Search Results

Search found 13324 results on 533 pages for 'stop words'.

Page 381/533 | < Previous Page | 377 378 379 380 381 382 383 384 385 386 387 388  | Next Page >

  • Can EventMachine recognize all threads are completed?

    - by philipjkim
    I'm an EM newbie and writing two codes to compare synchronous and asynchronous IO. I'm using Ruby 1.8.7. The example for sync IO is: def pause_then_print(str) sleep 2 puts str end 5.times { |i| pause_then_print(i) } puts "Done" This works as expected, taking 10+ seconds until termination. On the other hand, the example for async IO is: require 'rubygems' require 'eventmachine' def pause_then_print(str) Thread.new do EM.run do sleep 2 puts str end end end EventMachine.run do EM.add_timer(2.5) do puts "Done" EM.stop_event_loop end EM.defer(proc do 5.times { |i| pause_then_print(i) } end) end 5 numbers are shown in 2.x seconds. Now I explicitly wrote code that EM event loop to be stopped after 2.5 seconds. But what I want is that the program terminates right after printing out 5 numbers. For doing that, I think EventMachine should recognize all 5 threads are done, and then stop the event loop. How can I do that? Also, please correct the async IO example if it can be more natural and expressive. Thanks in advance.

    Read the article

  • Impressing Potential Employers

    - by superfly123
    Where I am, I can't afford to get certification. I'm definitely not the best programmer, but I do know my junk. I've been writing software in C++ for over 8 years now and have a very good knowledge of the Win32 API. But when applying for jobs, I get rejected every time I send a resume. I've given my resume to recruitment firms and asked them what they think's wrong with it and they said the only thing they could think of is the fact that I don't have certifications to prove that I know my stuff. But in my resume, I explain my previous work and projects, and also note that upon request they can actually see what I've done. Is there anything that you would suggest that might help others to stop ignoring my resumes? Thank you

    Read the article

  • How to make a service not receive messages at certain times

    - by miker169
    I'm currently learning wcf for an up and coming project. The service I am creating is using MSMQ to update the database, but the database can't accept messages at certain times. The service is going to be a windows service. The one thing I am coming up against at the moment is how I can get the service to stop reading messages from the queue at these times, for instance lets say I don't want to read messages from the queue on sundays. How would I go about implementing this. So that the client can send messages to the queue that update the database but the service doesn't read the messages until monday, so that the database gets all the updates on the monday? I have started looking at creating a customhost, but I'm not sure if I'm heading in the right direction with this. Thanks in advance.

    Read the article

  • When to use a service in Android

    - by Computerish
    Hi everyone, I have a class that fetches data in response to button presses in the main activity. Unfortunately, I keep running into problems because this class is not an Activity or a Service. For example, without a Context I cannot translate a resource id into a string: getString(R.string.example_string); // Doesn't work Should I make this class into a Service and have the main Activity stop the class when it is closed? Should I pass the Context from the Activity into this class like this? MyClass c = new MyClass(this); Or is there some better way to handle this problem? This issue also comes up when I try to send a Toast from this class.

    Read the article

  • emacs debugger: how can I step-out, step-over ?

    - by Cheeso
    I don't know why I'm having so much trouble groking the documentation for the elisp debugger. I see it has a commands to "step-into" (d). But for the life of me, I cannot see a step-out or step-over. Can anyone help? If I have this in the Backtrace buffer: Debugger entered--returning value: 5047 line-beginning-position() * c-parse-state() * byte-code("...") * c-guess-basic-syntax() c-show-syntactic-information(nil) call-interactively(c-show-syntactic-information) ...where do I put the cursor, and what key do I type, to step out of the parse-state() fn ? by that I mean, run until that fn returns, and then stop in the debugger again.

    Read the article

  • NSString inheritance

    - by Stef
    Hi, I'm doing an useless thing for my first step in Obj-C @interface String : NSString { int m_isnull; } - (id) init; - (int) isNull; @end @implementation String - (id) init { self = [super init]; m_isnull=1; return self; } - (int) isNull { return m_isnull; } @end test : String *a; a=@"ok"; Works fine, but just 2 little questions 1) When I'm compiling I have this warning warning: incompatible Objective-C types assigning 'struct NSString *', expected 'struct String *' I don't know how to avoid it !? 2) a=@"ok" is a fastest way to initialize a string, but when I'm debugging, I don't stop by at my init constructor why ?

