Search Results

Search found 36874 results on 1475 pages for 'string comparison'.

Page 370/1475 | < Previous Page | 366 367 368 369 370 371 372 373 374 375 376 377  | Next Page >

  • In scala can I pass repeated parameters to other methods?

    - by Fred Haslam
    Here is something I can do in java, take the results of a repeated parameter and pass it to another method: public void foo(String ... args){bar(args);} public void bar(String ... args){System.out.println("count="+args.length);} In scala it would look like this: def foo(args:String*) = bar(args) def bar(args:String*) = println("count="+args.length) But this won't compile, the bar signature expects a series of individual strings, and the args passed in is some non-string structure. For now I'm just passing around arrays. It would be very nice to use starred parameters. Is there some way to do it?

    Read the article

  • call method from main class, gives error

    - by user557039
    try to call method ss from class from it return me error, Blockquote Exception in thread "main" java.lang.NullPointerException at teste1.exp.ss(exp.java:16) at teste1.Main.main(Main.java:64) Java Result: 1 Blockquote <pre> public class Main { public static void main(String[] arguments) { ................... private static String[] ff; exp mega = new exp(); mega.ss(ff); } class exp { public void ss (String gvanswer[]){ String answer[] = new String[3]; answer[0] = "pacific "; answer[1] = "everest"; answer[2] = "amazon "; if (gvnswer[0].equals("pacific")) {System.out.println("eeeeeeeeeeeeee ");} if (gvanswer[1].equals(answer[1])){System.out.println("l ");} }

    Read the article

  • Why is the output like this?

    - by javatechi
    class another { public void method(Object o) { System.out.println("This is in method which takes object"); } public void method(String s) { System.out.println("This is method which takes string"); } } public class NewClass { public static void main(String args[]) { another an = new another(); an.method(null); } } When I try to execute this, I get This is method which takes string as the output. Why not "This is in method which takes object"? Object can also be null and string can also be null, why doesn't it invoke first method?

    Read the article

  • Is it bad practice to initialize a variable to a dummy value?

    - by froadie
    This question is a result of the answers to this question that I just asked. It was claimed that this code is "ugly" because it initializes a variable to a value that will never be read: String tempName = null; try{ tempName = buildFileName(); } catch(Exception e){ ... System.exit(1); } FILE_NAME = tempName; Is this indeed bad practice? Should one avoid initializing variables to dummy values that will never actually be used? (EDIT - And what about initializing a String variable to "" before a loop that will concatenate values to the String...? Or is this in a separate category? e.g. String whatever = ""; for(String str : someCollection){ whatever += str; } )

    Read the article

  • loop for Cursor1.moveToPosition() in android

    - by Edward Sullen
    I want to get data in the first column of all row from my database and convert to String[] ... List<String> item1 = new ArrayList<String>(); // c is a cursor which pointed from a database for(int i=0;i<=nombre_row;i++) { c.moveToPosition(i); item1.add(c.getString(0)); } String[] strarray = new String[item1.size()]; item1.toArray(strarray ); I've tried to command step by step, and found that the problem is in the Loop for.... Please help... thanks in advance for all answer.

    Read the article

  • Full automatic application trace for .net v4

    - by JL
    I would like to implement a way to trace every line of code in an application that is written for .net v4.0. An example would be. If I had the following function. private bool hasValue(string value) { if(string.isnullorempty(value) { return false; } else { return true; }} Then when the function is called I want detailed trace logs to contain something like this: Function called |Line 10 |Signature private bool hasValue(string value)|ValuesPassed hasValue("") Line Evaluated | Line 11 | if(string.isnullorempty(value) |ValuesPassed if(string.isnullorempty("") - evaluation returned true entered line 13 |signature return false|return action taken. This tracing can be done manually, but its a lot of work, and would dirty the code. Isn't there a way to get this level of tracing automatically with .net or 3rd party plugin? Thank you

    Read the article

  • Casting complex class into a dataset?

