Search Results

Search found 17003 results on 681 pages for 'multi index'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 386/681 | < Previous Page | 382 383 384 385 386 387 388 389 390 391 392 393  | Next Page >

  • CSS with PHP Extension ????

    - by raj
    hi everyone,,,plz helpl me out .. i want my css to recognise as mystyle.php but inside code would be of css , and i want to access it in my index.php page with header method ,i dont want to use Link method.

    Read the article

  • Flash - playing video

    - by Yippie-Kai-Yay
    Hello! I'm developing a Flash-only application and I want to integrate the flowplayer directly into it, but not on the webpage using some swfobject-like approach. So, at some moment (for example, when arbitrary event fires), I would like to add the flowplayer object to the scene so that it starts streaming the specified video. Does someone know if that is possible? Would the following API (http://releases.flowplayer.org/apidoc-latest/index.html) help me somehow? Thank you.

    Read the article

  • ValidateInputAttribute bug in VS 2010 RC / ASP.NET MVC 2.0?

    - by Ben
    Am I doing something wrong here? I have a text area on a view and am posting back the html contents. In VS 2008 and MVC 1.0 the following code successfully prevents input validation: [HttpPost] [ValidateInput(false)] public ActionResult Index(int? id) { return View(); } If I execute this code in VS 2010 / MVC 2.0 I always get this error: A potentially dangerous Request.Form value was detected from the client (body=""). Any ideas?

    Read the article

  • Postgresql count+sort performance

    - by invictus
    I have built a small inventory system using postgresql and psycopg2. Everything works great, except, when I want to create aggregated summaries/reports of the content, I get really bad performance due to count()'ing and sorting. The DB schema is as follows: CREATE TABLE hosts ( id SERIAL PRIMARY KEY, name VARCHAR(255) ); CREATE TABLE items ( id SERIAL PRIMARY KEY, description TEXT ); CREATE TABLE host_item ( id SERIAL PRIMARY KEY, host INTEGER REFERENCES hosts(id) ON DELETE CASCADE ON UPDATE CASCADE, item INTEGER REFERENCES items(id) ON DELETE CASCADE ON UPDATE CASCADE ); There are some other fields as well, but those are not relevant. I want to extract 2 different reports: - List of all hosts with the number of items per, ordered from highest to lowest count - List of all items with the number of hosts per, ordered from highest to lowest count I have used 2 queries for the purpose: Items with host count: SELECT i.id, i.description, COUNT(hi.id) AS count FROM items AS i LEFT JOIN host_item AS hi ON (i.id=hi.item) GROUP BY i.id ORDER BY count DESC LIMIT 10; Hosts with item count: SELECT h.id, h.name, COUNT(hi.id) AS count FROM hosts AS h LEFT JOIN host_item AS hi ON (h.id=hi.host) GROUP BY h.id ORDER BY count DESC LIMIT 10; Problem is: the queries runs for 5-6 seconds before returning any data. As this is a web based application, 6 seconds are just not acceptable. The database is heavily populated with approximately 50k hosts, 1000 items and 400 000 host/items relations, and will likely increase significantly when (or perhaps if) the application will be used. After playing around, I found that by removing the "ORDER BY count DESC" part, both queries would execute instantly without any delay whatsoever (less than 20ms to finish the queries). Is there any way I can optimize these queries so that I can get the result sorted without the delay? I was trying different indexes, but seeing as the count is computed it is possible to utilize an index for this. I have read that count()'ing in postgresql is slow, but its the sorting that are causing me problems... My current workaround is to run the queries above as an hourly job, putting the result into a new table with an index on the count column for quick lookup. I use Postgresql 9.2.

    Read the article

  • Rails in production environment not working,but it's working in development environment

    - by user1834759
    An ActionView::Template::Error occurred in posts#index: couldn't find file 'jquery' (in /opt/ruby_apps/bookdate-website/app/assets/javascripts/cpanel_app.coffee:1) sprockets (2.1.3) lib/sprockets/context.rb:100:in `resolve' An ActionView::Template::Error occurred in topics#show: cannot load such file -- html/tokenizer actionpack (3.2.8) lib/action_controller/vendor/html-scanner/html/sanitizer.rb:18:in `tokenize' sometimes there is an exception thrown like the one mentioned above,but sometime it works why? my ruby environment is ruby 1.9.3p194 (2012-04-20 revision 35410) [x86_64-linux] Rails 3.2.8

