Search Results

Search found 11338 results on 454 pages for 'big dave'.

Page 371/454 | < Previous Page | 367 368 369 370 371 372 373 374 375 376 377 378  | Next Page >

  • Changing a sprites bitmap

    - by numerical25
    As of right now, I am trying to create a tiling effect for a game I am creating. I am using a tilesheet and I am loading the tiles to the sprite like so... this.graphics.beginBitmapFill(tileImage); this.graphics.drawRect(30, 0,tWidth ,tHeight ); var tileImage is the bitMapData. 30 is the Number of pixels to move retangle. then tWidth and tHeight is how big the rectangle is. which is 30x30 This is what I do to change the bitmap when I role over the tile this.graphics.clear(); this.graphics.beginBitmapFill(tileImage); this.graphics.drawRect(60, 0,tWidth ,tHeight ); I clear the sprite canvas. I then rewrite to another position on tileImage. My problem is.... It removes the old tile completely but the new tile positions farther to the right then where the old bitmap appeared. My tile sheet is only 90px wide by 30px height. On top of that, it appears my new tile is drawn behind the old tile. Is there any better way to perfect this. again, all i want is for the bitmap to change colors

    Read the article

  • Some general C questions.

    - by b-gen-jack-o-neill
    Hello. I am trying to fully understand the process pro writing code in some language to execution by OS. In my case, the language would be C and the OS would be Windows. So far, I read many different articles, but I am not sure, whether I understand the process right, and I would like to ask you if you know some good articles on some subjects I couldn´t find. So, what I think I know about C (and basically other languages): C compiler itself handles only data types, basic math operations, pointers operations, and work with functions. By work with functions I mean how to pass argument to it, and how to get output from function. During compilation, function call is replaced by passing arguments to stack, and than if function is not inline, its call is replaced by some symbol for linker. Linker than find the function definition, and replace the symbol to jump adress to that function (and of course than jump back to program). If the above is generally true and I get it right, where to final .exe file actually linker saves the functions? After the main() function? And what creates the .exe header? Compiler or Linker? Now, additional capabilities of C, today known as C standart library is set of functions and the declarations of them, that other programmers wrote to extend and simplify use of C language. But these functions like printf() were (or could be?) written in different language, or assembler. And there comes my next question, can be, for example printf() function be written in pure C without use of assembler? I know this is quite big question, but I just mostly want to know, wheather I am right or not. And trust me, I read a lots of articles on the web, and I would not ask you, If I could find these infromation together on one place, in one article. Insted I must piece by piece gather informations, so I am not sure if I am right. Thanks.

    Read the article

  • Where are tables in Mnesia located?

    - by Sanoj
    I try to compare Mnesia with more traditional databases. As I understand it tables in Mnesia can be located to: ram_copies - tables are stored in RAM only, so no durability as in ACID. disc_copies - tables are located on disc and a copy is located in RAM, so the table can not be bigger than the available memory? disc_only_copies - tables are located to disc only, so no caching in memory and worse performance? And the size of the table are limited to the size of dets or the table has to be fragmented. So if I want the performance of doing reads from RAM and the durability of writes to disc, then the size of the tables are very limited compared to a traditional RDBMS like MySQL or PostgreSQL. I know that Mnesia aren't meant to replace traditional RDBMS:s, but can it be used as a big RDBMS or do I have to look for another database? The server I will use is a VPS with limited amount of memory, around 512MB, but I want good database performance. Are disc_copies and the other types of tables in Mnesia so limited as I have understood?