    - by iTayb
    This is the class I'm trying to turn into a dataset: public class BookStore { private List<Book> booksList; } public class Book { private string name; private string imageurl; private string subject; private string author; private int level; private int year; private int rating; private List<string> booksellers; private List<decimal> bookprices; } There are proprieties, of course. How can I turn it into a dataset? Thank you very much.

    Read the article

  • suppose there is a class which contains 4 data fields.i have to read these value from xml file and s

    - by SunilRai86
    suppose there is a class which contains 4 fields.i have to read these value from xml file and set that value to fields the xml file is like that <Root> <Application > <AppName>somevalue</AppName> <IdMark>somevalue</IdMark> <ClassName>ABC</ClassName> <ExecName>XYZ</ExecName> </Application> <Application> <AppName>somevalue</AppName> <IdMark>somevalue</IdMark> <ClassName>abc</ClassName> <ExecName>xyz</ExecName> </Application> </Root> now i have to read all the values from xml file and set each value to particular fields. i hav done reading of the xml file and i saved the retrieved value in arraylist. the code is like that public class CXmlFileHook { string appname; string classname; string idmark; string execname; string ctor; public CXmlFileHook() { this.appname = "Not Set"; this.idmark = "Not Set"; this.classname = "Not Set"; this.execname = "Not Set"; this.ctor = "CXmlFileHook()"; } public void readFromXmlFile(string path) { XmlTextReader oRreader = new XmlTextReader(@"D:\\Documents and Settings\\sunilr\\Desktop\\MLPACK.xml"); //string[] strNodeValues = new string[4] { "?","?","?","?"}; ArrayList oArrayList = new ArrayList(); while (oRreader.Read()) { if (oRreader.NodeType == XmlNodeType.Element) { switch (oRreader.Name) { case "AppName": oRreader.Read(); //strNodeValues[0] =oRreader.Value; oArrayList.Add(oRreader.Value); break; case "IdMark": oRreader.Read(); //strNodeValues[1] = oRreader.Value; oArrayList.Add(oRreader.Value); break; case "ClassName": oRreader.Read(); //strNodeValues[2] = oRreader.Value; oArrayList.Add(oRreader.Value); break; case "ExecName": oRreader.Read(); //strNodeValues[3] = oRreader.Value; oArrayList.Add(oRreader.Value); break; } } } Console.WriteLine("Reading from arraylist"); Console.WriteLine("-------------------------"); for (int i = 0; i < oArrayList.Count; i++) { //Console.WriteLine("Reading from Sting[]"+ strNodeValues[i]); Console.WriteLine(oArrayList[i]); } //this.appname = strNodeValues[0]; //this.idmark = strNodeValues[1]; //this.classname = strNodeValues[2]; //this.execname = strNodeValues[3]; this.appname = oArrayList[0].ToString(); this.idmark = oArrayList[1].ToString(); this.classname = oArrayList[2].ToString(); this.execname = oArrayList[3].ToString(); } static string vInformation; public void showCurrentState(string path) { FileStream oFileStream = new FileStream(path, FileMode.Append, FileAccess.Write); StreamWriter oStreamWriter = new StreamWriter(oFileStream); oStreamWriter.WriteLine("****************************************************************"); oStreamWriter.WriteLine(" Log File "); oStreamWriter.WriteLine("****************************************************************"); CXmlFileHook oFilehook = new CXmlFileHook(); //Type t = Type.GetType(this._classname); //Type t = typeof(CConfigFileHook); DateTime oToday = DateTime.Now; vInformation += "Logfile created on : "; vInformation += oToday + Environment.NewLine; vInformation += "Public " + Environment.NewLine; vInformation += "----------------------------------------------" + Environment.NewLine; vInformation += "Private " + Environment.NewLine; vInformation += "-----------------------------------------------" + Environment.NewLine; vInformation += "ctor = " + this.ctor + Environment.NewLine; vInformation += "appname = " + this.appname + Environment.NewLine; vInformation += "idmark = " + this.idmark + Environment.NewLine; vInformation += "classname = " + this.classname + Environment.NewLine; vInformation += "execname = " + this.execname + Environment.NewLine; vInformation += "------------------------------------------------" + Environment.NewLine; vInformation += "Protected" + Environment.NewLine; vInformation += "------------------------------------------------" + Environment.NewLine; oStreamWriter.WriteLine(vInformation); oStreamWriter.Flush(); oStreamWriter.Close(); oFileStream.Close(); } } here i set set the fields according to arraylist index but i dont want is there any another solution for this....