    Read the article

  • JQuery Datepicker Date highlight Issue

    - by Isola Olufemi
    I have an in-line date picker in which I want to highlight some dates based on array of strings from the server side. I found out the on load of the page with the datepicker, events the matches in the current month will not be highlighted. when I click the next month button the events on the next moth will be highlighted. What I discovered that i the matching only get highlighted when I click to the next month and not when I click back to the previous month. Below is my script: var actionCalDates = new Array(); function getDates(month, year) { $.ajax({ url: "/Index/GetAllAlerts", data: { month: month, year: year }, success: function (result) { var date = new Date(); var i = new Number(date.getMonth()); i += 1; actionCalDates = result.split(","); } }); } function getTitle(ar, d) { var result = ""; for (var i = 0; i < ar.length; i++) { if (ar[i].indexOf(d) != -1) { var e = actionCalDates[i].split(";"); result += e[0] + "\n"; } } return result; } $('#calendar').datepicker({ numberOfMonths: [1, 1], showCurrentAtPos: 0, dateFormat: 'dd/mm/y', beforeShowDay: function (thedate) { var theday = thedate.getDate(); var x = new Number(thedate.getMonth()); x += 1; var date = thedate.getDate() + "/" + x + "/" + thedate.getFullYear(); getDates(x, thedate.getFullYear()); for (var i = 0; i < actionCalDates.length; i++) { var entry = actionCalDates[i].split(";"); if (date == entry[1]) { return [true, "highlight", getTitle(actionCalDates, date)]; } } return [true, "", ""]; }, onChangeMonthYear: function (year, month, inst) { getDates(month, year); }, onSelect: function (d, instance) { $.ajax({ url: '/Index/AlertConvertDate', datatype: 'text', data: { dateString: d }, error: function (xhr, ajaxOptions, thrownError) { alert(xhr.statusText); alert(thrownError); }, success: function (data) { window.SetHomeContent(data); } }); } }); Please can someone point out where I went wrong? Thank you all.

    Read the article

  • How to add new object to an IList mapped as a one-to-many with NHibernate?

    - by Jørn Schou-Rode
    My model contains a class Section which has an ordered list of Statics that are part of this section. Leaving all the other properties out, the implementation of the model looks like this: public class Section { public virtual int Id { get; private set; } public virtual IList<Static> Statics { get; private set; } } public class Static { public virtual int Id { get; private set; } } In the database, the relationship is implemented as a one-to-many, where the table Static has a foreign key pointing to Section and an integer column Position to store its index position in the list it is part of. The mapping is done in Fluent NHibernate like this: public SectionMap() { Id(x => x.Id); HasMany(x => x.Statics).Cascade.All().LazyLoad() .AsList(x => x.WithColumn("Position")); } public StaticMap() { Id(x => x.Id); References(x => x.Section); } Now I am able to load existing Statics, and I am also able to update the details of those. However, I cannot seem to find a way to add new Statics to a Section, and have this change persisted to the database. I have tried several combinations of: mySection.Statics.Add(myStatic) session.Update(mySection) session.Save(myStatic) but the closest I have gotten (using the first two statements), is to an SQL exception reading: "Cannot insert the value NULL into column 'Position'". Clearly an INSERT is attempted here, but NHibernate does not seem to automatically append the index position to the SQL statement. What am I doing wrong? Am I missing something in my mappings? Do I need to expose the Position column as a property and assign a value to it myself? EDIT: Apparently everything works as expected, if I remove the NOT NULL constraint on the Static.Position column in the database. I guess NHibernate makes the insert and immediatly after updates the row with a Position value. While this is an anwers to the question, I am not sure if it is the best one. I would prefer the Position column to be not nullable, so I still hope there is some way to make NHibernate provide a value for that column directly in the INSERT statement. Thus, the question is still open. Any other solutions?

    Read the article

  • Configuration tools for multiple monitors for X / Linux

    - by richard
    I have Ubuntu 10.04 running gnome and two monitors. I am wondering if a can get a better multi-monitor configuration tool. The one I have, gnome-display-properties, has too many problems, including: when I swapped my monitors over, the narrower one now on the left. There is a width calculation error, such that I have a virtual monitor the width of the wide-monitor on the narrow-monitor and part of the wide monitor. And a virtual narrow-monitor on the remainder of the wide-monitor. I would like: nobugs. to be able to select which is primary monitor. to have multiple configurations. configurations to be automatically selected based on which monitors are attached. configurations to be cycled (reliably) when display mode key is pressed. when a display is deactivated, for windows to migrate to remaining monitors. option to not change display resolution when mirroring, but to use side/top blanking bars to pad out screen.