    Read the article

  • django shopping cart as a beginner

    - by Jacques Knie
    Hi, i'm quite new to django and trying to add a shopping cart to a simple webshop. What I need is a simple cart that can be filled and presents its content, which is then sent to the vendor via email. So Satchmo might be too big for this task. Therefore i chose django-cart (http://code.google.com/p/django-cart/) which causes some problems now. 1. Is django-cart the right thing? Or are there any better approaches to this task? 2. As I am a beginner even django-cart makes me struggle. I used the view and the template of the django-cart-website, but writing a form that can be used to add products to the cart took me hours. I probably need help in understanding the general layout of a shopping cart and its integration into a website. 3. Two more specific questions: Is it possible to dynamically populate a formfield in a template (e.g. with {{ object.id }})? Is django-cart able to change (update) the contents of a cart? I hope it's not too many questions at once. Thanks in advance Jacques

    Read the article

  • PHP/SQL/Wordpress: Group a user list by alphabet

    - by rayne
    I want to create a (fairly big) Wordpress user index with the users categorized alphabetically, like this: A Amy Adam B Bernard Bianca and so on. I've created a custom Wordpress query which works fine for this, except for one problem: It also displays "empty" letters, letters where there aren't any users whose name begins with that letter. I'd be glad if you could help me fix this code so that it only displays the letter if there's actually a user with a name of that letter :) I've tried my luck by checking how many results there are for that letter, but somehow that's not working. (FYI, I use the user photo plugin and only want to show users in the list who have an approved picture, hence the stuff in the SQL query). <?php $alphabet = range('A', 'Z'); foreach ($alphabet as $letter) { $user_count = $wpdb->get_results("SELECT COUNT(*) FROM wp_users WHERE display_name LIKE '".$letter."%' ORDER BY display_name ASC"); if ($user_count > 0) { $user_row = $wpdb->get_results("SELECT wp_users.user_login, wp_users.display_name FROM wp_users, wp_usermeta WHERE wp_users.display_name LIKE '".$letter."%' AND wp_usermeta.meta_key = 'userphoto_approvalstatus' AND wp_usermeta.meta_value = '2' AND wp_usermeta.user_id = wp_users.ID ORDER BY wp_users.display_name ASC"); echo '<li class="letter">'.$letter.''; echo '<ul>'; foreach ($user_row as $user) { echo '<li><a href="/author/'.$user->user_login.'">'.$user->display_name.'</a></li>'; } echo '</ul></li>'; } } ?> Thanks in advance!

    Read the article

  • Persisting complex data between postbacks in ASP.NET MVC

    - by Robert Wagner
    I'm developing an ASP.NET MVC 2 application that connects to some services to do data retrieval and update. The services require that I provide the original entity along with the updated entity when updating data. This is so it can do change tracking and optimistic concurrency. The services cannot be changed. My problem is that I need to somehow store the original entity between postbacks. In WebForms, I would have used ViewState, but from what I have read, that is out for MVC. The original values do not have to be tamper proof as the services treat them as untrusted. The entities would be (max) 1k and it is an intranet app. The options I have come up are: Session - Ruled out - Store the entity in the Session, but I don't like this idea as there are no plans to share session between URL - Ruled out - Data is too big HiddenField - Store the serialized entity in a hidden field, perhaps with encryption/encoding HiddenVersion - The entities have a (SQL) version field on them, which I could put into a hidden field. Then on a save I get "original" entity from the services and compare the versions, doing my own optimistic concurrency. Cookies - Like 3 or 4, but using a cookie instead of a hidden field I'm leaning towards option 4, although 3 would be simpler. Are these valid options or am I going down the wrong track? Is there a better way of doing this?

    Read the article

  • WPF DataValidation on a DataTemplate object in an ItemsControl

    - by Matt H.
    I have two datatemplates, both very similar... here is one of them: <DataTemplate x:Key="HeadingTemplate"> <Grid x:Name="mainHeadingGrid" Margin="5,5,30,0" HorizontalAlignment="Stretch"> <Grid.ColumnDefinitions> <ColumnDefinition Width="Auto" /> <ColumnDefinition /> </Grid.ColumnDefinitions> <TextBlock Grid.Column="1" Margin="30,3,10,0" Foreground="Black" FontWeight="Bold" HorizontalAlignment="Left" TextWrapping="Wrap"> <TextBlock.Text> <MultiBinding Converter="{StaticResource myHeadingConverter}" ConverterParameter="getRNHeadingTitle" Mode="TwoWay"> <Binding Path="num"/> <Binding Path="name"/> </MultiBinding> </TextBlock.Text> </TextBlock> <TextBox Grid.Column="1" Text="{Binding Path=moreInfo}"/> </Grid> </DataTemplate> I use an selector in my ItemsControl to choose between the two, based on the object it is bound to. I want to use validation to check through all of the properties and put a big exclamation point in front of the whole datatemplate as it is displayed in the itemscontrol. how do I do this? All of the examples I've found explain how to set a ValidationRule on a specific control in the datatemplate, in that control's binding. I want to apply my validation rule to the entire template... Help! :)