    Read the article

  • replace \n and \r\n with <br /> in java

    - by Bala R
    This has been asked several times for several languages but I can't get it to work. I have a string like this String str = "This is a string.\nThis is a long string."; And I'm trying to replace the \n with <br /> using str = str.replaceAll("(\r\n|\n)", "<br />"); but the \n is not getting replaced. I tried to use this RegEx Tool to verify and I see the same result. The input string does not have a match for "(\r\n|\n)". What am i doing wrong ?

    Read the article

  • Generic Dictionary - Getting Conversion Error

    - by pm_2
    The following code is giving me an error: // GetDirectoryList() returns Dictionary<string, DirectoryInfo> Dictionary<string, DirectoryInfo> myDirectoryList = GetDirectoryList(); // The following line gives a compile error foreach (Dictionary<string, DirectoryInfo> eachItem in myDirectoryList) The error it gives is as follows: Cannot convert type 'System.Collections.Generic.KeyValuePair<string,System.IO.DirectoryInfo>' to 'System.Collections.Generic.Dictionary<string,System.IO.DirectoryInfo>’ My question is: why is it trying to perform this conversion? Can I not use a foreach loop on this type of object?

    Read the article

  • Why does this MSDN example for Func<> delegate have a superfluous Select() call?

    - by Dan
    The MSDN gives this code example in the article on the Func Generic Delegate: Func<String, int, bool> predicate = ( str, index) => str.Length == index; String[] words = { "orange", "apple", "Article", "elephant", "star", "and" }; IEnumerable<String> aWords = words.Where(predicate).Select(str => str); foreach (String word in aWords) Console.WriteLine(word); I understand what all this is doing. What I don't understand is the Select(str => str) bit. Surely that's not needed? If you leave it out and just have IEnumerable<String> aWords = words.Where(predicate); then you still get an IEnumerable back that contains the same results, and the code prints the same thing. Am I missing something, or is the example misleading?

    Read the article

  • Passing parameters among views in a navigation frame INSIDE a custom control

    - by NetWriter
    I created a silverlight 3 application with a navigation frame and 3 views: search, add and edit. I used the app file to pass parameters among the 3 pages, eg: ((App)Application.Current).SNIPSELECTED = currentSnip; Then in the receiving page: currentSnip = ((App)Application.Current).SNIPSELECTED; currentSnip is a SnipItem object: public class SnipItem { public string itemID {get;set;} public string category {get;set;} public string itemDescription {get;set;} public string codeSnip {get;set;} } This worked fine until I decided to make this entire application into a user control and put that inside a second silverlight application with its own navigation frame and app file. The app files are getting confused. The first app file with all my parameter passing is not being read. I know how to pass a simple parameter between views in the first application without the app file (in a query string), but how about these custom types like my currentSnip above?

    Read the article

  • Normalizing Strings using Regexes

    - by RasputinJones
    How do I match this string "1 & 2" from this string "Foo Bar 1 & 2"? How do I match this string "1, 2 & 3" from this string "Foo Baz 1, 2 & 3"? Trying to split out "Foo Bar" from the string using regexes while using the presence of "1 & 2" or "1, 2 & 3" as conditionals to normalize these strings into "Foo Bar 1" and "Foo Bar 2" or "Foo Baz 1", "Foo Baz 2" and "Foo Baz 3" respectively.

    Read the article

  • NSString inheritance

    - by Stef
    Hi, I'm doing an useless thing for my first step in Obj-C @interface String : NSString { int m_isnull; } - (id) init; - (int) isNull; @end @implementation String - (id) init { self = [super init]; m_isnull=1; return self; } - (int) isNull { return m_isnull; } @end test : String *a; a=@"ok"; Works fine, but just 2 little questions 1) When I'm compiling I have this warning warning: incompatible Objective-C types assigning 'struct NSString *', expected 'struct String *' I don't know how to avoid it !? 2) a=@"ok" is a fastest way to initialize a string, but when I'm debugging, I don't stop by at my init constructor why ?

