Search Results

Search found 28775 results on 1151 pages for 'line'.

Page 356/1151 | < Previous Page | 352 353 354 355 356 357 358 359 360 361 362 363  | Next Page >

  • Experience using IRC to coordinate software development?

    - by momeara
    I am part of a growing software project with at least 200 active developer in 10 locations. I would like to set up an on-line chat forum for developers because I think it would help to coordinate efforts. We have an email mailing list but I feel like some questions or announcements are too informal to send to everyone while mentioning it in a chat forum might be a useful community resource. I have never participated in a software project that used an on-line chat forum so I would like to hear about peoples experiences. I am particularly interested in technical issues: Use of IRC vs. alternative platforms; how to manage access, eg. for developers only, allowing users to participate; the value of requiring certain announcements to be made on the chat forum eg who is resolving broken builds etc. If I pitch the idea to the community I would like to have some good arguments why it would be a good idea and some prospective of its usefulness in other software projects.

    Read the article

  • Saving a movie generated with Jython/JES on local disk

    - by Golgauth
    I made an autogenerated movie clip using JES (Jython Environment for Students). I can play it without any problem using playMovie(), but I can't figure out how to have it saved physically on disk. The full script is located here. ... movie = synthesizeFrameAndCreateMovie("D:\\FOLDER") print movie writeQuicktime(movie,"D:\\FOLDER\\movie.mov", 30) [LINE 35] #playMovie(movie) I get this error when calling the function writeQuicktime(): >>> ======= Loading Progam ======= Movie, frames: 60 The error was: Index: 0, Size: 0 I wasn't able to do what you wanted. The error java.lang.IndexOutOfBoundsException has occured Please check line 35 Note : I also tried the function writeAVI(), with the exact same result. This error sounds like a java bug in Jython/JES library. I am running JES under Windows 7 and have all the common Quicktime and AVI codex installed as well as the QTjava library in my jre... Any brilliant idea ? EDIT : Also tried the Linux version with same result for both QuickTime and AVI...

    Read the article

  • Cannot import SQLite with Python 2.6

    - by David McLaughlin
    I'm running Python 2.6 on Unix and when I run the interactive prompt (SQLite is supposed to be preinstalled) I get: [root@idev htdocs]# python Python 2.6 (r26:66714, Oct 23 2008, 16:25:34) [GCC 3.2.2 20030222 (Red Hat Linux 3.2.2-5)] on linux2 Type "help", "copyright", "credits" or "license" for more information. >>> import sqlite Traceback (most recent call last): File "<stdin>", line 1, in <module> ImportError: No module named sqlite >>> import sqlite Traceback (most recent call last): File "<stdin>", line 1, in <module> ImportError: No module named sqlite >>> How do I resolve this?

    Read the article

  • Use matching value of a RegExp to name the output file.

    - by fx42
    I have this file "file.txt" which I want to split into many smaller ones. Each line of the file has an id field which looks like "id:1" for a line belonging to id 1. For each id in the file, I like to create a file named idid.txt and put all lines that belong to this id in that file. My brute force bash script solution reads as follows. count=1 while [ $count -lt 19945 ] do cat file.txt | grep "id:$count " >> ./sets/id$count.txt count='expr $count + 1' done Now this is very inefficient as I have do read through the file about 20.000 times. Is there a way to do the same operation with only one pass through the file? - What I'm probably asking for is a way to use the value that matches for a regular expression to name the associated output file.