    Read the article

  • Modified jQuery innerfade sluggish

    - by Jay Hankins
    HI. I am using the jQuery innerfade plugin to scroll through some images on my site. Innerfade is sluggish to move on Firefox 3.6.3, and IE 8. IE 8 is much worse than Firefox, and Chrome runs smoothly. Can you analyze my code to see what the problem is? I've used the modified innerfade from here: http://www.stylephp.com/2009/01/17/customizing-jquery-innerfade-plug-in-adding-controls-navigation-and-caption/ My sites are here: Without bg image: http://dl.dropbox.com/u/145908/doozie2/index.html With bg image: http://dl.dropbox.com/u/145908/doozie2/index2.html Removing my background image fixes the situation; it's not that big of a file. I don't understand why that is an issue. I am using a technique to resize the image to fit the browser window, as you can see in the CSS. Thanks so much. P.S. Sorry, I'm a new user so I can't post more than one link. Please copy and paste the address between <.

    Read the article

  • What is the relationship between Turing Machine & Modern Computer ? [closed]

    - by smwikipedia
    I heard a lot that modern computers are based on Turing machine. I just cannot build a bridge between a conceptual Turing Machine and a modern computer. Could someone help me build this bridge? Below is my current understanding. I think the computer is a big general-purpose Turing machine. Each program we write is a small specific-purpose Turing machine. The classical Turing machine do its job based on the input and its current state inside and so do our programs. Let's take a running program (a process) as an example. We know that in the process's address space, there's areas for stack, heap, and code. A classical Turing machine doesn't have the ability to remember many things, so we borrow the concept of stack from the push-down automaton. The heap and stack areas contains the state of our specific-purpose Turing machine (our program). The code area represents the logic of this small Turing machine. And various I/O devices supply input to this Turing machine.

    Read the article

  • What are the limitations of the .NET Assembly format?

    - by McKAMEY
    We just ran into an interesting issue that I've not experienced before. We have a large scale production ASP.NET 3.5 SP1 Web App Project in Visual Studio 2008 SP1 which gets compiled and deployed using a Website Deployment Project. Everything has worked fine for the last year, until after a check-in yesterday the app started critically failing with BadImageFormatException. The check-in in question doesn't change anything particularly special and the errors are coming from areas of the app not even changed. Using Reflector we inspected the offending methods to find that there were garbage strings in the code (which Reflector humorously interpreted as Chinese characters). We have consistently reproduced this on several machines so it does not appear to be hardware related. Further inspection showed that those garbage strings did not exist in the Assemblies used as inputs to aspnet_merge.exe during deployment. Web Deployment Project Output Assemblies Properties: Merge all outputs to a single assembly Merge each individual folder output to its own assembly Merge all pages and control outputs to a single assembly Create a separate assembly for each page and control output In the web deployment project properties if we set the merge options to the first option ("Merge all outputs to a single assembly") we experience the issue, yet all of the other options work perfectly! So my question: does anyone know why this is happening? Is there a size-limit to aspnet_merge.exe's capabilities (the resulting merged DLL is around 19.3 MB)? Are there any other known issues with merging the output of WAPs? I would love it if any Assembly format / aspnet_merge gurus know about any such limitations like this. Seems to me like a 25MB Assembly, while big, isn't outrageous. Less disk to hit if it is all pregen'd stuff.

