE) intel(0): Detected a hung GPU, disabling acceleration. [ 42.079] (EE) intel(0): When reporting this, please include i915_error_state from debugfs and the full dmesg. [ 42.598] (II) intel(0): EDID vendor "LPL", prod id 307 [ 42.598] (II) intel(0): Printing DDC gathered Modelines: [ 42.598] (II) intel(0): Modeline "1280x800"x0.0 69.30 1280 1328 1360 1405 800 803 809 822 -hsync -vsync (49.3 kHz) [ 51.052] (II) AIGLX: Suspending AIGLX clients for VT switch I know im using the beta version so I'm not expecting it to work but does any one know what the problem may be or even why they Unity compatibility test is describing my video card as vmware when its an intel i915 and Ubuntu is running on the metal not virtualised. Unity 3D worked fine in 11.10

    Read the article

  • Unity 3D Not working where as Unity 2D works fine [closed]

    - by Stephen Martin
    I updated from 11.10 to 12.04 using the distribution upgrade, after that I couldn't log into using the Unity 3D desktop after logging in I would either never get unity's launcher or I would get the launcher and once I tried to do anything the windows lost their decoration and nothing would respond. If I use Unity 2D it works fine and in fact I'm using it to type this. I managed to get some info out of dmesg that looks like it's the route of whats happening. dmesg: [ 109.160165] [drm:i915_hangcheck_elapsed] *ERROR* Hangcheck timer elapsed... GPU hung [ 109.160180] [drm] capturing error event; look for more information in /debug/dri/0/i915_error_state [ 109.167587] [drm:i915_wait_request] *ERROR* i915_wait_request returns -11 (awaiting 1226 at 1218, next 1227) [ 109.672273] [drm:i915_reset] *ERROR* Failed to reset chip. output of lspci | grep vga 00:02.0 VGA compatible controller: Intel Corporation Mobile 4 Series Chipset Integrated Graphics Controller (rev 07) output of /usr/lib/nux/unity_support_test -p IN 12.04 OpenGL vendor string: VMware, Inc. OpenGL renderer string: Gallium 0.4 on llvmpipe (LLVM 0x300) OpenGL version string: 2.1 Mesa 8.0.2 Not software rendered: no Not blacklisted: yes GLX fbconfig: yes GLX texture from pixmap: yes GL npot or rect textures: yes GL vertex program: yes GL fragment program: yes GL vertex buffer object: yes GL framebuffer object: yes GL version is 1.4+: yes Unity 3D supported: no The same command in 11.10: stephenm@mcr-ubu1:~$ /usr/lib/nux/unity_support_test -p OpenGL vendor string: Tungsten Graphics, Inc OpenGL renderer string: Mesa DRI Mobile Intel® GM45 Express Chipset OpenGL version string: 2.1 Mesa 7.11 Not software rendered: yes Not blacklisted: yes GLX fbconfig: yes GLX texture from pixmap: yes GL npot or rect textures: yes GL vertex program: yes GL fragment program: yes GL vertex buffer object: yes GL framebuffer object: yes GL version is 1.4+: yes Unity 3D supported: yes stephenm@mcr-ubu1:~$ output of /var/log/Xorg.0.log [ 11.971] (II) intel(0): EDID vendor "LPL", prod id 307 [ 11.971] (II) intel(0): Printing DDC gathered Modelines: [ 11.971] (II) intel(0): Modeline "1280x800"x0.0 69.30 1280 1328 1360 1405 800 803 809 822 -hsync -vsync (49.3 kHz) [ 12.770] (II) intel(0): Allocated new frame buffer 2176x800 stride 8704, tiled [ 15.087] (II) intel(0): EDID vendor "LPL", prod id 307 [ 15.087] (II) intel(0): Printing DDC gathered Modelines: [ 15.087] (II) intel(0): Modeline "1280x800"x0.0 69.30 1280 1328 1360 1405 800 803 809 822 -hsync -vsync (49.3 kHz) [ 33.310] (II) XKB: reuse xkmfile /var/lib/xkb/server-93A39E9580D1D5B855D779F4595485C2CC66E0CF.xkm [ 34.900] (WW) intel(0): flip queue failed: Invalid argument [ 34.900] (WW) intel(0): Page flip failed: Invalid argument [ 34.900] (WW) intel(0): flip queue failed: Invalid argument [ 34.900] (WW) intel(0): Page flip failed: Invalid argument [ 34.913] (WW) intel(0): flip queue failed: Invalid argument [ 34.913] (WW) intel(0): Page flip failed: Invalid argument [ 34.913] (WW) intel(0): flip queue failed: Invalid argument [ 34.913] (WW) intel(0): Page flip failed: Invalid argument [ 34.926] (WW) intel(0): flip queue failed: Invalid argument [ 34.926] (WW) intel(0): Page flip failed: Invalid argument [ 34.926] (WW) intel(0): flip queue failed: Invalid argument [ 34.926] (WW) intel(0): Page flip failed: Invalid argument [ 35.501] (WW) intel(0): flip queue failed: Invalid argument [ 35.501] (WW) intel(0): Page flip failed: Invalid argument [ 35.501] (WW) intel(0): flip queue failed: Invalid argument [ 35.501] (WW) intel(0): Page flip failed: Invalid argument [ 41.519] [mi] Increasing EQ size to 512 to prevent dropped events. [ 42.079] (EE) intel(0): Detected a hung GPU, disabling acceleration. [ 42.079] (EE) intel(0): When reporting this, please include i915_error_state from debugfs and the full dmesg. [ 42.598] (II) intel(0): EDID vendor "LPL", prod id 307 [ 42.598] (II) intel(0): Printing DDC gathered Modelines: [ 42.598] (II) intel(0): Modeline "1280x800"x0.0 69.30 1280 1328 1360 1405 800 803 809 822 -hsync -vsync (49.3 kHz) [ 51.052] (II) AIGLX: Suspending AIGLX clients for VT switch I know im using the beta version so I'm not expecting it to work but does any one know what the problem may be or even why they Unity compatibility test is describing my video card as vmware when its an intel i915 and Ubuntu is running on the metal not virtualised. Unity 3D worked fine in 11.10

    Read the article

< Previous Page | 346 347 348 349 350 351 352 353 354 355 356 357  | Next Page >