    Read the article

  • writing XML with Xerces 3.0.1 and C++ on windows

    - by Jon
    Hi, i have the following function i wrote to create an XML file using Xerces 3.0.1, if i call this function with a filePath of "foo.xml" or "../foo.xml" it works great, but if i pass in "c:/foo.xml" then i get an exception on this line XMLFormatTarget *formatTarget = new LocalFileFormatTarget(targetPath); can someone explain why my code works for relative paths, but not absolute paths please? many thanks. const int ABSOLUTE_PATH_FILENAME_PREFIX_SIZE = 9; void OutputXML(xercesc::DOMDocument* pmyDOMDocument, std::string filePath) { //Return the first registered implementation that has the desired features. In this case, we are after a DOM implementation that has the LS feature... or Load/Save. DOMImplementation *implementation = DOMImplementationRegistry::getDOMImplementation(L"LS"); // Create a DOMLSSerializer which is used to serialize a DOM tree into an XML document. DOMLSSerializer *serializer = ((DOMImplementationLS*)implementation)->createLSSerializer(); // Make the output more human readable by inserting line feeds. if (serializer->getDomConfig()->canSetParameter(XMLUni::fgDOMWRTFormatPrettyPrint, true)) serializer->getDomConfig()->setParameter(XMLUni::fgDOMWRTFormatPrettyPrint, true); // The end-of-line sequence of characters to be used in the XML being written out. serializer->setNewLine(XMLString::transcode("\r\n")); // Convert the path into Xerces compatible XMLCh*. XMLCh *tempFilePath = XMLString::transcode(filePath.c_str()); // Calculate the length of the string. const int pathLen = XMLString::stringLen(tempFilePath); // Allocate memory for a Xerces string sufficent to hold the path. XMLCh *targetPath = (XMLCh*)XMLPlatformUtils::fgMemoryManager->allocate((pathLen + ABSOLUTE_PATH_FILENAME_PREFIX_SIZE) * sizeof(XMLCh)); // Fixes a platform dependent absolute path filename to standard URI form. XMLString::fixURI(tempFilePath, targetPath); // Specify the target for the XML output. XMLFormatTarget *formatTarget = new LocalFileFormatTarget(targetPath); //XMLFormatTarget *myFormTarget = new StdOutFormatTarget(); // Create a new empty output destination object. DOMLSOutput *output = ((DOMImplementationLS*)implementation)->createLSOutput(); // Set the stream to our target. output->setByteStream(formatTarget); // Write the serialized output to the destination. serializer->write(pmyDOMDocument, output); // Cleanup. serializer->release(); XMLString::release(&tempFilePath); delete formatTarget; output->release(); }

    Read the article

  • What Kind of Knowledge is Necessary For a Permon Who Does Not Have IT Background? [closed]

    - by skyflyer
    One of my colleagues joined our company, which by the way is a internet company, months ago as an on-line marketing specialist. He majored English in his college and has never deeply touched IT before. He says that to be a good on-line marketing specialist he needs to lean some basic IT skills in order to deliver superb work. According to him, things like Search Engine Optimization, monitoring competitors' web sites, design some functionality on web site and so on require IT entree-level knowledge. And he asks me what kind knowledge is helpful for him to do his job. I am stunted by his question. It is easy enough to answer, things like HTML, CSS, even Photo-shop are required in some job descriptions. Also, I believe some basic understanding of dynamic web site, static web site is helpful to him. On the other hand, as a techie I still feel my answer is awkward. What is your opinion on this? Always lot of thanks to you guys on SO.

    Read the article

  • How to set maxLines and ellipsesize of a TextView at the same time.

    - by michael
    I want to limit my text view to have maximum of 6 lines, so I did: <TextView android:id="@+id/toptext" android:layout_width="fill_parent" android:layout_height="wrap_content" android:maxLines="6"/> But when I try to configure it to add '...' when the text is truncated, I add android:ellipsize="end". I do see the ... but then my TextView only has a max line of 2, instead of 6. Can you please how can I make the text view of maximum line of 6 and add '...' when it get truncated? Thank you.

    Read the article

  • PHP does not work over ssl connections

    - by Haluk
    Hi, I just got my ssl certificate to work for the first time. For some reason when I connect to my website using https my browser tries to download the php file. I have the following line in my httpd.conf. Isn't this the line which makes sure php files are run using php? AddType application/x-httpd-php .php What else do I need to change so that I can get the php files to work over the https connection. Thanks!

