Search Results

Search found 10463 results on 419 pages for 'task tracking'.

Page 365/419 | < Previous Page | 361 362 363 364 365 366 367 368 369 370 371 372  | Next Page >

  • How to implement a multi-threaded asynchronous operation?

    - by drowneath
    Here's how my current approach looks like: // Somewhere in a UI class // Called when a button called "Start" clicked MyWindow::OnStartClicked(Event &sender) { _thread = new boost::thread(boost::bind(&MyWindow::WorkToDo, this)); } MyWindow::WorkToDo() { for(int i = 1; i < 10000000; i++) { int percentage = (int)((float)i / 100000000.f); _progressBar->SetValue(percentage); _statusText->SetText("Working... %d%%", percentage); printf("Pretend to do something useful...\n"); } } // Called on every frame MyWindow::OnUpdate() { if(_thread != 0 && _thread->timed_join(boost::posix_time::seconds(0)) { _progressBar->SetValue(100); _statusText->SetText("Completed!"); delete _thread; _thread = 0; } } But I'm afraid this is far from safe since I keep getting unhandled exception at the end of the program execution. I basically want to separate a heavy task into another thread without blocking the GUI part.

    Read the article

  • How to handle Win+Shift+LEft/Right on Win7 with custom WM_GETMINMAXINFO logic?

    - by Steven Robbins
    I have a custom windows implementation in a WPF app that hooks WM_GETMINMAXINFO as follows: private void MaximiseWithTaskbar(System.IntPtr hwnd, System.IntPtr lParam) { MINMAXINFO mmi = (MINMAXINFO)Marshal.PtrToStructure(lParam, typeof(MINMAXINFO)); System.IntPtr monitor = MonitorFromWindow(hwnd, MONITOR_DEFAULTTONEAREST); if (monitor != System.IntPtr.Zero) { MONITORINFO monitorInfo = new MONITORINFO(); GetMonitorInfo(monitor, monitorInfo); RECT rcWorkArea = monitorInfo.rcWork; RECT rcMonitorArea = monitorInfo.rcMonitor; mmi.ptMaxPosition.x = Math.Abs(rcWorkArea.left - rcMonitorArea.left); mmi.ptMaxPosition.y = Math.Abs(rcWorkArea.top - rcMonitorArea.top); mmi.ptMaxSize.x = Math.Abs(rcWorkArea.right - rcWorkArea.left); mmi.ptMaxSize.y = Math.Abs(rcWorkArea.bottom - rcWorkArea.top); mmi.ptMinTrackSize.x = Convert.ToInt16(this.MinWidth * (desktopDpiX / 96)); mmi.ptMinTrackSize.y = Convert.ToInt16(this.MinHeight * (desktopDpiY / 96)); } Marshal.StructureToPtr(mmi, lParam, true); } It all works a treat and it allows me to have a borderless window maximized without having it sit on to of the task bar, which is great, but it really doesn't like being moved between monitors with the new Win7 keyboard shortcuts. Whenever the app is moved with Win+Shift+Left/Right the WM_GETMINMAXINFO message is received, as I'd expect, but MonitorFromWindow(hwnd, MONITOR_DEFAULTTONEAREST) returns the monitor the application has just been moved FROM, rather than the monitor it is moving TO, so if the monitors are of differing resolutions the window end up the wrong size. I'm not sure if there's something else I can call, other then MonitorFromWindow, or whether there's a "moving monitors" message I can hook prior to WM_GETMINMAXINFO. I'm assuming there is a way to do it because "normal" windows work just fine.