    Read the article

  • Problem in populating a dictionary object using Enumerable.Range() (C#3.0)

    - by Newbie
    If I do for (int i = 0; i < appSettings.Count; i++) { string key = appSettings.Keys[i]; euFileDictionary.Add(key, appSettings[i]); } It is working fine. When I am trying the same thing using Enumerable.Range(0, appSettings.Count).Select(i => { string Key = appSettings.Keys[i]; string Value = appSettings[i]; euFileDictionary.Add(Key, Value); }).ToDictionary<string,string>(); I am getting a compile time error The type arguments for method 'System.Linq.Enumerable.Select(System.Collections.Generic.IEnumerable, System.Func)' cannot be inferred from the usage. Try specifying the type arguments explicitly. Any idea? Using C#3.0 Thanks

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • How to validate phone number(US format) in Java?

    - by Maxood
    I just want to know where am i wrong here: import java.io.*; class Tokens{ public static void main(String[] args) { //String[] result = "this is a test".split(""); String[] result = "4543 6546 6556".split(""); boolean flag= true; String num[] = {"0","1","2","3","4","5","6","7","8","9"}; String specialChars[] = {"-","@","#","*"," "}; for (int x=1; x<result.length; x++) { for (int y=0; y<num.length; y++) { if ((result[x].equals(num[y]))) { flag = false; continue; } else { flag = true; } if (flag == true) break; } if (flag == false) break; } System.out.println(flag); } }

    Read the article

  • parse json news feed array android

    - by user1827260
    I have an json feed from bbc in this format { "name": "ticker", "entries": [ { "headline": "text", "prompt": "LATEST", "isBreaking": "false", "mediaType": "Standard", "url": "" }, { "headline": "text", "prompt": "LATEST", "isBreaking": "false", "mediaType": "Standard", "url": "" }, etc........... My code is as follows: ArrayList mylist = new ArrayList(); JSONObject json = JSONfunctions.getJSONfromURL("http:/......"); try{ JSONArray item = json.getJSONArray("entries"); for (int i = 0; i<item.length(); i++) { HashMap<String, String> map = new HashMap<String, String>(); JSONObject e = item.getJSONObject(i); JSONObject title = e.JSONObject("headline"); map.put("title", "Title:" + e.getString("headline"); } It gives me the error "java.lang.String cannot be converted to JSONObject" I also tried leaving out JSONObject title = e.JSONObject("headline"); and it gives me a path error (note

    Read the article

  • Obtaining Index value of dictionary

    - by Maudise
    I have a piece of code which looks at the following public Test As Dictionary(Of String, String()) Which is brought in tester = New Dictionary(Of String, String()) tester.add("Key_EN", {"Option 1_EN", "Option 2_EN", "Option 3_EN"}) tester.add("Key_FR", {"Option 1_FR", "Option 2_FR", "Option 3_FR"}) tester.add("Key_DE", {"Option 1_DE", "Option 2_DE", "Option 3_DE"}) There's then a combo box which looks at the following dim Language as string Language = "_EN" ' note this is done by a drop down combo box to select _EN or _FR etc. cboTestBox.items.AddRange(tester("Key" & Language)) What I need to be able to do is to see what index position the answer is in and convert it back to the Key_EN. So, for example _DE is selected, then the options of "Option 1_DE", "Option 2_DE", "Option 3_DE" would be displayed. If they chose Option 3_DE then I need to be able to convert this to Option 3_EN. Many thanks Maudise

    Read the article

  • Python "string_escape" vs "unicode_escape"

    - by Mike Boers
    According to the docs, the builtin string encoding string_escape: Produce[s] a string that is suitable as string literal in Python source code ...while the unicode_escape: Produce[s] a string that is suitable as Unicode literal in Python source code So, they should have roughly the same behaviour. BUT, they appear to treat single quotes differently: >>> print """before '" \0 after""".encode('string-escape') before \'" \x00 after >>> print """before '" \0 after""".encode('unicode-escape') before '" \x00 after The string_escape escapes the single quote while the Unicode one does not. Is it safe to assume that I can simply: >>> escaped = my_string.encode('unicode-escape').replace("'", "\\'") ...and get the expected behaviour?