    Read the article

  • Loading .sql files from within PHP

    - by Josh Smeaton
    I'm creating an installation script for an application that I'm developing and need to create databases dynamically from within PHP. I've got it to create the database but now I need to load in several .sql files. I had planned to open the file and mysql_query it a line at a time - until I looked at the schema files and realised they aren't just one query per line. So, please.. how do I load an sql file from within PHP? (as phpMyAdmin does with it's import command).

    Read the article

  • SVN Merge returns nothing...

    - by Mike
    Here is the scenario: Windows Vista environment. SVN version 1.6.11. I'm on my branch directory. I want to update my branch with a particular change from my trunk. Using command line (using SlikSVN) I enter the following and it returns nothing (returns a blank line and no merge occurs): svn merge -r 11846:11891 http://trunk//AppConstants.java When I do the equivalent using Tortoise SVN, it says "Completed" but nothing gets merged either. When I do a svn diff I clearly see the differences I want to merge in from the trunk to my branch. The diff command I am using is svn diff -r 11846:11891 http://trunk//AppConstants.java. Can anyone figure why no merge occurs? Thanks!!!

    Read the article

  • Kerning problems when drawing text character by character

    - by shekel
    I'm trying to draw strings character by character to add lighting effects to shapes composed of text. while (i != line.length()) { c = line.substring(i, i + 1); cWidth = g.getFontMetrics().stringWidth(c); g.drawString(c, xx += cWidth, yy); i++; } The problem is, the width of a character isn't the actual distance it's drawn from another character when those two characters are printed as a string. Is there any way to get the correct distance in graphics2d?

    Read the article

  • jquery dialog problem

    - by user403295
    Hi guys, i know this is a very easy thing to implement but when I add a line to add a dialog my actual page disappears. Can anyone tell me what I am doing wrong? $(function(){ //when I open this line, my page disapperars? $("#dialog").dialog({ autoOpen: false, modal: true }); }); /*FUNCTION CLOSED/ <div id="dialog" title="Delete Record" style="display: none"> <p><span style="float:left; margin:0 7px 20px 0;"></span>Are You Sure?</p> </div>