    Read the article

  • Compromising design & code quality to integrate with existing modules

    - by filip-fku
    Greetings! I inherited a C#.NET application I have been extending and improving for a while now. Overall it was obviously a rush-job (or whoever wrote it was seemingly less competent than myself). The app pulls some data from an embedded device & displays and manipulates it. At the core is a communications thread in the main application form which executes a 600+ lines of code method which calls functions all over the place, implementing a state machine - lots of if-state-then-do type code. Interaction with the device is done by setting the state/mode globally and letting the thread do it's thing. (This is just one example of the badness of the code - overall it is not very OO-like, it reminds of the style of embedded C code the device firmware is written in). My problem is that this piece of code is central to the application. The software, communications protocol or device firmware are not documented at all. Obviously to carry on with my work I have to interact with this code. What I would like some guidance on, is whether it is worth scrapping this code & trying to piece together something more reasonable from the information I can reverse engineer? I can't decide! The reason I don't want to refactor is because the code already works, and changing it will surely be a long, laborious and unpleasant task. On the flip side, not refactoring means I have to sometimes compromise the design of other modules so that I may call my code from this state machine! I've heard of "If it ain't broke don't fix it!", so I am wondering if it should apply when "it" is influencing the design of future code! Any advice would be appreciated! Thanks!

    Read the article

  • How to detect a Socket disconnection?

    - by AngryHacker
    I've implemented a task using the async Sockets pattern in Silverlight 3. I started with Michael Schwarz's implementation and built on top of that. So basically, my Silverlight app establishes a persistent socket connection to a device and then data flows both ways as necessary between the device and the Silverlight app. One thing I am struggling with is how to detect disconnection. I could think of 2 approaches: Keep-Alive. I know this can be done at the Sockets level, but I am not sure how to do this in an async model. How would the Socket class let me know there has been a disconnection. Manual keep alive. Basically, I am having the Silverlight app send a dummy packet every 20 seconds or so. If it fails, I'd assume disconnection. However, incredibly, SocketAsyncEventArgs.SocketError always reports success, even if I simply unplug the device that the Silverlight app is connected to. I am not sure whether this is a bug or what or perhaps I need to upgrade to SL4. Any ideas, direction or implementation would be appreciated.

    Read the article

  • What is the best way to find a processed memory allocations in terms of C# objects

    - by Shantaram
    I have written various C# console based applications, some of them long running some not, which can over time have a large memory foot print. When looking at the windows perofrmance monitor via the task manager, the same question keeps cropping up in my mind; how do I get a break down of the number objects by type that are contributing to this footprint; and which of those are f-reachable and those which aren't and hence can be collected. On numerous occasions I've performed a code inspection to ensure that I am not unnecessarily holding on objects longer than required and disposing of objects with the using construct. I have also recently looked at employing the CG.Collect method when I have released a large number of objects (for example held in a collection which has just been cleared). However, I am not so sure that this made that much difference, so I threw that code away. I am guessing that there are tools in sysinternals suite than can help to resolve these memory type quiestions but I am not sure which and how to use them. The alternative would be to pay for a third party profiling tool such as JetBrains dotTrace; but I need to make sure that I've explored the free options first before going cap in hand to my manager.

    Read the article

  • Image Resizing and Compression

    - by GSTAR
    Hi guys, I'm implementing an image upload facility for my website. The uploading facility is complete but what I'm working on at the moment is manipulating the images. For this task I am using PHPThumb (http://phpthumb.gxdlabs.com). Anyway as I go along I'm coming across potential issues, to do with resizing and compression. Basically I want to acheive the following results: The ideal image dimensions are: 800px width, 600px height. If an uploaded image exceeds either of these dimensions, it will need be resized to meet the requirements. Otherwise, leave as it is. The ideal file size is 200kb. If an uploaded image exceeds this then it will need to be compressed to meet this requirement. Otherwise, leave as it is. So in a nutshell: 1) Check the dimensions, resize if required. 2) Check the filesize, compress if required. Has anybody done anything like this / could you give me some pointers? Is PHPThumb the correct tool to do this in?

    Read the article

  • Vim: change formatting of variables in a script

    - by sixtyfootersdude
    I am using vim to edit a shell script (did not use the right coding standard). I need to change all of my variables from camel-hum-notation startTime to caps-and-underscore-notation START_TIME. I do not want to change the way method names are represented. I was thinking one way to do this would be to write a function and map it to a key. The function could do something like generating this on the command line: s/<word under cursor>/<leave cursor here to type what to replace with> I think that this function could be applyable to other situations which would be handy. Two questions: Question 1: How would I go about creating that function. I have created functions in vim before the biggest thing I am clueless about is how to capture movement. Ie if you press dw in vim it will delete the rest of a word. How do you capture that? Also can you leave an uncompleted command on the vim command line? Question 2: Got a better solution for me? How would you approach this task?

