Search Results

Search found 22204 results on 889 pages for 'input devices'.

Page 362/889 | < Previous Page | 358 359 360 361 362 363 364 365 366 367 368 369  | Next Page >

  • "Remember" last three MySql queries; Cookie, passed variable or other method?

    - by Camran
    I have a classified website, with pretty sophisticated searching, and I am about to implement a function where the last three queries is displayed for the user, so that the user can go back easier through the queries. This because for each query the user has to provide a lot of input. I have four questions for you: I wonder, how can I save the actual query (SELECT * FROM etc etc)...? Do I need to add some form of encryption to be on the safe side? How will this affect performance? (I don't like the fact that cookies slow websites down) Anything else to think about? If you need more input, let me know... Btw, the website is PHP based. Thanks

    Read the article

  • Failed to sum splited text

    - by user1784753
    I have a problem when summing all of bx3.text to t2.text. first I split bx3.text with space private void total() { string[] ps = bx3.Text.Split(new string[] {" "}, StringSplitOptions.None ); t2.Text = ps.Select(x => Convert.ToInt32(x)).Sum().ToString(); } I did try with t2.text = ps[1] and the number showed was correct. but when i try to sum it all, I got error "Input string was not in a correct format" on (x = Convert.ToInt32(x)) bx3.text is full of user-input number separated by single space " "

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Javascript Function wont submit form..

    - by Josh K
    Here is my function: function processCheck() { var numberClicked = 0; var frm = document.getElementById('form'); for (var i=0; i<form.elements.length; i++) { if (frm.elements[i].checked) numberClicked++; } if(numberClicked != 8) alert('Must choose 8 Teams'); else frm.submit(); } My forms name is 'form', here is my input: echo "<input type='button' name='submit' value='Update' onclick='processCheck()' />"; When i click the button and there is anything but 8 boxes selected it displays the alert, if there is 8 boxes it does nothing (<-- The problem). I have the form action set to another page.

    Read the article

  • Buttons created through jquery don't respond to clicks

    - by Atrus
    As I've come to understand using $('.whatever').click() only works for items created initially. Additional items won't respond in the correct fashion. I was then directed to using something like $('.whatever).on('click', myFunction()). However, I'm not detecting any difference, as newly created items are not called. Here is a JSFiddle demonstration my example code: http://jsfiddle.net/atrus6/zaKZN/ My initial input plus 'Kill' will work in the correct fashion, however any additional 'input + kill's will not not do anything. Am I incorrectly using .on() or is it something else?

    Read the article

  • Change Modul popup every 30 sec Javascript

    - by SoftwareDeveloper
    I have a div id called modalpage and have css. I need a javascript function which can dynamically shows popup for 20 mins and change in every 30 secs right now i have the following javascript function. Can anybody help me please <script language="javascript" type="text/javascript"> function revealModal(divID) { window.onscroll = function () { document.getElementById(divID).style.top = document.body.scrollTop; }; document.getElementById(divID).style.display = "block"; document.getElementById(divID).style.top = document.body.scrollTop; } which is called by a input id button. <input id="Button1" type="button" value="Click here" onclick="revealModal('modalPage')" /> Thanks

    Read the article

  • JavaScript not working with Chrome & Xampp!

    - by Anonymous
    Hi, I've been trying for a couple hours now to figure out why JavaScript wouldn't work. The code works, but here it is anyway. <script type="text/javascript"> function change(text) { document.f1.ta.value="Hi!"; } </script> <form name="f1"> <input type="textarea" id="ta"/> <input type="button" action='change("Hi!")'/> </form> When I click the button, it does nothing. When I write "document.f1.ta.value="Hi!";" in the Chrome's inspector console, it works. I am using XAMPP (for Windows) 1.7.3 Windows 7 Ultimate.

    Read the article

  • Confused on the basics of AJAX

    - by Doug
    So right now, I'm just using a basic form to check a password. I want it to check the password and basically remain on page.html so I can use JavaScript to alert incorrect password or something. I'm not really sure how to do that. It seems it would bring me to check.php. I'm not too sure on the whole process, any help appreciated! Thanks! Page.html <form action="check.php" method="post"> <input type="password" name="password" /> <input type="submit" value="Submit" /> </form> check.php <?php $password = $_POST['password']; if ( $password != "testing" ) { die(); } ?>

    Read the article

  • What is the differance between those two Strings in Java

    - by user1816808
    why when we declare string in java we can't use == to compare this string and always will turn to false while if we initialize the string from the beginning it will be true . for example : import java.util.Scanner; public class MyString { /** * @param args */ public static void main(String[] args) { // TODO Auto-generated method stub Scanner input = new Scanner(System.in); String s = input.nextLine(); if(s=="Hello") system.out.println("Hello"); String d = "Hello"; if(d=="Hello") system.out.println("Hello"); } } I need an explanation please ??