    Read the article

  • Long to timestamp for historic data (pre-1900s)

    - by Mike
    I have a database of start and stop times that have previously all had fairly recent data (1960s through present day) which i've been able to store as long integers. This is very simialr to unix timestamps, only with millisecond precision, so a function like java.util.Date.getTime() would be the value of the current time. This has worked well so far, but we recently got data from the 1860s, and the following code no longer works: to_timestamp('1-JAN-1970 00:00:00', 'dd-mon-yyyy hh24:mi:ss') + numtodsinterval(int_to_convert/(1000),'SECOND' ); This wraps the date and we get timestamps in the year 2038. Is there a way around this issue? All of the documentation i've looked at the documentation and timestamps should be able to handle years all the way back to the -4000 (BC), so i'm suspecting an issue with the numtodsinterval. Any ideas suggestions would be greatly appreciated.

    Read the article

  • Basic iphone timer example

    - by Rob
    Okay, I have searched online and even looked in a couple of books for the answer because I can't understand the apple documentation for the NSTimer. I am trying to implement 2 timers on the same view that each have 3 buttons (START - STOP - RESET). The first timer counts down from 2 minutes and then beeps. The second timer counts up from 00:00 indefinitely. I am assuming that all of the code will be written in the methods behind the 3 different buttons but I am completely lost trying to read the apple documentation. Any help would be greatly appreciated.

    Read the article

  • Sending some byte at time

    - by user1417815
    I'm trying to figure out way to send some amount of text from the string ech time until it reach the end of the string, example: const char* the_string = "hello world, i'm happy to meet you all. Let be friends or maybe more, but nothing less" Output: hello world Output: , i'm happy to meet you all. Output: Let be friends or maybe more Output: , but nothing less stop: no more bytes to send. the problem i have searched google, but didn't understand the examples, i spent 4 days trying find a good way, also that sendt 5 bytes at time, but in case there is less, then send them until you are at the end of the string. please help me out guys, i will accept a C or C++ way, as long it works and well explained.

    Read the article

  • Where does Eclipse save the list of files to open on startup?

    - by Grundlefleck
    Question: where does Eclipse store the list of files it opens on startup? Background: Having installed a plugin into Eclipse which promptly crashed, my Eclipse workspace is in a bit of a state. When started, the building workspace task pauses indefinitely at 20%. Before I uninstall the plugin I want to give it another chance. I have a feeling that the reason Eclipse is pausing is because of a file which was opened when it crashed, which it tries to reopen on startup. If I can stop this file from opening on startup there's a chance I may be able to coax the plugin to behave. The problem is I have no idea where that list of files is persisted between runs of Eclipse. ...a second before I posted this question, I realised I could just delete the file causing the problem (duh). However, the search has frustrated me enough to want to find the answer.

    Read the article

  • Embedded quicktime video pause on click how to prevent?

    - by Marek
    I embedded a quicktime video in firefox. It works, but i would like to prevent the users to stop the video by clicking on it with the left mouse button. Reading the apple documentation i didn't find any answear. I came up with a workaround, i just put an almost invisible div over the whole video. The workaround works in firefox for os X, but oddly does not for the same version of firefox in windows. I would appreciate a way, workaround or not, to achive this at least in the windows/firefox environment. Thanks!

    Read the article

  • Artificial Intelligence - What to put in, or leave out, and what can be inferred?

    - by D Scott
    I was having a discussion with a coworker (while we were programming) about AI. We were talking about emotions/feelings and if you should choose to leave any out. I asked him, "Would you leave out racism or hate?" and if you did leave those out, what, if any, other emotions might lead to the AI learning the left out emotions or feelings. Should you PROGRAM in measures to stop the AI from learning those feelings? If you teach Love, does it need to know hurt? Or would it learn hurt? If it then knew Hurt would it connect it with Dislike, Hurt and Dislike could that then lead to some other non-programmed emotion? Such as hate? All while tele-commuting from home.

