Search Results

Search found 13889 results on 556 pages for 'results'.

Page 378/556 | < Previous Page | 374 375 376 377 378 379 380 381 382 383 384 385  | Next Page >

• SQL Server 2003: how can I assign a name to the SUM column ?

  - by Patrick

  hi, how can I assign a column name to the SUM column ? i.e. select OwnerUserId, SUM(PostScore) INTO Experts from ... I get this error: An object or column name is missing or empty. For SELECT INTO statements, verify each column has a name. For other statements, look for empty alias names. Aliases defined as "" or [] are not allowed. Change the alias to a valid name. I guess because the column containing the results of SUM has not name. thanks

  Read the article

• check for null date in CASE statement, where have I gone wrong?

  - by James.Elsey

  Hello, My source table looks like this Id StartDate 1 (null) 2 12/12/2009 3 10/10/2009 I want to create a select statement, that selects the above, but also has an additional column to display a varchar if the date is not null such as : Id StartDate StartDateStatus 1 (null) Awaiting 2 12/12/2009 Approved 3 10/10/2009 Approved I have the following in my select, but it doesn't seem to be working. All of the statuses are set to Approved even though the dates have some nulls select id, StartDate, CASE StartDate WHEN null THEN 'Awaiting' ELSE 'Approved' END AS StartDateStatus FROM myTable The results of my query look like : Id StartDate StartDateStatus 1 (null) Approved 2 12/12/2009 Approved 3 10/10/2009 Approved 4 (null) Approved 5 (null) Approved StartDate is a smalldatetime, is there some exception to how this should be treated? Thanks

  Read the article

• Tomcat SSL Configuration

  - by bdares

  I received a SSL cert to use for a Tomcat 6.0 server, ready to use. I configured Tomcat to use it with the following in server.xml: <Connector port="8443" maxThreads="200" scheme="https" secure="true" SSLEnabled="true" keystoreFile="C:\Tomcat 6.0\ssl\cert" keystorePass="*****" clientAuth="false" sslProtocol="TLS"/> I started Tomcat using the command prompt so I could see any error message as they happened. There were none. The results for accessing different URLS: http://localhost - normal page loads fine https://localhost - browser claims page cannot be found https://localhost:8443 - page cannot be found http://localhost:8443 - offers a certificate, after accepted redirects to https://localhost (I suspect the https:// urls initially offer the certificate which is automatically accepted by the browser, as it was issued by Verisign) How to fix? Edit: I've also tried port="443". Same result.

  Read the article

• How can I call a Perl package I define in the same file?

  - by Robert S. Barnes

  I need to define some modules and use them all in the same file. No, I can't change the requirement. I would like to do something like the following: { package FooObj; sub new { ... } sub add_data { ... } } { package BarObj; use FooObj; sub new { ... # BarObj "has a" FooObj my $self = ( myFoo => FooObj->new() ); ... } sub some_method { ... } } my $bar = BarObj->new(); However, this results in the message: Can't locate FooObj.pm in @INC ... BEGIN failed... How do I get this to work?

  Read the article

• (Action<T>).Name does not return expected values

  - by Tomas Lycken

  I have the following method (used to generate friendly error messages in unit tests): protected string MethodName<TTestedType>(Action<TTestedType> call) { return string.Format("{0}.{1}", typeof(TTestedType).FullName, call.Method.Name); } But when I call it as follows, I don't get the expected results: var nm = MethodName<MyController>(ctrl => ctrl.Create()); After running this code, nm contains "<Create_CreateShowsView>b__8", and not (as expected) "Create". How should I change the code to obtain the expected result?

  Read the article

• Entity Framework: Attached Entities not Saving

  - by blog

  Hello: I can't figure out why calling SaveChanges() on the following code results in no changes to the objects I attached: // delete existing user roles before re-attaching if (accountUser.AccountRoles.Count > 0) { foreach (AccountRole role in accountUser.AccountRoles.ToList()) { accountUser.AccountRoles.Remove(role); } } // get roles to add List<int> roleIDs = new List<int>(); foreach (UserRole r in this.AccountRoles) { roleIDs.Add(r.RoleID); } var roleEntities = from roles in db.AccountRoles where roleIDs.Contains(roles.id) select roles; accountUser.AccountRoles.Attach(roleEntities); db.SaveChanges(); In the debugger, I see that the correct roleEntities are being loaded, and that they are valid objects. However, if I use SQL Profiler I see no UPDATE or INSERT queries coming in, and as a result none of my attached objects are being saved.