    Read the article

  • Shell Sort problem

    - by user191603
    Show the result of running Shell Sort on the input 9,8,7,6,5,4,3,2,1 using increments { 1,3,7 }. I have done this part. the result is: 9 8 7 6 5 4 3 2 1 (original) 2 1 7 6 5 4 3 9 8 ( 7-sort ) 2 1 4 3 5 7 6 9 8 ( 3-sort ) 1 2 3 4 5 6 7 8 9 ( 1-sort ) Then the question requires me to determine the running time of Shell Sort using Shell's increments of N/2, N/4, ..., 1 for sorted input. I am not quite sure how to answer the second question as I don't understand the requirement of this question. So, would anyone give some hints to let me finish this question? Thank you for your help first!

    Read the article

  • Form validation in JAvascript with Regexp

    - by Nikita Barsukov
    I have a webpage with an input field where only digits are allowed. The input field has an onkeyup event that starts this validating function: function validate() { var uah_amount = document.getElementById("UAH").value; var allowed = /^\d+$/; document.getElementById("error").innerHTML = document.getElementById("UAH").value; if (!allowed.test(uah_amount)) { document.getElementById("error").style.backgroundColor = "red"; } } Everything works as I expect until I hit Backspace button to remove some characters. In this case function always behaves as if I entered letters. How to correct this?

    Read the article

  • Is it possible to block a certain character or group of characters from entering into text box or an

    - by Param-Ganak
    Hello friends! I have a text input field like text box or text area. I want to prevent the user from entering certain character or a group of characters. That is for example if I dont want # * @ and numbers from 0-9 these characters. So Whenever user press any of the above character key then that character should not appear in to an input field. It means directly blocking that character. Is this possible in Jquery? Please give me some guidelines to achive it. Thank You

    Read the article

  • Database that accesses a website.?

    - by Alec
    Hi Guys What application should I use that is able to automatically access a website to gather information? Basically I have a database that completes calculations for me; however I have to manually gather the parameters from a website and input these into my database. What I would like is have an application that will take my input say the name of a product, access the website, add this name into a search box on a website, complete the search and then extract the desired information from the web page returning the results to my application to complete the calculation thus presenting me with the result. This is a little out of my depth but I’m willing to learn no matter how complicated the software. Cheers for your help.

    Read the article

  • finding the value of radio button with jquery

    - by oo
    i have this code below to show different divs when i choose certain radio buttons: if ($("input[@name='exerciseRB']:checked").val() == 'New') { $("#newExercise").show(); $("#existingExercise").hide(); } else { $("#newExercise").hide(); $("#existingExercise").show(); } at first, i just had two radio buttons (both named exerciseRB and everything works fine. Now, later in my web page i added two new radio buttons (with the name lessonRB). The issue is that once i added these other new radio buttons when i look up this in firebug: $("input[@name='exerciseRB']:checked") i actually get an array back with both the exerciseRB item as well as the lessonRB item. Its almost as if the @name='exerciseRB' is being ignored. any ideas here?

    Read the article

  • Color getAlpha() not working as intended

    - by Arvy
    I was making a program where I load an image and after that I do something with opaque pixels. Transparent pixels showed up as black pixels, but after some time I found the cause: Color c = new Color (input.getRGB(x, y)); Works-> if ((input.getRGB(x, y) & 0xFF000000) != 0x00000000) { do_smth();} Returns true at all times-> if (c.getAlpha() != 0) { do_smth(); } So why it does not work?

    Read the article

  • Form POST or sessions?

    - by eddienotizzard
    If you have an item where you allow users to add comments, how can you pass which item the user is replying too? I've though of using a hidden field in a form, however this can be easily changed using plugins such as firebug: <form method="post" action="blah"> <input type="hidden" name="item_id" value="<?php echo $item_id; ?>"> <!-- other form data here --> <input type="submit" name="submit"> </form> Or just simply using a session: $_SESSION['item_id'] = $item_id Is there a safe way to send the item data in a form?