    Read the article

  • Java spliting strings

    - by N0b
    Hi I've got a Java problem. I'm trying split a string when ever a " " occurs, for example the sentence test abc. Then move the first letter in each word from first to last. I got the moving the letter to work on the original string using String text = JOptionPane.showInputDialog(null,"Skriv in en normal text:"); char firstLetter = text.charAt(0); normal = text.substring(1,text.length()+0) + firstLetter; So my question is how would I split the string then start moving the letters around in each part of the cut string? Thanks in advance

    Read the article

  • Validate NSString

    - by Chris
    I am validating an NSString to ensure that the string does not contain apostrophes. The code I'm using to do this is NSCharacterSet * invalidNumberSet = [NSCharacterSet characterSetWithCharactersInString:@"'"]; NSScanner * scanner = [NSScanner scannerWithString:string]; NSString * scannerResult; [scanner setCharactersToBeSkipped:nil]; [scanner scanUpToCharactersFromSet:invalidNumberSet intoString:&scannerResult]; if(![string isEqualToString:scannerResult]) { return 2; } Returning 2 represents an error. This code works, except for the case where the string is an apostrophe. To get around this issue, I added the following code above the preceding block. if([string isEqualToString:@"'"]); { return 2; } This code is evaluating to true, regardless of the input. I need to either prevent the first block from crashing with the input of ', or get the second block to work. What am I missing?

    Read the article

  • programming help

    - by user208639
    class Person holds personal data Its constructor receives 3 parameters, two Strings representing first and last names and an int representing age public Person(String firstName, String lastName, int age) { its method getName has no parameters and returns a String with format "Lastname, Firstname" its method getAge takes no parameters and returns an int representing the current age its method birthday increases age value by 1 and returns the new age value Create the class Person and paste the whole class into the textbox below public class Person { public Person(String first, String last, int age) { getName = "Lastname, Firstname"; System.out.print(last + first); getAge = age + 1; return getAge; System.out.print(getAge); birthday = age + 1; newAge = birthday; return newAge; } } im getting errors such as "cannot find symbol - variable getName" but when i declare a variable it still not working, i also wanted to ask if i am heading in the right direction or is it all totally wrong? im using a program called BlueJ to work on.

