Search Results

Search found 14236 results on 570 pages for 'times square'.

Page 380/570 | < Previous Page | 376 377 378 379 380 381 382 383 384 385 386 387  | Next Page >

• Parsing timestamps - do it in MySQL or in PHP?

  - by Andrew Heath

  Let's say you've got a table with a timestamp column, and you want to parse that column into two arrays - $date and $time. Do you, personally: a) query like this DATE(timestamp), TIME(timestamp) , or perhaps even going as far as HOUR(timestamp), MINUTE(timestamp b) grab the timestamp column and parse it out as needed with a loop in PHP I feel like (a) is easier... but I know that I don't know anything. And it feels a little naughty to make my query hit the same column 2 or 3 times for output... Is there a best-practice for this?

  Read the article

• Thread toggling

  - by sid

  Hi all, In Ubuntu, I am running 2 'C' applications, When I press key up/down the applications are alternatively getting the events. What might be the problem/solution? Ex: I have 'A application' and 'B application', I launch 'A application' and press the key up/down its working fine. If I simultaneously launch 'B application' and focus is on 'B application' then pressing key up/down will toggle between 'A application' & 'B application' so 2 times I have to press the key to move on 'B application'(focus is on 'B application'). 'A application' and 'B application' are threads. Thanks in advance-opensid

  Read the article

• Splitting Nucleotide Sequences in JS with Regexp

  - by TEmerson

  I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

  Read the article

• MediaWiki : is it possible to add an edit link in a template?

  - by leo

  I have a template on my wiki, kind of a box template. Then, there is this page where I use it several times. Can I add an edit link to each of the boxes so I don't have to edit the whole page in order to modify one of the boxes? The boxes contain only text, not other templates. Thanks! Edit: Actually there's an easier way to ask my question: Let's say I have a page without sections defined (namely without == titles ==): content A content B content C Is there a way to open an edit form only for content B?

  Read the article

• Eliminating inherited overlong MACRO

  - by ExpatEgghead

  I have inherited a very long set of macros from some C algorithm code.They basically call free on a number of structures as the function exits either abnormally or normally. I would like to replace these with something more debuggable and readable. A snippet is shown below #define FREE_ALL_VECS {FREE_VEC_COND(kernel);FREE_VEC_COND(cirradCS); FREE_VEC_COND(pixAccum)..... #define FREE_ALL_2D_MATS {FREE_2D_MAT_COND(circenCS); FREE_2D_MAT_COND(cirradCS_2); } #define FREE_ALL_IMAGES {immFreeImg(&imgC); immFreeImg(&smal..... #define COND_FREE_ALLOC_VARS {FREE_ALL_VECS FREE_ALL_2D_MATS FREE_ALL_IMAGES} What approach would be best? Should I just leave well alone if it works? This macro set is called twelve times in one function. I'm on Linux with gcc.

  Read the article

• Seasonal Pricing for a Hotel Room

  - by Laykes

  I am trying to manage seasonal prices for hotel rooms. The only way that I can think of doing it would be to use: | DayDate |EndDate | A | B ----------------------------------------------- | 2010/07/1 |2010/07/2 | 200 | 40 | 2010/07/3 |2010/07/4 | 150 | 40 | 2010/07/5 |2010/07/5 | 150 | 50 | 2010/07/6 |2010/07/7 | 200 | 50 | 2010/07/8 |2010/07/9 | 100 | 60 etc.. (table taken from another question). The problem is: I don't want my seasons to be year specific. Seasons for rooms shouldn't change year on year. I don't want my users to have to enter the seasonal information several times. I am also going to have thousands of rooms, so I don't know a way to make this easily manageable. I'm using mysql and php.