    Read the article

  • SQL error C# - Parameter already defined

    - by jakesankey
    Hey there. I have a c# application that parses txt files and imports the data from them into a sql db. I was using sqlite and am now working on porting it to sql server. It was working fine with sqlite but now with sql i am getting an error when it is processing the files. It added the first row of data to the db and then says "parameter @PartNumber has already been declared. Variable names must be unique within a batch or stored procedure". Here is my whole code and SQL table layout ... the error comes at the last insertCommand.ExecuteNonQuery() instance at the end of the code... SQL TABLE: CREATE TABLE Import ( RowId int PRIMARY KEY IDENTITY, PartNumber text, CMMNumber text, Date text, FeatType text, FeatName text, Value text, Actual text, Nominal text, Dev text, TolMin text, TolPlus text, OutOfTol text, FileName text ); CODE: using System; using System.Data; using System.Data.SQLite; using System.IO; using System.Text.RegularExpressions; using System.Threading; using System.Collections.Generic; using System.Linq; using System.Data.SqlClient; namespace JohnDeereCMMDataParser { internal class Program { public static List<string> GetImportedFileList() { List<string> ImportedFiles = new List<string>(); using (SqlConnection connect = new SqlConnection(@"Server=FRXSQLDEV;Database=RX_CMMData;Integrated Security=YES")) { connect.Open(); using (SqlCommand fmd = connect.CreateCommand()) { fmd.CommandText = @"IF (EXISTS (SELECT * FROM INFORMATION_SCHEMA.TABLES WHERE TABLE_SCHEMA = 'RX_CMMData' AND TABLE_NAME = 'Import')) BEGIN SELECT DISTINCT FileName FROM Import; END"; fmd.CommandType = CommandType.Text; SqlDataReader r = fmd.ExecuteReader(); while (r.Read()) { ImportedFiles.Add(Convert.ToString(r["FileName"])); } } } return ImportedFiles; } private static void Main(string[] args) { Console.Title = "John Deere CMM Data Parser"; Console.WriteLine("Preparing CMM Data Parser... done"); Console.WriteLine("Scanning for new CMM data... done"); Console.ForegroundColor = ConsoleColor.Gray; using (SqlConnection con = new SqlConnection(@"Server=FRXSQLDEV;Database=RX_CMMData;Integrated Security=YES")) { con.Open(); using (SqlCommand insertCommand = con.CreateCommand()) { SqlCommand cmdd = con.CreateCommand(); string[] files = Directory.GetFiles(@"C:\Documents and Settings\js91162\Desktop\", "R303717*.txt*", SearchOption.AllDirectories); List<string> ImportedFiles = GetImportedFileList(); foreach (string file in files.Except(ImportedFiles)) { string FileNameExt1 = Path.GetFileName(file); cmdd.CommandText = @" IF (EXISTS (SELECT * FROM INFORMATION_SCHEMA.TABLES WHERE TABLE_SCHEMA = 'RX_CMMData' AND TABLE_NAME = 'Import')) BEGIN SELECT COUNT(*) FROM Import WHERE FileName = @FileExt; END"; cmdd.Parameters.Add(new SqlParameter("@FileExt", FileNameExt1)); int count = Convert.ToInt32(cmdd.ExecuteScalar()); con.Close(); con.Open(); if (count == 0) { Console.WriteLine("Parsing CMM data for SQL database... Please wait."); insertCommand.CommandText = @" INSERT INTO Import (FeatType, FeatName, Value, Actual, Nominal, Dev, TolMin, TolPlus, OutOfTol, PartNumber, CMMNumber, Date, FileName) VALUES (@FeatType, @FeatName, @Value, @Actual, @Nominal, @Dev, @TolMin, @TolPlus, @OutOfTol, @PartNumber, @CMMNumber, @Date, @FileName);"; insertCommand.Parameters.Add(new SqlParameter("@FeatType", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@FeatName", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@Value", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@Actual", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@Nominal", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@Dev", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@TolMin", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@TolPlus", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@OutOfTol", DbType.Decimal)); string FileNameExt = Path.GetFullPath(file); string RNumber = Path.GetFileNameWithoutExtension(file); string RNumberE = RNumber.Split('_')[0]; string RNumberD = RNumber.Split('_')[1]; string RNumberDate = RNumber.Split('_')[2]; DateTime dateTime = DateTime.ParseExact(RNumberDate, "yyyyMMdd", Thread.CurrentThread.CurrentCulture); string cmmDate = dateTime.ToString("dd-MMM-yyyy"); string[] lines = File.ReadAllLines(file); bool parse = false; foreach (string tmpLine in lines) { string line = tmpLine.Trim(); if (!parse && line.StartsWith("Feat. Type,")) { parse = true; continue; } if (!parse || string.IsNullOrEmpty(line)) { continue; } Console.WriteLine(tmpLine); foreach (SqlParameter parameter in insertCommand.Parameters) { parameter.Value = null; } string[] values = line.Split(new[] { ',' }); for (int i = 0; i < values.Length - 1; i++) { SqlParameter param = insertCommand.Parameters[i]; if (param.DbType == DbType.Decimal) { decimal value; param.Value = decimal.TryParse(values[i], out value) ? value : 0; } else { param.Value = values[i]; } } insertCommand.Parameters.Add(new SqlParameter("@PartNumber", RNumberE)); insertCommand.Parameters.Add(new SqlParameter("@CMMNumber", RNumberD)); insertCommand.Parameters.Add(new SqlParameter("@Date", cmmDate)); insertCommand.Parameters.Add(new SqlParameter("@FileName", FileNameExt)); // insertCommand.ExecuteNonQuery(); } } } Console.WriteLine("CMM data successfully imported to SQL database..."); } con.Close(); } } } }