    Read the article

  • How to make smooth transition from a WebBrowser control to an Image in Silverlight 4?

    - by Trex
    Hi, I have the following XAML on my page: `<Grid x:Name="LayoutRoot"> <Viewbox Stretch="Uniform"> <Image x:Name="myImage" /> </Viewbox> <WebBrowser x:Name="myBrowser" /> </Grid>` and then in the codebehind I'm switching the visibility between the image and the browser content: myBrowser.Visibility = Visibility.Collapsed; myImage.Source = new BitmapImage(new Uri(p)); myImage.Visibility = Visibility.Visible; and myImage.Visibility = Visibility.Collapsed; myBrowser.Source = new Uri(myPath + p, UriKind.Absolute); myBrowser.Visibility = Visibility.Visible; This works fine, but what the client now wants is a smooth transition between when the Image is shown and when the browser is shown. I tried several approaches but always ran into dead end. Do you have any ideas? I tried setting two states using the VSM and than displaying a white rectangle on top as an overlay, before the swap takes place, but that didn't work (I guess it's because nothing can be placed above the WebBroser???) I tried setting the Visibility of the image control and the webbrowser control using the VSM, but that didn't work either. I really don't know what else to try to solve this simple task. Any help is greatly appreciated. Jan

    Read the article

  • Hundreds of custom UserControls create thousands of USER Objects

    - by Andy Blackman
    I'm creating a dashboard application that shows hundreds of "items" on a FlowLayoutPanel. Each "item" is a UserControl that is made up of 12 or labels. My app queries a database and then creates an "item" instance for each record, populating ethe labels and textboxes with data before adding it to the FlowLayoutPanel. After adding about 560 items to the panel, I noticed that the USER Objects count in my Task Manager had gone up to about 7300, which was much much larger than any other app on my machine. I did a quick spot of mental arithmetic (OK, I might have used calc.exe) and figured that 560 * 13 (12 labels plus the UserControl itself) is 7280. So that suddenly gave away where all the objects were coming from... Knowing that there is a 10,000 USER object limit before windows throws in the towel, I'm trying to figure better ways of drawing these items onto the FlowLayoutPanel. My ideas so far are as follows: 1) User-draw the "item", using graphics.DrawText and DrawImage in place of many of the labels. I'm hoping that this will mean 1 item = 1 USER Object, not 13. 2) Have 1 instance of the "item", then for each record, populate the instance and use the Control.DrawToBitmap() method to grab an image and then use that in the FlowLayoutPanel (or similar) So... Does anyone have any other suggestions ??? P.S. It's a zoomable interface, so I have already ruled out "Paging" as there is a requirement to see all items at once :( Thanks everyone.

    Read the article

  • lapply slower than for-loop when used for a BiomaRt query. Is that expected?

    - by ptocquin
    I would like to query a database using BiomaRt package. I have loci and want to retrieve some related information, let say description. I first try to use lapply but was surprise by the time needed for the task to be performed. I thus tried a more basic for-loop and get a faster result. Is that expected or is something wrong with my code or with my understanding of apply ? I read other posts dealing with *apply vs for-loop performance (Here, for example) and I was aware that improved performance should not be expected but I don't understand why performance here is actually lower. Here is a reproducible example. 1) Loading the library and selecting the database : library("biomaRt") athaliana <- useMart("plants_mart_14") athaliana <- useDataset("athaliana_eg_gene",mart=athaliana) 2) Querying the database : loci <- c("at1g01300", "at1g01800", "at1g01900", "at1g02335", "at1g02790", "at1g03220", "at1g03230", "at1g04040", "at1g04110", "at1g05240" ) I create a function for the use in lapply : foo <- function(loci) { getBM("description","tair_locus",loci,athaliana) } When I use this function on the first element : > system.time(foo(cwp_loci[1])) utilisateur système écoulé 0.020 0.004 1.599 When I use lapply to retrieve the data for all values : > system.time(lapply(loci, foo)) utilisateur système écoulé 0.220 0.000 16.376 I then created a new function, adding a for-loop : foo2 <- function(loci) { for (i in loci) { getBM("description","tair_locus",loci[i],athaliana) } } Here is the result : > system.time(foo2(loci)) utilisateur système écoulé 0.204 0.004 10.919 Of course, this will be applied to a big list of loci, so the best performing option is needed. I thank you for assistance. EDIT Following recommendation of @MartinMorgan Simply passing the vector loci to getBM greatly improves the query efficiency. Simpler is better. > system.time(lapply(loci, foo)) utilisateur système écoulé 0.236 0.024 110.512 > system.time(foo2(loci)) utilisateur système écoulé 0.208 0.040 116.099 > system.time(foo(loci)) utilisateur système écoulé 0.028 0.000 6.193