  Read the article

• .NET Garbage Collection behavior (with DataTable)

  - by gmac

  I am wonder why after creating a very simple DataTable and then setting it to null why Garbage Collection does not clear out all the memory used by that DataTable. Here is an example. The variable Before should be equal to Removed but it is not. { long Before = 0, After = 0, Removed = 0, Collected = 0; Before = GC.GetTotalMemory(true); DataTable dt = GetSomeDataTableFromSql(); After = GC.GetTotalMemory(true); dt = null; Removed = GC.GetTotalMemory(true); GC.Collect(); Collected = GC.GetTotalMemory(true); } Gives the following results. Before = 388116 After = 731248 Removed = 530176 Collected = 530176

  Read the article

• Mod_rewrite trouble: Want to direct from ?= to a flat link, nothing seems to work.

  - by Davezatch

  I have a site that currently serves results as example.com/index.php?show=foo and I'd like it to read example.com/show/foo. My understanding is this would make them visible to search engine robots, and it seems a much simpler way to do this than to create a couple hundred html files... I've tried the following .htaccess code: Options +FollowSymLinks RewriteEngine on RewriteRule ^show/(.*)$ index.php?show=$1 [NC,L] No dice. Also tried this, which I found on another stack overflow question: <IfModule mod_rewrite.c> RewriteEngine On RewriteBase / RewriteCond %{REQUEST_FILENAME} !-f RewriteCond %{REQUEST_FILENAME} !-d RewriteRule ^([0-9A-Za-z]+)/?$ /index.php?show=$1 [L] </IfModule> Any ideas on what I'm missing here?

  Read the article

• Running Test framework as part of application

  - by VP

  Hi, I would like to know if it is possible in rails to run some test cases through my application. I mean, i want show the test results to users. So i was thinking to be able to call my tests through a controller and put the tests output in a dialog. Imagine that i'm doing an application where before to apply a rule, i want to run some validation tests. I could write methods in my rule model to do it, but i would like to use something like shoulda or any other kind of DSL where the "fixture" would be a record itself. Any tip or idea?

  Read the article

• Delphi and mysql - Unable to connent to server..maybe custom connection reqd

  - by Steve

  I am coding an application for my company wherein i want to parse the results of a mysql query and display them in my application but i am facing a problem conecting to the database. the ip address of the server is : 172.30.192.20 and before i can ping it i have to add route on my pc something like this route add 172.30.192.0 mask 255.255.255.0 172.30.192.56 where 172.30.192.56 is the gateway Now whenever i try to connect 172.30.192.20 which is where the sql server is running my appplication instead connects to 172.30.192.56 i am coding the application in delphi and have used TmySQL After this didnt workout i tried an application called SQLwave. I just entered the server ip address and was able to connect to the database without any problems. it seems sqlwave uses mydac which is why even i tried using it but using the default connection options and setting i was still not able to connect. it seems sqlwave uses a custom connection using mydac i just want to know whats going wrong with my connection

  Read the article

• How come the [L] flag isn't working in my .htaccess file?

  - by George Edison

  Here are the rules: <IfModule mod_rewrite.c> RewriteEngine on RewriteRule ^$ index.php?action=home [L] RewriteRule ^[\w\W]*$ error.php [L] When a page matches the first one, it is supposed to ignore any other further rules. Yet accessing / results in error.php being invoked. Commenting out the second rule works as intended - the page redirects to index.php. What am I doing wrong? Also: is there a better way to write the last line? It's basically a catch-all.

  Read the article

• can i have a date in the url of a route in asp.net ?