    Read the article

  • zeromq installtion on mac os snow leopard

    - by Ashish
    I have installed zeromq 2.1.11 on mac os x using the steps given on http://www.zeromq.org/area:download Then i installed pyzmq (python bindings ) But i get the following error : import zmq Traceback (most recent call last): File "<pyshell#1>", line 1, in <module> import zmq File "/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/site-packages/zmq/__init__.py", line 35, in <module> from zmq.utils import initthreads # initialize threads ImportError: dlopen(/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/site-packages/zmq/utils/initthreads.so, 2): no suitable image found. Did find: /Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/site-packages/zmq/utils/initthreads.so: no matching architecture in universal wrapper

    Read the article

  • unsetting application role in classic ASP

    - by user303526
    Hi, I'm trying to unset an application role but have been failing miserably. I was able to get the cookie value after setting (sp_setapprole) the application role. But I haven't been able to use that cookie (type varbinary / byte array) in my query to unset using sp_unsetapprole. If it was any other stored procedure it wouldn't have been a problem. I was able to use Command object and create a parameter which takes data type input of adVarBinary (204) and execute the command line.. but to the Server the query goes as below. exec sp_executesql N'sp_unsetapprole @P1 ',N'@P1 varbinary(36)',0x01000000CD11697F8F0ED3627BC1DAD25FB9CEB3A2EC5B289C658235E510CD9F29230000 Since sp_setapprole and sp_unsetapprole have to be run ad hoc, the sql server is failing to run this line. And I'm finding it hard to append varbinary cookie value to a simple query such as 'sp_unsetapprole ' & varKookie so it runs "directly" on to the server. Any kind of suggestions are welcome. Thanks, Nandagopal

    Read the article

  • ASP.Net Checkbox Doesn't Allow Setting Visible to True

    - by Shawn Steward
    I'm working on an old web application in Visual Studio .Net 2003 (yeeich) and I'm having an issue with a Checkbox that will not set the Visibility to True. It's declared as such: Protected WithEvents chkTraining As System.Web.UI.WebControls.CheckBox and <asp:CheckBox id="chkTraining" runat="server" Visible="False"></asp:CheckBox> When I am debugging through the line that has: chkTraining.Visible = True it goes past it fine, but as I check this value on the very next line, chkTraining.Visible = False. What could possibly be going on here? There's no events firing off or anything else going on... this really is throwing me for a loop. Thanks for your help.

    Read the article

  • How do I set up Scala plugin for NetBeans to copy the Scala runtime library?

    - by Alexey Romanov
    Versions: NetBeans 6.8, Scala Kit 0.16.1 When I compile my project, I get the following output: init: deps-jar: Compiling 2 source files to F:\MyProgramming\NorvigSpellChecker\build\classes compile: Created dir: F:\MyProgramming\NorvigSpellChecker\dist Building jar: F:\MyProgramming\NorvigSpellChecker\dist\NorvigSpellChecker.jar Not copying the libraries. To run this application from the command line without Ant, try: java -jar "F:\MyProgramming\NorvigSpellChecker\dist\NorvigSpellChecker.jar" jar: BUILD SUCCESSFUL (total time: 3 seconds) Of course, the libraries should be copied, so I can't actually run it by using this command line. I don't see any options to copy the library in the project configuration. The plugin uses Ant for building, but I don't have any experience with it; presumably it should be easy enough to tell Ant to copy the libraries. Here is build-impl.xml, what should I do in build.xml?

    Read the article

  • fixed-size tableView cell in iPhone?

    - by SeniorLee
    I want to have all same size(width) cells in tableView no matter what accessory they have. If text in a cell almost fits to a cell, If i click that cell, check mark(accessory at the right) is displayed and some of characters goes to next line. it's annyoing. It's ok to do wordwrap. I can adjust cell's height. But I dont' want a cell displays different number of characters in an line depends on it's clicked or not. How can I do that?? thanks.