  Read the article

• Letter-spacing in large name decreasing

  - by zabulus

  I have such trouble: in large names, as shown in image , somehow letter-spacing for Tahoma font is decreasing. This issue is shown up in two components that I use, so I don't think this is bug of the components. I have tested with another fonts, Arial - situation the same; MS Sans Serif - the same; Trebuchet MS - situation is good, symbols type correctly; Times New Roman - situation is good too, but font with notches Can you help? Using .NET without WPF.

  Read the article

• how to deal with async calls in Ajax 4.0(using jquery?)

  - by dexter

  in my code i have done something like this. $.get('/Home/Module/Submit', { moduleName: ModName, moduleParameters: moduleParameters }, function(result) { $("#" + target).html(result); }); when i put alert in the function(result) {..} it shows html perfectly(both in alert and at the 'target'-on the .aspx page) BUT when i remove the alert.. on the page the 'html' don't appear or appear randomly (this method is called multiple times) i think that the 'result' comes to function asynchronously thats why it is not bind with the respective 'div' however in the last iteration it gets bind every time. can we make process stop until data gets bind? or is there any functionality (like alert) which can make data bind.. without disturbing UI (unlike alert)?

  Read the article

• How do I get back results running a VB Script from C#?

  - by Tom

  I want to be able to call VB scripts from C#, which is easy enough, but I need to be able to get back the results from these scripts at times. Should I use the method referenced with something to read back, or should I use a different method? I've found a method to getting data back from powershell scripts using Runspaces and Pipelines, but I don't know enough about this technology to know if it will work with VB scripts as well. Ideally, I'd like to do something similar to the powershell method where I can just pass in the contents of the script without needing to reference an external file and get back the results. Can anyone tell me how to do this? Thanks.

  Read the article

• how to select all the data from many tables?

  - by Syom

  how to select all the data from many tables? i try `"SELECT * FROM `table1`, `table2`"` , but result none understandable for me. it returns only some rows from table1, and 3 times all the data from table2. i've red one same question here, but don't understand the answer. so could you help me? thanks in advance. update: when i try (SELECT * FROM `videos`) UNION (SELECT * FROM `users`) it returns #1222 - The used SELECT statements have a different number of columns

  Read the article

• Visual Studio 2010 haunted keyboard

  - by Ryan

  It seems the haunted keyboard is back in VS2010 ... after working on a web application for a short while I find that some keys just don't work, or are behaving like certain keys are stuck. This is only in VS, and I am definitely not triggering any keyboard changes in VS or Windows (I have disabled that in Windows) and I have reset my environment settings several times. Aargh! This is so frustrating ... anyone else getting this problem? Is there are solution?

  Read the article

• "Inlining" (kind of) functions at runtime in C

  - by fortran

  Hi, I was thinking about a typical problem that is very JIT-able, but hard to approach with raw C. The scenario is setting up a series of function pointers that are going to be "composed" (as in maths function composition) once at runtime and then called lots and lots of times. Doing it the obvious way involves many virtual calls, that are expensive, and if there are enough nested functions to fill the CPU branch prediction table completely, then the performance with drop considerably. In a language like Lisp, I could probably process the code and substitute the "virtual" call by the actual contents of the functions and then call compile to have an optimized version, but that seems very hacky and error prone to do in C, and using C is a requirement for this problem ;-) So, do you know if there's a standard, portable and safe way to achieve this in C? Cheers

  Read the article

• FLEX: how to ignore MouseEvents from the container ?

  - by Patrick

  hi, I've some objects on the canvas, and I added eventListeners to these objects for MOUSE_UP event. I'm know checking if it works by tracing e.target.name, and I found out that the event is triggered twice, before on the element container (Canvas) and then the element itself. I read several times the documentation about Capture, Bubbling etc.. but I don't understand how to trigger the events only from the element itself... child.addEventListener(MouseEvent.MOUSE_UP, updateSelectedTags); private function updateSelectedTags(e:MouseEvent):void { Alert.show(e.currentTarget.name); //I have 2 alerts, one for canvas, the other one for the child } } thanks

  Read the article

• About the leading newline in Visual Studio solution files.