    Read the article

  • Need to detect the same application open on another computer on the network. Any software around tha

    - by Joe Schmoe
    I have a time management application that I use at home quite a lot and have running most of the time. At home, I have a desktop PC and a couple of laptops scattered around the house...all networked together. Unfortunately, the application I use is not multi-user and I risk losing/corrupting data if it has been left running on one computer inadvertently while I start using it on another one in another part of the house. I use Live Mesh to automatically keep the application's database synced across the different computers and I just need some way of making sure that I don't start using the application on another computer before closing it down on the previous one. Anyone know of any Windows software that can detect if an application is running simultaneously on different computers on my network, and warn me if I am about to have two open at the same time?

    Read the article

  • Position of object in database

    - by fl00r
    Hi! I have got model Team and I've got (i.e.) team = Team.first :offset => 20. Now I need to get number of position of my team in db table. I can do it in ruby: Team.all.index team #=> 20 But I am sure that I can write it on SQL and it will be less expensive for me with big tables.

    Read the article

  • google maps marker draggable doesn't work

    - by ArmenGrigoryan
    I try all methods but in my google map on the marker doesn't work events, I try enable events and write (clickable: true), but it did not help, in test server working good, but on phpfox marker not clickable, help me please correct it go to it http://iguansystems.com/phpfoxdev/index.php?do=/pages/24/quickstart/step2/ link login - [email protected], and pass- tryuser in center frontend right at "Primary Venue" have "Can't find venue? Add New" click on "Add New" and window with a map open

    Read the article

  • Deploy .net MVC 2 appication on IIS6

    - by munish
    I want to deploy my .net MVC 2 appication on IIS6.0. Will it require to change route path in global.asax file. In my application i have used html link, ajax request and Html.ActionLink. The code lines in the Global.asax file are: routes.MapRoute( "LogOn", "{controller}/{action}/{id}", new { controller = "Account", action = "Index", id = UrlParameter.Optional } ); Please suggest me. Thanks and Regards Munish

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • File storage service that allows clients to upload large files to my account?

    - by deceze
    Can anyone recommend an online file storage service which fulfills these requirements? I can create an account I can invite clients to upload files into my account clients do not need to register to be able to upload clients must not be able to see anything but their own files or they must not see any files at all, they get only a dropbox only I can access the uploaded files, everything is non-public service is multi-lingual I just need clients to be able to send me potentially large files in a dead simple manner online, that's all. No registration step to go through, no software to download, no synching or sharing. No setting up of individual folders and permissions for each individual client. No copying and pasting of links (a la Mediafire, Rapidshare etc).

    Read the article

  • Can I Do a Foreach on a TimeSpan by Timespan Type?

    - by IPX Ares
    I have a requirement that regardless of the start and dates that I need to loop through that timespan and calculate figures at the month level. I cannot seem to figure it out, and maybe it is not possible, but I would like to do something like: FOREACH Month As TimeSpan in ContractRange.Months Do Calculations (Month.Start, Month.End) NEXT Is this possible or do I need to calculate the number of months, and just iterate through the amount of months and calculate the start/end of that month based on my index?

    Read the article

  • Question regarding MySQL indices and their functionality

    - by user281434
    Hi Say I have an ordinary table in my db like so ---------------------------- | id | username | password | ---------------------------- | 24 | blah | blah | ---------------------------- A primary key is assigned to the id column. Now when I run a Mysql query like this: SELECT id FROM table WHERE username = 'blah' LIMIT 1 Does that primary key index even help? If I am telling it to match usernames, then shouldn't the username column be indexed instead? Thanks for your time

    Read the article

  • <object> for PDF is blocking drop-down menu

    - by Tumharyyaaden
    URL: http://hartford.uconn.edu/director/academic_plan.html It is an HTML page, and using to display PDF document. Which is blocking the jQuery drop down menu. I have tried using CSS z-index property with positioning specified. Also tried setting wmode="transparent" / wmode="opaque" / and other variations but nothing seems to work.