    Read the article

  • PHP setcookie warning

    - by Ranking
    Hello guys, I have a problem with 'setcookie' in PHP and I can't solve it. so I receive this error "Warning: Cannot modify header information - headers already sent by (output started at C:\Program Files\VertrigoServ\www\vote.php:14) in C:\Program Files\VertrigoServ\www\vote.php on line 86" and here is the file.. line 86 is setcookie ($cookie_name, 1, time()+86400, '/', '', 0); is there any other way to do this ?? <html> <head> <title>Ranking</title> <link href="style.css" rel="stylesheet" type="text/css"> </head> <body bgcolor="#EEF0FF"> <div align="center"> <br/> <div align="center"><div id="header"></div></div> <br/> <table width="800" border="0" align="center" cellpadding="5" cellspacing="0" class="mid-table"> <tr><td height="5"> <center> <table border="0" cellpadding="0" cellspacing="0" align="center" style="padding-top:5px;"> <tr> <td align="center" valign="top"><img src="images/ads/top_banner.png"></td> </tr> </table> </center> </td></tr> <tr><td height="5"></td></tr> </table> <br/> <?php include "conf.php"; $id = $_GET['id']; if (!isset($_POST['submitted'])) { if (isset($_GET['id']) && is_numeric($_GET['id'])) { $id = mysql_real_escape_string($_GET['id']); $query = mysql_query("SELECT SQL_CACHE id, name FROM s_servers WHERE id = $id"); $row = mysql_fetch_assoc($query); ?> <form action="" method="POST"> <table width="800" height="106" border="0" align="center" cellpadding="3" cellspacing="0" class="mid-table"> <tr><td><div align="center"> <p>Code: <input type="text" name="kod" class="port" /><img src="img.php" id="captcha2" alt="" /><a href="javascript:void(0);" onclick="document.getElementById('captcha2').src = document.getElementById('captcha2').src + '?' + (new Date()).getMilliseconds()">Refresh</a></p><br /> <p><input type="submit" class="vote-button" name="vote" value="Vote for <?php echo $row['name']; ?>" /></p> <input type="hidden" name="submitted" value="TRUE" /> <input type="hidden" name="id" value="<?php echo $row['id']; ?>" /> </div></td></tr> <tr><td align="center" valign="top"><img src="images/ads/top_banner.png"></td></tr> </table> </form> <?php } else { echo '<font color="red">You must select a valid server to vote for it!</font>'; } } else { $kod=$_POST['kod']; if($kod!=$_COOKIE[imgcodepage]) { echo "The code does not match"; } else { $id = mysql_real_escape_string($_POST['id']); $query = "SELECT SQL_CACHE id, votes FROM s_servers WHERE id = $id"; $result = mysql_query($query) OR die(mysql_error()); $row = mysql_fetch_array($result, MYSQL_ASSOC); $votes = $row['votes']; $id = $row['id']; $cookie_name = 'vote_'.$id; $ip = $_SERVER['REMOTE_ADDR']; $ltime = mysql_fetch_assoc(mysql_query("SELECT SQL_CACHE `time` FROM `s_votes` WHERE `sid`='$id' AND `ip`='$ip'")); $ltime = $ltime['time'] + 86400; $time = time(); if (isset($_COOKIE['vote_'.$id]) OR $ltime > $time) { echo 'You have already voted in last 24 hours! Your vote is not recorded.'; } else { $votes++; $query = "UPDATE s_servers SET votes = $votes WHERE id = $id"; $time = time(); $query2 = mysql_query("INSERT INTO `s_votes` (`ip`, `time`, `sid`) VALUES ('$ip', '$time', '$id')"); $result = mysql_query($query) OR die(mysql_error()); setcookie ($cookie_name, 1, time()+86400, '/', '', 0); } } } ?> <p><a href="index.php">[Click here if you don't want to vote]</a></p><br/> <p><a href="index.php">Ranking.net</a> &copy; 2010-2011<br> </p> </div> </body> </html> Thanks a lot!

    Read the article

  • beforeSave() returned some error

    - by kwokwai
    Hi all, I got a simple input text field in a HTML form: <input type="text" name="data[User][pswd]" id="data[User][pswd]"> The scripts for the Controller's action that captured the data is as follows: function register(){ $temp = $this->data; if(strlen($temp['User']['pswd'])>6) { if ($this->User->save($this->data)) { $this->Session->setFlash('Data was Saved'); } } } // this script works And in the Model controller, I got these lines of codes: function beforeSave() { $raw = $this->data; if(strlen($raw['User']['pswd'])>6){ md5($raw['User']['pswd']); } return true; } // this script failed to work The data was stored into the Database successfully but it was not undergone any MD5 encryption. I think that there must be some errors in the Model's script because I saw some errors flashed after the data was saved, but the screen that showed the errors immediately refreshed in a second after the data was saved successfully and I couldn't see the detail of the errors that caused the problem. Could you help me out please?