  - by mafutrct

  Sometimes, for unknown reasons, VS 2008 creates solution files led by a newline. Microsoft Visual Studio Solution File, Format Version 10.00 # Visual Studio 2008 [...] This happened on various machines, and I have no idea why this is. A Google search did not yield any useful results. Now, why do I worry about this? Because I can't open these solutions in Windows Explorer. I have to open VS, select File - Open - Solution and it works fine. But to open solutions from within Explorer, I have to edit the sln file and remove the leading newline. Edit: After Leom's suggestion I tested a few times and found that the issue is solely dependent on the leading newline.

  Read the article

• AJAX Closures and targeting 'this'

  - by Nick Lowman

  In the code example below the success callback function logs 'input#04.update' four times rather than each individual input, which makes sense seeing how closures work but how would I go about targeting each individual input using this. <input type="text" name="" id="01" class="update"> <input type="text" name="" id="02" class="update"> <input type="text" name="" id="03" class="update"> <input type="text" name="" id="04" class="update"> function updateFields(){ $('input.update').each(function(){ $this = $(this); $.ajax({ data: 'id=' + this.id, success: function(resp){ console.log($this); $this.val(resp) } }); }); }

  Read the article

• what to use for repetitive (daily, weekly, monthly) tasks ? Workflows, Windows Services, something e

  - by mare

  I've been writing Windows Services for a while and they always seem to work fine for things that need to run every day, few times a week, once a month, etc. but I've been lately thinking about going with Windows Workflow Foundation. However, I am unsure how would they run on a server without some container application (for instance SharePoint)? I worked with Sharepoint workflows before and I always had huge problems, at first with the bugs in the workflow architecture implementation (the problems with sleep and delay) and later when they eventually started to work, they were difficult to manage and change. On the other hand Windows Services were always quite easy to implement, easy to create a setup for them and install them and they were always quite resilient (they were often working for months without crashing or something else going wrong). What do you recommend? Please bear in mind we are working in .NET (version is of no problem, if 4.0 brings something new on this subject, we can use it).

  Read the article

• C# performance of static string[] contains() (slooooow) vs. == operator

  - by Andrew White

  Hiya, Just a quick query: I had a piece of code which compared a string against a long list of values, e.g. if(str == "string1" || str = "string2" || str == "string3" || str = "string4". DoSomething(); And the interest of code clarity and maintainability I changed it to public static string[] strValues = { "String1", "String2", "String3", "String4"}; ... if(strValues.Contains(str) DoSomething(); Only to find the code execution time went from 2.5secs to 6.8secs (executed ca. 200,000 times). I certainly understand a slight performance trade off, but 300%? Anyway I could define the static strings differently to enhance performance? Cheers.

  Read the article

• Jumping over a While loop in Debug mode

  - by BDotA

  Here is the scenario: I put a break point at the beginning of a method that I want to debug... at first lets say there is Part1 in this method that I want to step into/over some of the codes... good... after that there is a While loop that I am NOT interested to step into/over it, I just want to tell the debugger that Hey you yourself run this loop for 10 times and just let me move to Part2 of my code which starts after this While loop , is it possible to do this with debugging options? so something like this : BreakPoint : MyMethod { Part One of the code : Ok, lets debug it While Loop : I do not care, Do not want to debug it Part Two of the code: Yes, I want to debug it too }

  Read the article

• Duplicate records

  - by czuroski

  Hello, I am using nHibernate for db persistence. I have a one-to-many relationship defined between 2 tables. When I query and try to get data, I am getting the correct number of rows from the "many" table, but the rows are duplicates of the first row returned. table1 (one), table2 (many). I create a criteria query to get a certain record from table1. I then expect to get all associated records from table2. ie, table1 holds orders, table2 holds items. I query table1 to get an order which has 4 items. I expect to see each of those 4 items from table2, but all I am seeing is the 1st item repeated 4 times. Does anyone have any idea what might be happening?