    Read the article

  • PendingIntent in Widget + TaskKiller

    - by YaW
    Hi, I've developed an Application (called Instant Buttons) and the app has a widget feature. This widget uses PendingIntent for the onClick of the widget. My PendingIntent code is something like this: Intent active = new Intent(context, InstantWidget.class); active.setAction(String.valueOf(appWidgetId)); active.putExtra("blabla", blabla); //Some data PendingIntent actionPendingIntent = PendingIntent.getBroadcast(context, 0, active, 0); actionPendingIntent.cancel(); actionPendingIntent = PendingIntent.getBroadcast(context, 0, active, 0); remoteViews.setOnClickPendingIntent(R.id.button, actionPendingIntent); The onReceive gets the intent and do some stuff with the MediaPlayer class to reproduce a sound. I have reports from some users that the widgets stop working after a while and with some research i've discovered is because the Task Killers. It seems that when you kill the app in the TaskKiller, the PendingIntent is erased from memory, so when you click the widget, it doesn't know what to do. Is there any solution for this? Is my code wrong or something or it's the default behavior of the PendingIntent? Is there something I can use to avoid the TaskKiller to stop my widgets from working?? Greetings.

    Read the article

  • is it possible to write a program which prints its own source code utilizing a "sequence-generating-

    - by guest
    is it possible to write a program which prints its own source code utilizing a "sequence-generating-function"? what i call a sequence-generating-function is simply a function which returns a value out of a specific interval (i.e. printable ascii-charecters (32-126)). the point now is, that this generated sequence should be the programs own source-code. as you see, implementing a function which returns an arbitrary sequence is really trivial, but since the returned sequence must contain the implementation of the function itself it is a highly non-trivial task. this is how such a program (and its corresponding output) could look like #include <stdio.h> int fun(int x) { ins1; ins2; ins3; . . . return y; } int main(void) { int i; for ( i=0; i<size of the program; i++ ) { printf("%c", fun(i)); } return 0; } i personally think it is not possible, but since i don't know very much about the underlying matter i posted my thoughts here. i'm really looking forward to hear some opinions!

    Read the article

  • Functioning Socket read no longer works when called in AsyncTask

    - by bibismcbryde
    I'm making an app that sends a string to a server over a socket and then reads the output after the server has processed that data. It worked perfectly when it was my foreground task, but I have since used AsyncTask to show a process dialog while the socket communication runs in the background, and things start breaking after I read the output from the server and then try to close the socket. private class Progressor extends AsyncTask<String, Void, Void> { ProgressDialog dialog; protected void onPreExecute() { dialog = ProgressDialog.show(ClearTalkInputActivity.this, "Loading..", "Analyzing Text", true, false); } protected Void doInBackground(String... strings) { String language = strings[0].toLowerCase(); String the_text = strings[1]; Socket socket = null; DataOutputStream dos = null; DataInputStream dis = null; try { socket = new Socket(my_ip, port); dos = new DataOutputStream(socket.getOutputStream()); dis = new DataInputStream(socket.getInputStream()); dos.writeUTF(language+"****"+the_text); String in = ""; while (in.indexOf("</content>") < 0) { in += dis.readUTF(); } socket.close(); save_str(OUTPUT_KEY, in); } catch (UnknownHostException e) { e.printStackTrace(); } catch (IOException e) { e.printStackTrace(); } finally { if (socket != null) { try { socket.close(); } catch (IOException e) { e.printStackTrace(); } } } if (dos != null) { try { dos.close(); } catch (IOException e) { e.printStackTrace(); } } if (dis != null) { try { dis.close(); } catch (IOException e) { e.printStackTrace(); } } return null; } protected void onPostExecute() { if (dialog.isShowing()) dialog.dismiss(); startActivity(new Intent (output_intent)); } }