    Read the article

  • Datepicker (1.8rc3) not transferring date in IE6

    - by brianjcohen
    Using jquery-1.4.2 and jquery-UI 1.8rc3, I instantiated a datepicker on a text input with showOn: 'focus'. The datepicker appears correctly. However when I click on a date, the datepicker doesn't disappear and the dateStr doesn't get transferred to the text input. I tried adding an onClose: handler that calls alert(dateStr). The event fires but no dateStr has been set. Everything works fine in Firefox. I have Microsoft Script Debugger installed but no script errors were detected. I did report this as a potential problem at the jQuery UI forums but my message has been sitting there awaiting moderation for hours and I figured someone here might have a suggestion. $().ready(function() { $(".date").datepicker({ showOn: 'focus', onClose: function(dateText) { alert(dateText); } }); });

    Read the article

  • Unable to recieve file contents on server during upload

    - by Khushal
    Hello, I have a JSP page in which I have a file input field from which I browse a csv file and then upload it on server. I am using method = "POST" and ENCTYPE='multipart/form-data' in the form in which this file input field is present. On the servlet side(in the application's servlet) I am making use of apache's commom file upload API-ServletFileUpload API. After getting the FileItem list from the method parseRequest(request) of this API I am unable to get the file name and its content by using the methods getName(), getString() of FileItem API. Needed to know what am I doing wrong or any modifications in my approach that will make my application to work. Any pointers regarding this will be helpful. Thanks in advance!!

    Read the article

  • Outputting audio stream into microphone

    - by Brap
    Hey everyone. Is there a way of outputting audio from my program and redirecting that stream to the system's microphone input 'layer'? I understand this might require some low-level calls being 'Pinvoked', but are there any articles that might help me. For example, if I was to run the output audio stream of my application into Window's Sound Recorder program, it would think that the audio is coming from a microphone and thus record that. I don't want to record a stream, just output it to the device's micrphone input. Thanks for any ideas.

    Read the article

  • javascript - Google Chrome cluttering Array generated from .split()

    - by patrick
    Given the following string: var str = "one,two,three"; If I split the string on the commas, I normally get an array, as expected: var arr = str.split(/\s*,\s*/); Trouble is that in Google Chrome (for Mac), it appends extra properties to the array. Output from Chrome's debugger: arr: Array 0: one 1: two 2: three constructor: function Array() index: undefined input: undefined length: 3 So if I iterate over the array with a for/in loop, it iterates over the new properties. Specifically the input and index properties. Using hasOwnProperty doesn't seem to help. A fix would be to do a for loop based on the length of the Array. Still I'm wondering if anyone has insight into why Chrome behaves this way. Firefox and Safari don't have this issue.

    Read the article

  • removeClass doesn't work on the second DIV tag

    - by kwokwai
    Hi all, I am learning JQuery and writing a simple data validation for the two fields in a HTML form: <FORM name="addpost" id="addpost" method="post" action="/add"> <TABLE BORDER=0 width="100%"> <TR> <TD>Topic</TD> <TD> <DIV ID="topic"> <INPUT type=text name="topic" id="topic" size="72" maxlength="108"/> </DIV> </TD> </TR> <TR> <TD>Comments</TD> <TD> <DIV ID="topiccontent"> <TEXTAREA rows="12" cols="48" name="content" ID="content"> </TEXTAREA> </DIV> </TD> </TR> <TR> <TD> <INPUT type="submit" value="Send"> </TD> </TR> </TABLE> </FORM> Here is the JQuery script for checking the data input from the form above: $('#addpost').submit(function(){ if($('#topic').val()==""){ $('#topic').addClass('hierror'); return false;} else{$('#topic').removeClass('hierror');} if($('#topiccontent').val()==""){ $('#topiccontent').addClass('hierror'); return false;} else{$('#topiccontent').removeClass('hierror');} }); Here is the CSS for the hierror class: .hierror{border-style:solid; border-width:12px; border-color:#FF0000;} ('#topic').removeClass('hierror') works but ('#topiccontent').removeClass('hierror') doesn't. Could you help me please?

    Read the article

  • Scalable stl set like container for C++

    - by Pqr
    Hi, I need to store large number of integers. There can be duplicates in the input stream of integers, I just need to store distinct amongst them. I was using stl set initially but It went OutOfMem when input number of integers went too high. I am looking for some C++ container library which would allow me to store numbers with the said requirement possibly backed by file i.e container should not try to keep all numbers in-mem. I don't need to store this data persistently, I just need to find unique values amongst it.

    Read the article

< Previous Page | 358 359 360 361 362 363 364 365 366 367 368 369  | Next Page >