    Read the article

  • Frame Showing Problem

    - by Nitz
    Hey Guys I have made one project which is showing the inventory of the stock of one store. In that inventory the software should store data of the products with their images. There is one problem... Bcz of the lots of stock, the screen on which is image is loading taking a lot of time. So, i thought i should give the frame in which there will be on label which will show the "Loading Software". But now when i am setting visible = true for that frame, but bcz of that images screen class loading problem my frame is not showing correctly. I have put screen shot, now my code. JFrame f; try{ f = new JFrame("This is a test"); f.setSize(300, 300); Container content = f.getContentPane(); content.setBackground(Color.white); content.setLayout(new FlowLayout()); JLabel jl = new JLabel(); jl.setText("Loading Please Wait...."); content.add(jl); f.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE); f.setVisible(true); }catch(Exception e){ e.printStackTrace(); } initComponents(); try { addInverntory = new AddInventoryScreen(); showstock = new showStock(); // this class will take big time. mf = new mainForm(); f.setVisible(false); }catch (Exception ex) { ex.printStackTrace(); } How Can show some message that, other class is loading or "Loading Software" kind of thing in this situation. Just For the know....this class is not screen on which the image will load.

    Read the article

  • detecting pauses in a spoken word audio file using pymad, pcm, vad, etc

    - by james
    First I am going to broadly state what I'm trying to do and ask for advice. Then I will explain my current approach and ask for answers to my current problems. Problem I have an MP3 file of a person speaking. I'd like to split it up into segments roughly corresponding to a sentence or phrase. (I'd do it manually, but we are talking hours of data.) If you have advice on how to do this programatically or for some existing utilities, I'd love to hear it. (I'm aware of voice activity detection and I've looked into it a bit, but I didn't see any freely available utilities.) Current Approach I thought the simplest thing would be to scan the MP3 at certain intervals and identify places where the average volume was below some threshold. Then I would use some existing utility to cut up the mp3 at those locations. I've been playing around with pymad and I believe that I've successfully extracted the PCM (pulse code modulation) data for each frame of the mp3. Now I am stuck because I can't really seem to wrap my head around how the PCM data translates to relative volume. I'm also aware of other complicating factors like multiple channels, big endian vs little, etc. Advice on how to map a group of pcm samples to relative volume would be key. Thanks!

    Read the article

  • Creative ways to punish (or just curb) laziness in coworkers

    - by FerretallicA
    Like the subject suggests, what are some creative ways to curb laziness in co-workers? By laziness I'm talking about things like using variable names like "inttheemplrcd" instead of "intEmployerCode" or not keeping their projects synced with SVN, not just people who use the last of the sugar in the coffee room and don't refill the jar. So far the two most effective things I've done both involve the core library my company uses. Since most of our programs are in VB.net the lack of case sensitivity is abused a lot. I've got certain features of the library using Reflection to access data in the client apps, which has a negligible performance hit and introduces case sensitivity in a lot places where it is used. In instances where we have an agreed standard which is compromised by blatant laziness I take it a step further, like the DatabaseController class which will blatantly reject any DataTable passed to it which isn't named dtSomething (ie- must begin with dt and third letter must be capitalised). It's frustrating to have to resort to things like this but it has also gradually helped drill more attention to detail into their heads. Another is adding some code to the library's initialisation function to display a big and potentially embarrassing (only if seen by a client) message advising that the program is running in debug mode. We have had many instances where projects are sent to clients built in debug mode which has a lot of implications for us (especially with regard to error recovery) and doing that has made sure they always build to release before distributing. Any other creative (ie- not StyleCop etc) approaches like this?

    Read the article

  • Cannot install XML::LibXML module on Windows

    - by Deepak Konidena
    I am trying to use XPath to extract some HTML tags and data and for that I need to use XML::LibXML module. I tried installing it from CPAN shell but it doesn't install. I followed the instructions from CPAN site about the installation, that we need to install libxml2, iconv and zlib wrappers before installing XML::LibXML and it didn't work out. Also, if there is any other simpler module that gets my task done, please let me know. The task at hand: I am searching for a specific <dd> tag on a html page which is really big ( around 5000 - 10000) <dd> and <dt> tags. So, I am writing a script which matches the content within <dd> tag and fetches the content within the corresponding (next) <dt> tag. I wish i could i have been a little more clearer. Any help is greatly appreciated.