  Read the article

• C++ string how to

  - by typoknig

  This is a very simple question and I feel stupid for asking it, but I am pressed for time and I need to figure it out :) I just need to know how to make a string that contains text and other variables. For instance in Java I can just do this: String someString; for(int i = 0; i>10; i++){ someString = ("this text has printed " + i + " times"); //how do I create this line in C++? System.out.println(someString); i++; }

  Read the article

• Multiple Concurrent Changes Using SVN, GIT, and CVS

  - by KlaxSmashing

  At work, we are using SVN, CVS, and GIT because there any many projects that were started at various times. Anyway, a common sequence that occurs is as follows: Working on task A, making changes to project Has new task B, some bug or functionality needs to be done on project, independent of task A but may affect same set of files Check in task B Check in task A Unfortunately, what I do at this time is two maintain 2 working copies of each project. So I can always work on task B from a clean copy. As you can imagine, this is wasteful and also, does not scale well (task C, D, E, etc.) For each of these versioning systems, are there commands that can help me do the following: "Save" task A, reverting working copy to current repository Work on task B, check in changes "Restore" task A changes back to working copy

  Read the article

• Loading multiple embedded flash apps onto an HTML page- problem with ordering

  - by shudson250

  We need to load an embedded version of a site written in Flash, and not originally designed to load multiple instances of itself, on a HTML page. The specific issue is how to get them to load in order when embedded, given that they are all being opened by the same instance of the flash player. It's a complicated mapping application, and at the moment, the maps and data get intermixed as the session variables are overwritten by another instance starting to load before the previous one has finished. We need a way to have them load sequentially, one finishing before another starts to load. The most we can specify in the URL is an &order=1 or similar. We have PHP and SQL on the backend. Edit: The embedded versions are being loaded in an iFrame of a parent site. One php file loads one swf, as many times as the parent site desires.

  Read the article

• cron library for java

  - by nutsiepully

  I am looking for a cron expression library in java. Something that can parse cron expressions and return me future fire times for the trigger. API on the lines of. CronExpression cronExpression = new CronExpression("0 30 4 * * *"); List<Date> fireTimes = cronExpression.getFireTimes(todaysDate, nextWeekDate); I don't want to use something as complicated as quartz. The purpose is to basically use cron like a regex for timings. That's all. I do not want a background scheduler. I tried googling but wasn't able to find anything very helpful. Any suggestions would be appreciated. Regards, Pulkit P.S - I looked at using the CronExpression class out of quartz. Wasn't very helpful - failing some tests.

  Read the article

• Rails layouts per action?

  - by mrbrdo

  I use a different layout for some actions (mostly for the new action in most of the controllers). I am wondering what the best way to specify the layout would be? (Consider like I am using 3 or more different layouts in the same controller) I don't like using render :layout = 'name' that much. I did like doing layout 'name', :only = [:new] but it turns out I can't use that to specify 2 different layouts (e.g. if I call layout 2 times in the same controller, with different layout names and different only options, the first one gets ignored - those actions don't display in the layout i specified). I'm using Rails 2.

  Read the article

• Count Records in Listing View

  - by 47

  I have these two models: class CommonVehicle(models.Model): year = models.ForeignKey(Year) series = models.ForeignKey(Series) engine = models.ForeignKey(Engine) body_style = models.ForeignKey(BodyStyle) ... class Vehicle(models.Model): objects = VehicleManager() stock_number = models.CharField(max_length=6, blank=False) vin = models.CharField(max_length=17, blank=False) common_vehicle = models.ForeignKey(CommonVehicle) .... What I want to do is to have a count of how many times a given CommonVehicle object is used in the Vehicle class. So far my attempts are giving me one number, which is a total of all the records. How can I have the count being the total appearances for each CommonVehicle

  Read the article

< Previous Page | 376 377 378 379 380 381 382 383 384 385 386 387  | Next Page >