    Read the article

  • Android strange behavior with listview and custom cursor adapter

    - by Michael Little
    I have a problem with a list view and a custom cursor adapter and I just can't seem to figure out what is wrong with my code. Basically, in my activity I call initalize() that does a bunch of stuff to handle getting the proper data and initializing the listview. On first run of the activity you can see from the images that one of the items is missing from the list. If I go to another activity and go back to this activity the item that was missing shows up. I believe it has something to do with setContentView(R.layout.parent). If I move that to my initialize() then the item never shows up even when returning from another activity. So, for some reason, returning from another activity bypasses setContentView(R.layout.parent) and everything works fine. I know it's impossible for me to bypass setContentView(R.layout.parent) so I need to figure out what the problem is. Also, I did not include the layout because it is nothing more then two textviews. Also, the images I have attached do not show that the missing item is the last one on the list. Custom Cursor Adapter: public class CustomCursorAdapter extends SimpleCursorAdapter { private Context context; private int layout; public CustomCursorAdapter (Context context, int layout, Cursor c, String[] from, int[] to) { super(context, layout, c, from, to); this.context = context; this.layout = layout; } public View newView(Context context, Cursor cursor, ViewGroup parent) { LayoutInflater inflater = LayoutInflater.from(context); final View view = inflater.inflate(layout, parent, false); return view; } @Override public void bindView(View v, Context context, Cursor c) { if (c.getColumnName(0).matches("section")){ int nameCol = c.getColumnIndex("section"); String section = c.getString(nameCol); TextView section_text = (TextView) v.findViewById(R.id.text1); if ((section.length() > 0)) { section_text.setText(section); } else { //so we don't have an empty spot section_text.setText(""); section_text.setVisibility(2); section_text.setHeight(1); } } else if (c.getColumnName(0).matches("code")) { int nameCol = c.getColumnIndex("code"); String mCode = c.getString(nameCol); TextView code_text = (TextView) v.findViewById(R.id.text1); if (code_text != null) { int i = 167; byte[] data = {(byte) i}; String strSymbol = EncodingUtils.getString(data, "windows-1252"); mCode = strSymbol + " " + mCode; code_text.setText(mCode); code_text.setSingleLine(); } } if (c.getColumnName(1).matches("title")){ int nameCol = c.getColumnIndex("title"); String mTitle = c.getString(nameCol); TextView title_text = (TextView) v.findViewById(R.id.text2); if (title_text != null) { title_text.setText(mTitle); } } else if (c.getColumnName(1).matches("excerpt")) { int nameCol = c.getColumnIndex("excerpt"); String mExcerpt = c.getString(nameCol); TextView excerpt_text = (TextView) v.findViewById(R.id.text2); if (excerpt_text != null) { excerpt_text.setText(mExcerpt); excerpt_text.setSingleLine(); } } } The Activity: public class parent extends ListActivity { private static String[] TITLE_FROM = { SECTION, TITLE, _ID, }; private static String[] CODE_FROM = { CODE, EXCERPT, _ID, }; private static String ORDER_BY = _ID + " ASC"; private static int[] TO = { R.id.text1, R.id.text2, }; String breadcrumb = null; private MyData data; private SQLiteDatabase db; CharSequence parent_id = ""; @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); data = new MyData(this); db = data.getReadableDatabase(); setContentView(R.layout.parent); initialize(); } public void initialize() { breadcrumb = null; Bundle bun = getIntent().getExtras(); TextView tvBreadCrumb; tvBreadCrumb = (TextView)findViewById(R.id.breadcrumb); if (bun == null) { //this is the first run tvBreadCrumb.setText(null); tvBreadCrumb.setHeight(0); parent_id = "0"; try { Cursor cursor = getData(parent_id); showSectionData(cursor); } finally { data.close(); } } else { CharSequence state = bun.getString("state"); breadcrumb = bun.getString("breadcrumb"); tvBreadCrumb.setText(breadcrumb); CharSequence code = bun.getString("code"); parent_id = code; if (state.equals("chapter")) { try { Cursor cursor = getData(parent_id); showSectionData(cursor); } finally { data.close(); } } else if (state.equals("code")) { try { Cursor cursor = getCodeData(parent_id); showCodeData(cursor); } finally { data.close(); } } } } @Override public void onStart() { //initialize(); super.onResume(); } @Override public void onResume() { initialize(); super.onResume(); } private Cursor getData(CharSequence parent_id) { Cursor cTitles = db.query(TITLES_TABLE_NAME, TITLE_FROM, "parent_id = " + parent_id, null, null, null, ORDER_BY); Cursor cCodes = db.query(CODES_TABLE_NAME, CODE_FROM, "parent_id = " + parent_id, null, null, null, ORDER_BY); Cursor[] c = {cTitles, cCodes}; Cursor cursor = new MergeCursor(c); startManagingCursor(cursor); return cursor; } private Cursor getCodeData(CharSequence parent_id2) { Bundle bun = getIntent().getExtras(); CharSequence intent = bun.getString("intent"); CharSequence searchtype = bun.getString("searchtype"); //SQLiteDatabase db = data.getReadableDatabase(); if (intent != null) { String sWhere = null; if(searchtype.equals("code")) { sWhere = "code LIKE '%"+parent_id2+"%'"; } else if(searchtype.equals("within")){ sWhere = "definition LIKE '%"+parent_id2+"%'"; } //This is a search request Cursor cursor = db.query(CODES_TABLE_NAME, CODE_FROM, sWhere, null, null, null, ORDER_BY); startManagingCursor(cursor); return cursor; } else { Cursor cursor = db.query(CODES_TABLE_NAME, CODE_FROM, "parent_id = "+ parent_id2, null, null, null, ORDER_BY); startManagingCursor(cursor); return cursor; } } private void showSectionData(Cursor cursor) { CustomCursorAdapter adapter= new CustomCursorAdapter(this, R.layout.item, cursor, TITLE_FROM, TO); setListAdapter(adapter); } private void showCodeData(Cursor cursor) { CustomCursorAdapter adapter = new CustomCursorAdapter(this, R.layout.item, cursor, CODE_FROM, TO); setListAdapter(adapter); Bundle bun = getIntent().getExtras(); CharSequence intent = bun.getString("intent"); if (intent != null) { Cursor cursor1 = ((CursorAdapter)getListAdapter()).getCursor(); startManagingCursor(cursor1); TextView tvBreadCrumb; tvBreadCrumb = (TextView)findViewById(R.id.breadcrumb); tvBreadCrumb.setText(cursor1.getCount() + " Records Found"); //cursor1.close(); //mdl } }