    Read the article

  • Any good tutorials or resources for learning how to design a scalable and "component" based game 'fr

    - by CodeJustin.com
    In short I'm creating a 2D mmorpg and unlike my last "mmo" I started developing I want to make sure that this one will scale well and work well when I want to add new in-game features or modify existing ones. With my last attempt with an avatar chat within the first few thousand lines of code and just getting basic features added into the game I seen my code quality lowering and my ability to add new features or modify old ones was getting lower too as I added more features in. It turned into one big mess that some how ran, lol. This time I really need to buckle down and find a design that will allow me to create a game framework that will be easy to add and remove features (aka things like playing mini-games within my world or a mail system or buddy list or a new public area with interactive items). I'm thinking that maybe a component based approach MIGHT be what I'm looking for but I'm really not sure. I have read documents on mmorpg design and 2d game engine architecture but nothing really explained a way of designing a game framework that will basically let me "plug-in" new features into the main game and use the resources of the main game without changing much within my 'main game code'. Hope someone understands what I mean, any help will is appreciated.

    Read the article

  • Fixed mouse pointer with jQuery draggable

    - by MikeWyatt
    I'm building a little game in HTML5. The canvas element is a viewport into the game world. The user can move the viewport's position in the world by clicking and dragging with the mouse on a small icon. The problem is that the scrolling stops when the mouse pointer hits the edge of the screen. In all likelihood, that will limit scrolling in one of the directions severely, since the icon will be in one of the corners of the page. The only technical solution I can think of would be to somehow fix the mouse pointer's position on the icon and detect the relative movement each frame. Basically I would just reset the pointer position back to the center of the icon after each drag event. Unfortunately, I'm fairly positive that this is not possible. Playing with the user's pointer is a big no-no from a usability and security standpoint. So, is there any other way to do what I want? I'm primarily looking for technical ideas here, but suggestions for a more appropriate interface would also be welcome.

    Read the article

  • Form is submitting when the page loads

    - by RailAddict
    I have a really simple Rails app. Basically an article with comments. I want the article page to show the article, comments underneath and then a textbox to write a comment and a submit button to submit it. I got it all working except for one (big) problem. When the page loads.. example.com/article/1 a blank comment is submitted to the database. I fixed that by including "validates_presence_of :body" in the Comment model. But that results in the following image when the page loads: This is my code by the way: def show @place = Article.find(params[:id]) @comment = Article.find(params[:id]).comments.create(params[:comment]) respond_to do |format| format.html # show.html.erb format.xml { render :xml => @article } end end and <% form_for([@article, @comment]) do |f| %> <p> <%= f.label :commenter %><br /> <%= f.text_field :commenter %> </p> <p> <%= f.label :body %><br /> <%= f.text_area :body %> </p> <p> <%= f.submit "Create" %> </p> <% end %>

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Free solution for automatic updates with a .NET/C# app?