    Read the article

  • Supporting Piping (A Useful Hello World)

    - by blastthisinferno
    I am trying to write a collection of simple C++ programs that follow the basic Unix philosophy by: Make each program do one thing well. Expect the output of every program to become the input to another, as yet unknown, program. I'm having an issue trying to get the output of one to be the input of the other, and getting the output of one be the input of a separate instance of itself. Very briefly, I have a program add which takes arguments and spits out the summation. I want to be able to pipe the output to another add instance. ./add 1 2 | ./add 3 4 That should yield 6 but currently yields 10. I've encountered two problems: The cin waits for user input from the console. I don't want this, and haven't been able to find a simple example showing a the use of standard input stream without querying the user in the console. If someone knows of an example please let me know. I can't figure out how to use standard input while supporting piping. Currently, it appears it does not work. If I issue the command ./add 1 2 | ./add 3 4 it results in 7. The relevant code is below: add.cpp snippet // ... COMMAND LINE PROCESSING ... std::vector<double> numbers = multi.getValue(); // using TCLAP for command line parsing if (numbers.size() > 0) { double sum = numbers[0]; double arg; for (int i=1; i < numbers.size(); i++) { arg = numbers[i]; sum += arg; } std::cout << sum << std::endl; } else { double input; // right now this is test code while I try and get standard input streaming working as expected while (std::cin) { std::cin >> input; std::cout << input << std::endl; } } // ... MORE IRRELEVANT CODE ... So, I guess my question(s) is does anyone see what is incorrect with this code in order to support piping standard input? Are there some well known (or hidden) resources that explain clearly how to implement an example application supporting the basic Unix philosophy? @Chris Lutz I've changed the code to what's below. The problem where cin still waits for user input on the console, and doesn't just take from the standard input passed from the pipe. Am I missing something trivial for handling this? I haven't tried Greg Hewgill's answer yet, but don't see how that would help since the issue is still with cin. // ... COMMAND LINE PROCESSING ... std::vector<double> numbers = multi.getValue(); // using TCLAP for command line parsing double sum = numbers[0]; double arg; for (int i=1; i < numbers.size(); i++) { arg = numbers[i]; sum += arg; } // right now this is test code while I try and get standard input streaming working as expected while (std::cin) { std::cin >> arg; std::cout << arg << std::endl; } std::cout << sum << std::endl; // ... MORE IRRELEVANT CODE ...

    Read the article

  • Android Soft Keyboard value using array

    - by Shubh
    Hi friends, Yet I use Soft Keyboard sample from http://developer.android.com/resources/samples/SoftKeyboard/index.html Here we uses ASCII value from XML ,now at the place of XML I want to generate these value using array. How can I do this Thanks in Advance

    Read the article

  • How can write a mod_rewrite rule to determine if the domain is not the main domain then change https:// to http://

    - by Oudin
    I've set up a WordPress multi-site with a wildcard ssl for example.com to access the admin area securely. However I'm also using domain mapping to map other domains to other sites e.g. alldogs.com to alldogs.example.com. The problem is when I'm trying to access the front end of a site from and admin for a mapped domain e.g. alldogs.com by clicking "Visit Site" the Link goes to https://alldogs.com because of the forced ssl applied to the admin area. Which produces a certificate warning since the certificate is for example.com and not alldogs.com. How can write a mod_rewrite rule to determine if the url/link clicked on is not the main domain e.g. example.com then change the https:// to http:// so the site can be accessed via port 80 and not generate a certificate warning for that mapped domains

    Read the article

  • Using .htaccess to force https on all requests in Zend MVC

    - by davykiash
    I have been battling with .htaccess to get all the requests to use https on my Zend MVC. What am seeing is that SSL turns "on" and then goes "off" as the page loads. Below is my .htaccess file. SetEnv APPLICATION_ENV production RewriteEngine On RewriteCond %{REQUEST_FILENAME} -s [OR] RewriteCond %{REQUEST_FILENAME} -l [OR] RewriteCond %{REQUEST_FILENAME} -d RewriteRule ^.*$ - [NC,L] RewriteRule ^.*$ index.php [NC,L] RewriteEngine On RewriteCond %{HTTPS} off RewriteRule (.*) https://%{HTTP_HOST}%{REQUEST_URI} What do I need to adjust to get my https working properly?

    Read the article

  • How to replace the deprecated csc ant task

    - by GrGr
    I have a mixed Java / C# project and use an ant script that contains a csc task to compile the dll. This works, but I get a warning [csc] This task is deprecated and will be removed in a future version [csc] of Ant. It is now part of the .NET Antlib: [csc] http://ant.apache.org/antlibs/dotnet/index.html How can I replace the csc task? I can surely create an exec task calling nant with a project.build file, but that feels completely wrong.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 382 383 384 385 386 387 388 389 390 391 392 393  | Next Page >