    Read the article

  • Programming an Android Button to update EditText views

    - by bergler77
    Ok guys, I have a button in android that i'm trying to use to update 8 EditText Views with different random numbers. Everything works up until I click the button. It appears I am missing a resource according to the debugger, but I'm not sure what. I've tried several different ways of implementing the button. Here is what I have after looking at several posts. import java.util.Random; import android.os.Bundle; import android.view.View; import android.view.View.OnClickListener; import android.widget.Button; import android.widget.EditText; public class MyCharNewChar extends MyCharActivity { private OnClickListener randomButtonListener = new OnClickListener(){ public void onClick(View v) { //Button creates a set of random numbers and updates the values //of the EditText views. Random rand = new Random(); int STR = 1 + rand.nextInt(12); int AGI = 1 + rand.nextInt(12); int DEX = 1 + rand.nextInt(12); int WIS = 1 + rand.nextInt(12); int INT = 1 + rand.nextInt(12); int CON = 1 + rand.nextInt(12); int HP = 1 + rand.nextInt(20); int AC = 1 + rand.nextInt(6); EditText str = (EditText) findViewById(R.id.str); str.setText(STR); EditText agi = (EditText) findViewById(R.id.agi); agi.setText(AGI); EditText dex = (EditText) findViewById(R.id.dex); dex.setText(DEX); EditText wis = (EditText) findViewById(R.id.wis); wis.setText(WIS); EditText intel = (EditText) findViewById(R.id.intel); intel.setText(INT); EditText con = (EditText) findViewById(R.id.con); con.setText(CON); EditText hp = (EditText) findViewById(R.id.baseHP); hp.setText(HP); EditText ac = (EditText) findViewById(R.id.baseAC); ac.setText(AC); } }; @Override public void onCreate(Bundle savedInstanceState){ super.onCreate(savedInstanceState); setContentView(R.layout.newchar); Button randomButton = (Button) findViewById(R.id.randomButton); randomButton.setOnClickListener(randomButtonListener); } } Here is the xml: <?xml version="1.0" encoding="utf-8"?> <LinearLayout xmlns:android="http://schemas.android.com/apk/res/android" android:id="@+id/linearlayoutNew1" android:layout_width="match_parent" android:layout_height="match_parent" android:orientation="vertical" android:background="@drawable/background" > <TextView android:id="@+id/newCharLabel" android:layout_width="match_parent" android:layout_height="wrap_content" android:text="@string/new_character_screen" android:textSize="24dp" android:textColor="@color/splash" android:textStyle="bold" android:gravity="center"/> <TextView android:id="@+id/nameLabel" android:layout_width="match_parent" android:layout_height="wrap_content" android:text="@string/nameLabel" android:textSize="18dp" android:textColor="@color/splash"/> <EditText android:id="@+id/editText1" android:layout_width="match_parent" android:layout_height="wrap_content" android:ems="10" android:inputType="textPersonName" > <requestFocus /> </EditText> <TableLayout android:id="@+id/statsLayout" android:layout_width="match_parent" android:layout_height="wrap_content" android:padding="5dp"> <TableRow android:id="@+id/tableRow01" android:orientation="horizontal" android:layout_width="match_parent" android:layout_height="wrap_content" android:padding="5dp"> <TextView android:id="@+id/strLabel" android:layout_width="wrap_content" android:layout_height="wrap_content" android:text="@string/strLabel" android:textSize="18dp" android:textColor="@color/splash"/> <EditText android:id="@+id/str" android:layout_width="wrap_content" android:layout_height="wrap_content" android:ems="3" android:inputType="number" /> <TextView