    - by a2h
    Yes, from searching I can see this has been asked time and time again. Here's a backstory. I'm an individual hobbyist developer with zero budget. A program I've been developing has been in need of constant bugfixes, and me and users are getting tired of having to manually update. Me, because my current solution of Manually FTP to my website Update a file "newest.txt" with the newest version Update index.html with a link to the newest version Hope for people to see the "there's an update" message Have them manually download the update sucks, and whenever I screw up an update, I get pitchforks. Users, because, well, "Are you ever going to implement auto-update?" "Will there ever be an auto-update feature?" Over the past I have looked into: WinSparkle - No in-app updates, and the DLL is 500 KB. My current solution is a few KBs in the executable and has no in-app updates. http://windowsclient.net/articles/appupdater.aspx - I can't comprehend the documentation http://www.codeproject.com/KB/vb/Auto_Update_Revisited.aspx - Doesn't appear to support anything other than working with files that aren't in use wyUpdate - wyBuild isn't free, and the file specification is simply too complex. Maybe if I was under a company paying me I could spend the time, but then I may as well pay for wyBuild. http://www.kineticjump.com/update/default.aspx - Ditto the last sentence. ClickOnce - Workarounds for implementing launching on startup are massive, horrendous and not worth it for such a simple feature. Publishing is a pain; manual FTP and replace of all files is required for servers without FrontPage Extensions. I'm pretty much ready to throw in the towel right now and strangle myself. And then I think about Sparkle... EDIT: I came across SparkleDotNET just then. Looks good, though the DLL is 200 KB. Don't know if that's really that big of an issue, though.

    Read the article

  • Product Catalog Schema design

    - by FlySwat
    I'm building a proof of concept schema for a product catalog to possibly replace a very aging and crufty one we use. In our business, we sell both physical materials and services (one time and reoccurring charges). The current catalog schema has each distinct category broken out into individual tables, while this is nicely normalized and performs well, it is fairly difficult to extend. Adding a new attribute to a particular product involves changing the table schema and backpopulating old data. An idea I've been toying with has been something along the line of a base set of entity tables in 3rd normal form, these will contain the facts that are common among ALL products. Then, I'd like to build an Attribute-Entity-Value schema that allows each entity type to be extended in a flexible way using just data and no schema changes. Finally, I'd like to denormalize this data model into materialized views for each individual entity type. This views are what the application would access. We also have many tables that contain business rules and compatibility rules. These would join against the base entity tables instead of the views. My big concerns here are: Performance - Attribute-Entity-Value schemas are flexible, but typically perform poorly, should I be concerned? More Performance - Denormalizing using materialized views may have some risks, I'm not positive on this yet. Complexity - While this schema is flexible and maintainable using just data, I worry that the complexity of the design might make future schema changes difficult. For those who have designed product catalogs for large scale enterprises, am I going down the totally wrong path? Is there any good best practice schema design reading available for product catalogs?

    Read the article

  • SIMPLE PHP MVC Framework!

    - by Allen
    I need a simple and basic MVC example to get me started. I dont want to use any of the available packaged frameworks. I am in need of a simple example of a simple PHP MVC framework that would allow, at most, the basic creation of a simple multi-page site. I am asking for a simple example because I learn best from simple real world examples. Big popular frameworks (such as code ignighter) are to much for me to even try to understand and any other "simple" example I have found are not well explained or seem a little sketchy in general. I should add that most examples of simple MVC frameworks I see use mod_rewrite (for URL routing) or some other Apache-only method. I run PHP on IIS. I need to be able to understand a basic MVC framework, so that I could develop my own that would allow me to easily extend functionality with classes. I am at the point where I understand basic design patterns and MVC pretty well. I understand them in theory, but when it comes down to actually building a real world, simple, well designed MVC framework in PHP, i'm stuck. I would really appreciate some help! Edit: I just want to note that I am looking for a simple example that an experienced programmer could whip up in under an hour. I mean simple as in bare bones simple. I dont want to use any huge frameworks, I am trying to roll my own. I need a decent SIMPLE example to get me going.