    Read the article

  • update a column in input file by taking value from Database in perl.

    - by Rahul Singh
    input file: 1,a,USA,, 2,b,UK,, 3,c,USA,, i want to update the 4th column in the input file from taking values from one of the table. my code looks like this: my $customer_dbh = DBI-connect("DBI:Oracle:$INST", $USER, $PASS ) or die "Couldn't connect to datbase $INST"; my $cust_smh; print "connected \n "; open FILE , "+$input_file" or die "can't open the input file"; print "echo \n"; while(my $line=) { my @line_a=split(/\,/,$line); my $customer_id=$line_a[3]; print "$customer_id\n"; $cust_smh = $customer_dbh-prepare("SELECT phone_no from book where number = $line_a[0]"); $cust_smh-execute() or die "Couldn't execute stmt, error : $DBI::errstr"; my $number = $cust_smh-fetchrow_array(); $line_a[3]=$number; }

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Having issue with OpenGL 1.0 for HP slate 7

    - by Roy Coder
    I have issue with HP slate when i am trying to draw Line in OpenGL Draw method. But working in other devices. In Hp Slate Green line not drawn properly as like in another device. My Code is: gl.glPushMatrix(); gl.glEnableClientState(GL10.GL_VERTEX_ARRAY); gl.glVertexPointer(2, GL10.GL_FLOAT, 0, vertexFloatBuffer); gl.glColorMask(true, true, true, true); gl.glDepthMask(true); gl.glLineWidth(8.0f); setColor(gl); gl.glDrawArrays(GL10.GL_LINES, 0, fPoints.length / 2); gl.glDisableClientState(GL10.GL_VERTEX_ARRAY); gl.glPopMatrix(); Suggest me at which place i am wrong or missing something? UpdateImage

    Read the article

  • Given two lines on a plane, how to find integer points closest to their interseciton?

    - by Lukasz Lew
    I can't solve it: You are given 8 integers: A, B, C representing a line on a plane with equation A*x + B*y = C a, b, c representing another line x, y representing a point on a plane The two lines are not parallel therefore divide plane into 4 pieces. Point (x, y) lies inside of one these pieces. Problem: Write a fast algorithm that will find a point with integer coordinates in the same piece as (x,y) that is closest to the cross point of the two given lines. Note: This is not a homework, this is old Euler-type task that I have absolutely no idea how to approach.

    Read the article

  • DataGridView: how to focus the whole row instead of a single cell?

    - by Tomas Sedovic
    I'd like to use the DataGridView control as a list with columns. Sort of like ListView in Details mode but I want to keep the DataGridView flexibility. ListView (with Details view and FullRowSelect enabled) highlights the whole line and shows the focus mark around the whole line: DataGridView (with SelectionMode = FullRowSelect) displays focus mark only around a single cell: So, does anyone know of some (ideally) easy way to make the DataGridView row selection look like the ListView one? I'm not looking for a changed behaviour of the control - I only want it to look the same. Ideally, without messing up with the methods that do the actual painting.

    Read the article

  • How do I do a join in ActiveRecord after records have been returned?

    - by Russ Bradberry
    I am using ActiveRecord in Rails 3 to pull data from two different tables in two different databases. These databases can not join on each other, but I have the need to do a simple join after-the-fact. I would like to preserve the relation so that I can chain it down the line. here is a simplified version of what I am doing browsers = Browser.all # <-- this is fairly small and can reside in memory events = Event.where(:row_date=>Date.today).select(:name, :browser_id) So as you can see, I want to join browsers in on the events relation, where browser_id should equal browsers.name. events is a relation and I can still add clauses to it down the line, so I dont want to run the query on the db just yet. How would I accomplish this?

    Read the article

< Previous Page | 352 353 354 355 356 357 358 359 360 361 362 363  | Next Page >