    Read the article

  • Advice: Python Framework Server/Worker Queue management (not Website)

    - by Muppet Geoff
    I am looking for some advice/opinions of which Python Framework to use in an implementation of multiple 'Worker' PCs co-ordinated from a central Queue Manager. For completeness, the 'Worker' PCs will be running Audio Conversion routines (which I do not need advice on, and have standalone code that works). The Audio conversion takes a long time, and I need to co-ordinate an arbitrary number of the 'Workers' from a central location, handing them conversion tasks (such as where to get the source files, or where to ask for the job configuration) with them reporting back some additional info, such as the runtime of the converted audio etc. At present, I have a script that makes a webservice call to get the 'configuration' for a conversion task, based on source files located on the worker already (we manually copy the source files to the worker, and that triggers a conversion routine). I want to change this, so that we can distribute conversion tasks ("Oy you, process this: xxx") based on availability, and in an ideal world, based on pending tasks too. There is a chance that Workers can go offline mid-conversion (but this is not likely). All the workers are Windows based, the co-ordinator can be WIndows or Linux. I have (in my initial searches) come across the following - and I know that some are cross-dependent: Celery (with RabbitMQ) Twisted Django Using a framework, rather than home-brewing, seems to make more sense to me right now. I have a limited timeframe in which to develop this functional extension. An additional consideration would be using a Framework that is compatible with PyQT/PySide so that I can write a simple UI to display Queue status etc. I appreciate that the specifics above are a little vague, and I hope that someone can offer me a pointer or two. Again: I am looking for general advice on which Python framework to investigate further, for developing a Server/Worker 'Queue management' solution, for non-web activities (this is why DJango didn't seem the right fit).

    Read the article

  • What Test Environment Setup do Top Project Committers Use in the Ruby Community?

    - by viatropos
    Today I am going to get as far as I can setting up my testing environment and workflow. I'm looking for practical advice on how to setup the test environment from you guys who are very passionate and versed in Ruby Testing. By the end of the day (6am PST?) I would like to be able to: Type one 1-command to run test suites for ANY project I find on Github. Run autotest for ANY Github project so I can fork and make TESTABLE contributions. Build gems from the ground up with Autotest and Shoulda. For one reason or another, I hardly ever run tests for projects I clone from Github. The major reason is because unless they're using RSpec and have a Rake task to run the tests, I don't see the common pattern behind it all. I have built 3 or 4 gems writing tests with RSpec, and while I find the DSL fun, it's less than ideal because it just adds another layer/language of methods I have to learn and remember. So I'm going with Shoulda. But this isn't a question about which testing framework to choose. So the questions are: What is your, the SO reader and Github project committer, test environment setup using autotest so that whenever you git clone a gem, you can run the tests and autotest-develop them if desired? What are the guys who are writing the Paperclip Tests and Authlogic Tests doing? What is their setup? Thanks for the insight. Looking for answers that will make me a more effective tester.

    Read the article

  • Turning a series of raw images into movie frames in Android

    - by Nicholas Killewald
    I've got an Android project I'm working on that, ultimately, will require me to create a movie file out of a series of still images taken with a phone's camera. That is to say, I want to be able to take raw image frames and string them together, one by one, into a movie. Audio is not a concern at this stage. Looking over the Android API, it looks like there are calls in it to create movie files, but it seems those are entirely geared around making a live recording from the camera on an immediate basis. While nice, I can't use that for my purposes, as I need to put annotations and other post-production things on the images as they come in before they get fed into a movie (plus, the images come way too slowly to do a live recording). Worse, looking over the Android source, it looks like a non-trivial task to rewire that to do what I want it to do (at least without touching the NDK). Is there any way I can use the API to do something like this? Or alternatively, what would be the best way to go about this, if it's even feasible on cell phone hardware (which seems to keep getting more and more powerful, strangely...)?