    Read the article

  • Finding distance to the closest point in a point cloud on an uniform grid

    - by erik
    I have a 3D grid of size AxBxC with equal distance, d, between the points in the grid. Given a number of points, what is the best way of finding the distance to the closest point for each grid point (Every grid point should contain the distance to the closest point in the point cloud) given the assumptions below? Assume that A, B and C are quite big in relation to d, giving a grid of maybe 500x500x500 and that there will be around 1 million points. Also assume that if the distance to the nearest point exceds a distance of D, we do not care about the nearest point distance, and it can safely be set to some large number (D is maybe 2 to 10 times d) Since there will be a great number of grid points and points to search from, a simple exhaustive: for each grid point: for each point: if distance between points < minDistance: minDistance = distance between points is not a good alternative. I was thinking of doing something along the lines of: create a container of size A*B*C where each element holds a container of points for each point: define indexX = round((point position x - grid min position x)/d) // same for y and z add the point to the correct index of the container for each grid point: search the container of that grid point and find the closest point if no points in container and D > 0.5d: search the 26 container indices nearest to the grid point for a closest point .. continue with next layer until a point is found or the distance to that layer is greater than D Basically: put the points in buckets and do a radial search outwards until a points is found for each grid point. Is this a good way of solving the problem, or are there better/faster ways? A solution which is good for parallelisation is preferred.

    Read the article

  • How can I setup Hudson to use the same repository for different projects and maintain separate chang

    - by Allen
    I typically setup SVN to host 1 big project per repository but a lot of our infrastructure has changed and we now have one main SVN server that has a hierarchy like so Branches Tags Trunk Project1 files & folders Project2 files & folders Project3 files & folders Projects1,2, and 3 do not share anything amongst themselves, they are independent projects each with their own solution file to be built. I can setup projects in Hudson like so Repository Url: http://server/svn/MainRepository Local module directory (optional): /Trunk/Project1 And that will maintain a separate workspace for each project, but every time you commit to Project 2 or Project 3, a build gets kicked off in Hudson for every project based in that repository. Also, any commit made anywhere in the repository is pulled down and inserted into the Hudson changelog for all of them. I know the easiest solution would be to simply separate every project into its own repository. However, if I couldn't do that due to various reasons, is there a feasible way to achieve the functionality that having separate repositories gets me? I want commits to the sub folder of project 1 to only affect project 1. No other project's commits should cause project 1 to build and project 1's changelog in Hudson should only have commit notes from project 1.

    Read the article

  • Getting Google results in Java? Need help!

    - by Cris Carter
    Hello. Right now, I'm trying to get the results from Google in Java, by searching for a term. I'm using a desktop program, not an applet. That in itself isn't complicated. but then Google gave me a 403 error. Anyways, I added referrer and User Agent and then it worked. Now, my problem is that I don't get the results page from Google. Instead, I get their script which gets the results page. My code right now simply uses a GET request on "http://www.google.com/search?q=" + Dork; Then it outputs each line. Here is what I get when I run my program: <.!doctype html<.head<.titledork - Google Search<./title<.scriptwindow.google={kEI:"9myaS-Date).getTime()}}};try{}catch(u){}window.google.jsrt_kill=1; align:center}#logo{display:block;overflow:hidden;position:relative;width:103px;height:37px; <./ script<./div Lots of stuff like that. I shortened it (A LOT) and put in dots to fit it here. So my big question is: How do I turn this whole mess into the nice results page I get when searching Google with a browser? Any help would be seriously appreciated, and I really need the answer fast. Also, please keep in mind that I do NOT want to use Google's API for this. Thanks in advance!

    Read the article

  • Vertical-Align: A Full Explanation

    - by Livvy Jeffs
    I've been struggling with vertical alignments, a seemingly simple enough process that has a lot of idiosyncrasies throughout different languages and element types. I've done a lot of reading through stackexchange and can't seem to find a common thread of understanding. Here are the rules that I have been able to gather: 1) Vertical-align does not work in <\div>s, you have to set div {display: table-cell; vertical-align: middle} This seems like a big hassle, especially since table-cells override the height limitation even when overflow is set to hidden and expands to fit content, which means the vertical "center" is variable. I just read some source-code from Pinterest where button {vertical-align: middle}, but no other vertical-align commands seem to work. It seems as if button is by default aligned in the middle. Can someone provide a clear explanation for the vertical-align attribute? What html elements respond to vertical-align? Which html elements have default vertical-align attributes? Which html elements have non-overridable vertical-align attributes? And any clues as to understanding the idiosyncracies would help as well! Thanks in advance!

    Read the article

< Previous Page | 367 368 369 370 371 372 373 374 375 376 377 378  | Next Page >