    Read the article

  • problem in playing next song in the avaudioplayer

    - by Rajashekar
    Hello friends my delegate method looks like this. after the first song is played it goes into this method and plays the second song , however when the second song is done playing it stops. it does not go into the delegate method.i need to play all the songs continuously. i am not sure, why. can someone help me. (void)audioPlayerDidFinishPlaying:(AVAudioPlayer *)p successfully:(BOOL)flag { if (flag == NO) NSLog(@"Playback finished unsuccessfully"); else { //[player stop]; index++; NSLog(@"%d",index); path=[[NSBundle mainBundle] pathForResource:[songlist objectAtIndex:index] ofType:@"mp3"]; [player initWithContentsOfURL:[NSURL fileURLWithPath:path] error:NULL]; [songlabel2 setTitle:[songlist objectAtIndex:index]]; [endtime setText:[NSString stringWithFormat:@"%.2f",[player duration]/100]]; [player play]; } }

    Read the article

  • Location inheritInChildApplications kill debugger?

    - by chobo2
    Hi I am wondering is this normal when you add this into your web.config <location path="." inheritInChildApplications="false"> </location> The debugger should stop working. Like when I add this to my site and try to run in debug mode it won't activate any of my debug points nor will it lock up Visual studios 2008. I can have it running and still make edits to my C# code. I take the line away and I get the debug mode back and it locks up VS2008.

    Read the article

  • twisted .loseConnection does not immediately lose connection?

    - by Claudiu
    I have a server with a few clients connected to it. When CTRL+C is hit (that is, reactor starts shutting down), I want to close all my connections, wait until they are cleanly closed, and then stop. I do this by going through the connected clients' transports and calling .loseConnection(). On the ones that are connected locally, they immediately disconnect. However, on one that is connected through the internet, the connection is not immediately lost. Communication stops - and closing the client program no longer even tells the server that the connection has died, although it does before calling .loseConnection() - but the connection is not deemed 'lost' until a few minutes later after I send a few heartbeat requests from the server. I understand that if a connection dies, there's no way for the server to know unless it tries to send some data. But if I specifically ask for a connection to be closed, why does it not just close/disconnect immediately? Am I calling the wrong function?

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • SQL: Interrupting a query

    - by NoozNooz42
    I've worked on a project using a proprietary non-SQL DB where queries could be interrupted and in the codebase there were quite some spots where that functionnality was used and made perfect sense (for example to stop a long running query that gets cancelled by the user, or when a more recent query takes place and renders the previous query obsolete, etc.) and I realized I never really saw that kind of "interrupted queries" previously and thought it could make a good SO question (several questions, but they're all related to exactly the same thing): can SQL queries be interrupted? is this part of the SQL standard? if it's not part of the SQL standard, which SQL DBs allow queries to be interrupted (any example most welcome)? is it common to interrupt a DB query (SQL or not) which you'll know you won't care about the result anymore? (in the codebase I've worked on, it sure helps lighten the server's load)

    Read the article

  • How to have a javascript callback executed after an update panel postback?

    - by TNunes
    I'm using a jQuery tip plugin to show help tips when the user hovers certain elements of the page. I need to register the plugin events after the page is loaded using css selectors. The problem is I'm using an ASP.NET Update Panel and after the first postback, the tips stop working because the update panel replaces the page content but doesn't rebind the javascript events. I need a way to execute a javascript callback after the Update Panel refreshes its content, so I can rebind the javascript events to have the tips working again. Is there any way to do this?

    Read the article

  • Using Session to limit form submission by time

    - by user1733850
    I have spent over 2 hours scouring the net trying to figure this out. I am trying to stop multiple form submission any faster than 60 seconds. Here is what I am using. session_start(); if (!isset($_SESSION['last_submit'])) $_SESSION['last_submit'] = time(); if (time()-$_SESSION['last_submit'] < 60) die('Post limit exceeded. Please wait at least 60 seconds'); else $_SESION['last_submit'] = time(); I found this bit here on the site but haven't been able to figure anything else out as far as getting it to work. I have this bit of code on my page at the beginning that does the DB query with the previous pages POST results. Do I need to set $last_submit to a certain value? Any help is appreciated.