    Read the article

  • Using custom Qt subclasses in Python

    - by kwatford
    First off: I'm new to both Qt and SWIG. Currently reading documentation for both of these, but this is a time consuming task, so I'm looking for some spoilers. It's good to know up-front whether something just won't work. I'm attempting to formulate a modular architecture for some in-house software. The core components are in C++ and exposed via SWIG to Python for experimentation and rapid prototyping of new components. Qt seems like it has some classes I could use to avoid re-inventing the wheel too much here, but I'm concerned about how some of the bits will fit together. Specifically, if I create some C++ classes, I'll need to expose them via SWIG. Some of these classes likely subclass Qt classes or otherwise have Qt stuff exposed in their public interfaces. This seems like it could raise some complications. There are already two interfaces for Qt in Python, PyQt and PySide. Will probably use PySide for licensing reasons. About how painful should I expect it to be to get a SWIG-wrapped custom subclass of a Qt class to play nice with either of these? What complications should I know about upfront?

    Read the article

  • How does PHP interface with Apache?

    - by Sbm007
    Hi, I've almost finished writing a HTTP/1.0 compliant web server under Java (no commercial usage as such, this is just for fun) and basically I want to include PHP support. I realize that this is no easy task at all, but I think it'll be a nice accomplishment. So I want to know how PHP exactly interfaces with the Apache web server (or any other web server really), so I can learn from it and write my own PHP wrapper. It doesn't necessarily have to be mod_php, I don't mind writing a FastCGI wrapper - which to my knowledge is capable of running PHP as well. I would've thought that all that PHP needs is the output that goes to client (so it can interpret the PHP parts), the full HTTP request from client (so it can extract POST variables and such) and the client's host name. And then you simply take the parsed PHP code and write that to the output stream. There will probably be more things, but in essence that's how I would have thought it works. From what I've gathered so far, apache2handler provides an API which PHP makes use of to 'connect' to Apache. I guess it's an idea to look at the source code for apache2handler and php5apache2.dll or so, but before I do that I thought I'd ask SO first. If anyone has more information, experience, or some sort of specification that is relevant to this then please let me know. Thanks in advance!

    Read the article

  • How to exclude tags folder from triggering build in Teamcity?

    - by Jaya mareedu
    Hello, I recently installed Teamcity 5.0.3. I am trying to setup automated build for a .NET 2.0 VS2005 project. I use NAnt and MSBuild task to perform the build. The project structure is a typical SVN structure svn://localhost/ITools is my repository and the project structure is VisualTrack trunk branches tags I created a new project in Teamcity and then created a build configuration for that project. I asked it to kick off a build everytime there is a change detected in SVN VisualTrack VCS. I also configured it to create a label in VisualTrack/tags for every successful build. The problem I am running into is that the build is getting trigerred everytime teamcity is creating a new label under tags. I only want the build to be triggered if some developer commits his or her changes into trunk. Next step I took was to create a build trigger rule to exclude the tags path by specifying a trigger pattern as -:VisualTrack/tags/**, but looks like its not working. I believe the pattern I specified is not correct. Can someone please help me resolve this issue? Thanks, Jaya.

    Read the article

  • measure the response time of a link

    - by Ahoura Ghotbi
    I am trying to create a simple load balance script and I was wondering if it is possible to find the response time of a server live? By that I mean is it possible to measure how long it takes for a server to respond after the request has been sent out? What I am trying to do is fairly simple, I want to send a request to a link/server and do a count down, if the server took more than 5 seconds to reply, I would like to fall on the backup server. Note that it doesnt have to be in pure php, I wouldnt mind using other languages such as javascript, C/C++, asp, but I prefer to do it in PHP. if it is possible to do the task, could you just point me to the right direction so I can read up on it. Clarification What I want to do is not to download a file and see how long it took, my servers have high load and it takes a while for them to respond when you click on a file to download, what I want to do is to measure the time it takes the server to respond (in this situation, its the time it takes the server to respond and allow the user to download the file), and if it takes longer than x seconds, it should fall back on a backup server.