  - by oo

  This code below doesn't seem to work but i can't figure out why. If i have a user entered textbox that is a datepicker and the results are displayed as: 21-May-2010 , can i take this value and stick it into a URL to send over to a controller action so instead of an id (which is an int), i want a id which is a date value View / Javascript Code: $.get('/Tracker/DailyBlog/' + this.val(), function(data) { $('#dailyblog').html(data); }); ControllAction Code: public ActionResult DailyBlog(DateTime blogDate) { //go do something } any idea why this is not working ?

  Read the article

• Force a page cache of Ajax content

  - by Webnet

  I have a page that is an search where the results are loaded via ajax. It then lists products on a page and you can click to view each product. I'd like to change this page where after you view a product if you click "back" on your browser it'll load the cache instead of forcing the user to search again. How can I achieve this? I currently have.... header('Cache-Control: private, max-age:3600'); header('Expires: '.gmdate('D, d M Y H:i:s \G\M\T', time() + 3600)); and it doesn't load the cache

  Read the article

• String.Format with NumberGroupSeparator outputting 0xa0 not comma

  - by andrevdm

  I'm seeing strange results when doing a string.Format( "C" ); E.g. double val = 123456.78; Console.WriteLine( val.ToString( "C" ) ); This prints the thousand separator as 0xa0 rather than a comma (0x2c). I get the same result if I use string.Format( "{0:0,0.00}", 1234567.12D ); Here is the full output R 123ÿ456,78 52333A333233 201230456C78 My regional settings are English (South African) and I'm getting the same result on multiple machines. Any ideas? Thanks.

  Read the article

• A pointer member variable having different values

  - by Rohan Prabhu

  Ok, to begin with, this is my code: HyperSprite::HyperSprite() { _view = 0; } void HyperSprite::publish(QGraphicsView* view) { _view = view; } void HyperSprite::getKFrame() { if(_view != 0) { qDebug()<<(void*)_view; } } Now, if I call HyperSprite::getKFrame() from within main(), I get the output: 0xbf8ffb84 I have a TCP server, which requires this QGraphicsView* variable. So whenever a new connection is made, HyperSprite::getKFrame() is called. However, whenever I make a connection to my server, this is the output: 0x1e425ff I honestly don't understand this. Shouldn't the value of a member remain same throughout? Why is the pointer value changing? As is obvious, whenever I try to use the _view pointer to access any of its members, a Segmentation Fault occurs. I tried using QSharedPointer, but it also results in the same problem. The data of the QSharedPointer automatically changes. Why is this happening?

  Read the article

• join query with lowstock products with another table in magento

  - by muralikalpana

  I want to display some attributes in reports/products/lowstock grid. here how can i join another table with lowstock product id? here is the query /** @var $collection Mage_Reports_Model_Resource_Product_Lowstock_Collection */ $collection = Mage::getResourceModel('reports/product_lowstock_collection') ->addAttributeToSelect('*') ->setStoreId($storeId) ->filterByIsQtyProductTypes() ->joinInventoryItem('qty') ->joinInventoryItem('low_stock_date') ->useManageStockFilter($storeId) ->useNotifyStockQtyFilter($storeId) ->setOrder('qty', Varien_Data_Collection::SORT_ORDER_ASC); here i have to join with this productid with another table. i am not getting results if i use this query. $collection->getSelect()->join(array('t2' => 'lowstockorders'),'lowstock_inventory_item.product_id = t2.product_id','t2.product_id'); please anybody tell me how to join these tables thanks, murali

  Read the article

• MySQL TEXT field performance

  - by Jonathon

  I have several TEXT and/or MEDIUMTEXT fields in each of our 1000 MySQL tables. I now know that TEXT fields are written to disk rather than in memory when queried. Is that also true even if that field is not called in the query? For example, if I have a table (tbExam) with 2 fields (id int(11) and comment text) and I run SELECT id FROM tbExam, does MySQL still have to write that to disk before returning results or will it run that query in memory? I am trying to figure out if I need to reconfigure our actual db tables to switch to varchar(xxxx) or keep the text fields and reconfigure the queries.

  Read the article

• Splitting Nucleotide Sequences in JS with Regexp

  - by TEmerson

  I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

  Read the article

• In Ruby, how do I make a hash from an array?