android:id="@+id/agiLabel" android:layout_width="wrap_content" android:layout_height="wrap_content" android:text="@string/agiLabel" android:textSize="18dp" android:textColor="@color/splash"/> <EditText android:id="@+id/agi" android:layout_width="wrap_content" android:layout_height="wrap_content" android:ems="3" android:inputType="number"/> <TextView android:id="@+id/dexLabel" android:layout_width="wrap_content" android:layout_height="wrap_content" android:text="@string/dexLabel" android:textSize="18dp" android:textColor="@color/splash"/> <EditText android:id="@+id/dex" android:layout_width="wrap_content" android:layout_height="wrap_content" android:ems="3" android:inputType="number"/> </TableRow> <TableRow android:id="@+id/tableRow02" android:orientation="horizontal" android:layout_width="match_parent" android:layout_height="wrap_content" android:padding="5dp"> <TextView android:id="@+id/intLabel" android:layout_width="wrap_content" android:layout_height="wrap_content" android:text="@string/intLabel" android:textSize="18dp" android:textColor="@color/splash"/> <EditText android:id="@+id/intel" android:layout_width="wrap_content" android:layout_height="wrap_content" android:ems="3" android:inputType="number"/> <TextView android:id="@+id/wisLabel" android:layout_width="wrap_content" android:layout_height="wrap_content" android:text="@string/wisLabel" android:textSize="18dp" android:textColor="@color/splash"/> <EditText android:id="@+id/wis" android:layout_width="wrap_content" android:layout_height="wrap_content" android:ems="3" android:inputType="number"/> <TextView android:id="@+id/conLabel" android:layout_width="wrap_content" android:layout_height="wrap_content" android:text="@string/conLabel" android:textSize="18dp" android:textColor="@color/splash"/> <EditText android:id="@+id/con" android:layout_width="wrap_content" android:layout_height="wrap_content" android:ems="3" android:inputType="number"/> </TableRow> </TableLayout> <LinearLayout android:id="@+id/linearlayoutNew02" android:layout_width="match_parent" android:layout_height="wrap_content" android:padding="5dp" android:gravity="center"> <TextView android:id="@+id/baseHPLabel" android:layout_width="wrap_content" android:layout_height="wrap_content" android:text="@string/hpLabel" android:textSize="18dp" android:textColor="@color/splash"/> <EditText android:id="@+id/baseHP" android:layout_width="wrap_content" android:layout_height="wrap_content" android:ems="3" android:inputType="number"/> <TextView android:id="@+id/baseACLabel" android:layout_width="wrap_content" android:layout_height="wrap_content" android:text="@string/acLabel" android:textSize="18dp" android:textColor="@color/splash"/> <EditText android:id="@+id/baseAC" android:layout_width="wrap_content" android:layout_height="wrap_content" android:ems="3" android:inputType="number"/> </LinearLayout> <LinearLayout android:id="@+id/linearlayoutNew03" android:layout_width="match_parent" android:layout_height="wrap_content" android:orientation="horizontal"> <Button android:id="@+id/randomButton" android:layout_width="0dp" android:layout_height="wrap_content" android:layout_weight="1" android:text="@string/randomButton" android:textSize="16dp" android:clickable="true"/> </LinearLayout> </LinearLayout> I have also tried setting the onClick in xml to setup a specific onClick method. Still the same error so I must have a problem elsewhere. Any suggestions would be great!

    Read the article

< Previous Page | 366 367 368 369 370 371 372 373 374 375 376 377  | Next Page >