    Read the article

  • First Time Architecturing?

    - by cam
    I was recently given the task of rebuilding an existing RIA. The new RIA that I've designed is based on Silverlight, with a WCF service to connect to MS SQL Server. This is my first time doing something like this, so I'm not sure how to design the entire thing. Basically, the client can look through graphs of "stocks" (allowing the client to choose different time periods, settings, etc). I've written the whole application essentially, but I'm not sure how to put it together. The graphs are supposed to be directly based on the database, and to create the datapoints on the graph, some calculations need to be done (not very expensive ones). The problem I'm having is to decide where to put the calculations (client or serverside? Or half and half?) What factors should I look for to help me decide where the calculations should be done? And how can I go about optimizing this (caching, etc)? Obviously this is a very broad subject, so I'm not expecting an immediate answer, but any help/pointing in the right direction/resources would be appreciated.

    Read the article

  • do the Python libraries have a natural dependence on the global namespace?

    - by msw
    I first ran into this when trying to determine the relative performance of two generators: t = timeit.repeat('g.get()', setup='g = my_generator()') So I dug into the timeit module and found that the setup and statement are evaluated with their own private, initially empty namespaces so naturally the binding of g never becomes accessible to the g.get() statement. The obvious solution is to wrap them into a class, thus adding to the global namespace. I bumped into this again when attempting, in another project, to use the multiprocessing module to divide a task among workers. I even bundled everything nicely into a class but unfortunately the call pool.apply_async(runmc, arg) fails with a PicklingError because buried inside the work object that runmc instantiates is (effectively) an assignment: self.predicate = lambda x, y: x > y so the whole object can't be (understandably) pickled and whereas: def foo(x, y): return x > y pickle.dumps(foo) is fine, the sequence bar = lambda x, y: x > y yields True from callable(bar) and from type(bar), but it Can't pickle <function <lambda> at 0xb759b764>: it's not found as __main__.<lambda>. I've given only code fragments because I can easily fix these cases by merely pulling them out into module or object level defs. The bug here appears to be in my understanding of the semantics of namespace use in general. If the nature of the language requires that I create more def statements I'll happily do so; I fear that I'm missing an essential concept though. Why is there such a strong reliance on the global namespace? Or, what am I failing to understand? Namespaces are one honking great idea -- let's do more of those!

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Mono Text Based Web Browser

    - by powerbox
    Hi guys, is there any public text based web browser implementation for C# or on mono base api that I can use to fill up web forms automatically? I'll be using it to automate some web task that does not require any image authentication. I'm currently using a web browser control available on .Net Framework and waits for the event WebBrowserDocumentCompletedEventHandler to fire after a page is successfully loaded and invoke some actions like Submit or simulating a mouse click on some links. It actually does the job but I can't process bulk transactions since I needed to wait for the whole page to be loaded together with the images and other stuff. It is easy to use HttpWebRequest to fill up some forms , provide some data and then submit. But on some occasions I only need to simulate a mouse click to a certain link which I don't know how to do with HttpWebRequest. By the way using HttpWebRequest will still download all the images of a web page that I see pointless since I only need to provide correct data back to the server. I hope someone can pinpoint me the correct way of doing this kind of automation and thanks in advance!

    Read the article

  • Application process never terminates on each run

    - by rockyurock
    I am seeing an application always remains live even after closing the application using my Perl script below. Also, for the subsequent runs, it always says that "The process cannot access the file because it is being used by another process. iperf.exe -u -s -p 5001 successful. Output was:" So every time I have to change the file name $file used in script or I have to kill the iperf.exe process in the Task Manager. Could anybody please let me know the way to get rid of it? Here is the code I am using ... my @command_output; eval { my $file = "abc6.txt"; $command = "iperf.exe -u -s -p 5001"; alarm 10; system("$command > $file"); alarm 0; close $file; }; if ($@) { warn "$command timed out.\n"; } else { print "$command successful. Output was:\n", $file; } unlink $file;

    Read the article

< Previous Page | 361 362 363 364 365 366 367 368 369 370 371 372  | Next Page >