  - by Wizzlewott

  I have a simple array: arr = ["apples", "bananas", "coconuts", "watermelons"] I also have a function f that will perform an operation on a single string input and return a value. This operation is very expensive, so I would like to memoize the results in the hash. I know I can make the desired hash with something like this: h = {} arr.each { |a| h[a] = f(a) } What I'd like to do is not have to initialize h, so that I can just write something like this: h = arr.(???) { |a| a => f(a) } Can that be done?

  Read the article

• Using Session to limit form submission by time

  - by user1733850

  I have spent over 2 hours scouring the net trying to figure this out. I am trying to stop multiple form submission any faster than 60 seconds. Here is what I am using. session_start(); if (!isset($_SESSION['last_submit'])) $_SESSION['last_submit'] = time(); if (time()-$_SESSION['last_submit'] < 60) die('Post limit exceeded. Please wait at least 60 seconds'); else $_SESION['last_submit'] = time(); I found this bit here on the site but haven't been able to figure anything else out as far as getting it to work. I have this bit of code on my page at the beginning that does the DB query with the previous pages POST results. Do I need to set $last_submit to a certain value? Any help is appreciated.

  Read the article

• How to map an property of ClassA to one of SuperclassA?

  - by mystify

  I have a class named SuperclassA, and an class named ClassA. ClassA inherits from SuperclassA. SuperclassA has got an property called something, so a very generic not-much-saying name. In ClassA, I want to have an property which maps to that something of SuperclassA. How could I do that? I want to make absolutely sure that any access to myBetterProperty results in accessing what's behind something. Assigning an value to myBetterProperty should result in assigning one to something, and vice versa. How to? Pointers set up in init? How would that look like? *self.myBetterProperty = &something; ? I'm not sure about that...

  Read the article

• What exactly is GRASP's Controller about?

  - by devoured elysium

  What is the idea behind Grasp's Controller pattern? My current interpretation is that sometimes you want to achieve something that needs to use a couple of classes but none of those classes could or has access to the information needed to do it, so you create a new class that does the job, having references to all the needed classes(this is, could be the information expert). Is this a correct view of what Grasp's Controller is about? Generally when googling or SO'ing controller, I just get results about MVC's (and whatnot) which are topics that I don't understand about, so I'd like answers that don't assume I know ASP.NET's MVC or something :( Thanks

  Read the article

• Is an index required for columns in ON clause?

  - by newbie

  Do I have to create an index on columns referenced in Joins? E.g. SELECT * FROM left_table INNER JOIN right_table ON left_table.foo = right_table.bar WHERE ... Should I create indexes on left_table(foo), right_table(bar), or both? I noticed different results when I used EXPLAIN (Postgresql) with and without indexes and switching around the order of the comparison (right_table.bar = left_table.foo) I know for sure that indexes are used for the left of the WHERE clause but I am wondering whether I need indexes for columns listed in ON clauses.

  Read the article

• Android HTTP get methods

  - by Nick

  I have written a number of applications for blackberry and am just starting in Android. It seems to me that android has a lot more built in functions. I am starting by recreating some of my BB apps on Android and on one I take a few xml sites and parse them out. On blackberry I implemented this by creating a class that extended a thread. I would construct a new instance of this class with the parameters of my http request and it would call a function back in my main class, sending it the results. I am tempted to reuse my code, but am curious if android has something better built in. I have been looking at the handler class as well as possible using a service. Bascially, I would like to start a new thread that will return a document of a specific url. Thanks!

  Read the article

• Showing val as html inside of a div in real time.

  - by smudge

  I'm using the following in order to have on screen display of each value of a checkbox that's selected with great results when it's displayed inside a textbox. I'd like to change it so that I can show a real time display in a div as html instead of a textbox. A link to a working demo is here and below is the script. I know it's probably a basic line or two but i'm still learning and new. thanks! function updateTextArea() { var allVals = []; $('#c_b :checked').each(function() { allVals.push($(this).val()); }); $('#t').val(allVals) } $(function() { $('#c_b input').click(updateTextArea); updateTextArea(); });

  Read the article

< Previous Page | 374 375 376 377 378 379 380 381 382 383 384 385  | Next Page >