    Read the article

  • Java Pack No Resize

    - by ikurtz
    i am learning Java at the moment and have the following question: i am adding my controls to JFrame and then pack() before displaying. this runs the application and all is very nice. i was wondering is there a way to stop the user from resizing the application window? also is there a way to for the image in JLabel to expand as the user changes the application window? at the moment i have it as: constraints.fill = GridBagConstraints.BOTH; constraints.anchor = GridBagConstraints.CENTER; and it only centers the image, i would like to be able to expand/shrink the image. thanks.

    Read the article

  • DAQ Triggers in Matlab

    - by RidePlanet
    I'm writing a program that detects the speed of a object by hall effect sensors that are run into MATLAB through a DAQ (MCC USB-1408FS) The problem that has arisen is that I'm using a non-stop scan technique to detect the state of one of 3 sensors. Unfortunately this means that unless the object is rotating past each sensor at the exact rate the program runs, I will see an instantaneous speed (done by comparing the time between two sensors) of zero. I need the sensors to signal the program to count when they are hit, instead of constantly scanning for the signal. How can this be done?

    Read the article

  • [ASP.NET MVC] Problem with View - it does not refresh after db update

    - by crocodillez
    Hi, I am working with small ASP.NET MVC project - online store. I have addToCart method which adds selected product to cart - it updates cart table in my db and showing cart view with its content. But I have problems. while db is updating correctly the view does not. I see that quantity of the product in my db is incremented correctly but quantity in view is not changed. I have to stop debugging my app in visual studia and restart it - then my view is showing correct data. What can be wrong?

    Read the article

  • how to deal with async calls in Ajax 4.0(using jquery?)

    - by dexter
    in my code i have done something like this. $.get('/Home/Module/Submit', { moduleName: ModName, moduleParameters: moduleParameters }, function(result) { $("#" + target).html(result); }); when i put alert in the function(result) {..} it shows html perfectly(both in alert and at the 'target'-on the .aspx page) BUT when i remove the alert.. on the page the 'html' don't appear or appear randomly (this method is called multiple times) i think that the 'result' comes to function asynchronously thats why it is not bind with the respective 'div' however in the last iteration it gets bind every time. can we make process stop until data gets bind? or is there any functionality (like alert) which can make data bind.. without disturbing UI (unlike alert)?

    Read the article

  • eliminating noise/spikes

    - by tgv
    I have a measurement data with similar positive and negative values which should be like: ReqData=[0 0 -2 -2 -2 -2 -2 -2 0 0 0 -2 -2 -2 -2 0 0 2 2 2 2 2 2 0 0 2 2 2 2 2 0 0 2 2 2 2 2 0 0 2 2 2 0 0]' However, there are some measurement noises in the data - so the real data is like this: RealData=[0 0 -2 -2 -2 -2 -2 -2 0 0 0 -2 -2 -2 -2 0 0 2 2 2 2 -4 -1 0 0 2 2 2 2 -7 0 0 2 2 2 2 -1 0 0 2 2 2 0 0]' How do I remove the end noise from the RealData and convert it into ReqData using Matlab? How do I find the start and stop indexes of each set of positive or negative data and split them using Matlab? For instance, ansPositive = [3,8, 12, 15]' and ansNegative = [18, 23, 26, 30, 33, 37, 40, 42]'.

    Read the article

  • Alert Box Running First?

    - by corymathews
    I have some jQuery/JS below. The first thing to run is the alert box at the end. $(document).ready(function() { $("#id1 img , .msg").stop().animate( { width: '300px', height: '300px'}, { duration: 'slow', easing: 'easeInSine' }).pause(3000); $(".msg").animate( { width: '50px', height: '50px' }, { duration: 498, easing: 'easeOutSine' }); $("#id1 img").animate( { width: '50px', height: '50px' }, { duration: 500, easing: 'easeOutSine' }); $("#id1 img , .msg").animate( { width: '300px',height: '300px'}, { duration: 'slow', easing: 'easeInSine' }).pause(3000); alert('eh?'); }); I do have a easing plugin. If I run this the alert will show, and then the first animate will happen in the background but not be shown. It will just appear at the final size. Shouldn't the alert run at the end of all the animation? Can anyone explain why this is happening?

    Read the article

< Previous Page | 377 378 379 380 381 382 383 384 385 386 387 388  | Next Page >