Search Results

Search found 24073 results on 963 pages for 'mount point'.

Page 389/963 | < Previous Page | 385 386 387 388 389 390 391 392 393 394 395 396  | Next Page >

  • Converting JBOSS annotations to xml

    - by sixtyfootersdude
    Good Morning, I was just hoping that someone could point me to a reference that defines about what JBOSS annotations are equivalent to what xml tags. I am particularly interested in these tags: @WebContext in org.jboss.ws.annotation.WebContext and @SecurityDomain in org.jboss.annotation.security.SecurityDomain

    Read the article

  • Memory Leak from Foundation & CFNetwork Library

    - by Lakshmie
    I am using instruments to resolve memory leak issues for an app in iPhone. I just wanted to know if I have to resolve the leaks coming from Foundation and CFNetwork Libraries. Specifically, the leaks are from: 1. NSCFString 2. NSConcreteData 3. General Block-3584 Since they do not directly point to the code that I have written, how should I resolve them, if I have to? Thanks.

    Read the article

  • sandboxed web parts inside SharePoint 2010

    - by vrajaraman
    Is it possible to develop a web-part in ASP.NET (framework 2.0), to have a sandbox architecture, and deploy those web parts inside Share Point 2010 and/or MOSS 2007 we donot want to use any SharePoint dll reference with web parts we develop. we refer to the url, section at http://msdn.microsoft.com/en-us/library/ee539417.aspx (section Web Parts in Sandboxed Solutions)

    Read the article

  • Simple 3D Editor/Viewer

    - by mnn
    I'm looking for an application, which could be able to load bunch of points in space, render them and be able to simple 3D operations (select such point, rotate & move viewport). The source has to be available, as I want to use it as basis for my own application.

    Read the article

  • RAD Visual Web Application Creator/ Builder/ Designer for PHP

    - by inhoue
    Hi all, I want to see if any of you know a (free and open source will be ideal) tool/ app that can help build a php web application very quickly without investing too much time on writing codes, preferring drag and drop/ point and click work-flow designer for logic design (see Agile from Outsystems below). Plus, visual designer for the business logic is great since it can help a developer visualize the logic better. There are a lot of GUI builders, form builders out there, but I am looking for one app for the entire web application development process. My goal is to find an application that a team of developers can use together and use the build-in code of the app as much as possible. E.g. the app will provide a modular just for handle user login or a shopping cart; a developer just need to drag and drop the modular to the logic designer and the code will be generated. This way the functionality will be in a module and code will always be standard across developers. So if a new developer get on-board, he will just need to use the system and get up and running quickly. To explain this better: there is a lot php frameworks, e.g. cakephp, CodeIgniter, etc which I can use to help coding, but still I need to create (code) the GUI, writing quite a bit of codes. I am looking for a tool/ app that is a little more high level than those frameworks. Here is 2 examples apps I found during my google search which they have visual logic designer and gui builder in one single app. Also a single click deployment (but I need it to be php apps or at least I can deploy the (php) code to a LAMP/ WAMP server): Wavemaker: for JAVA Agile from Outsystems: for JAVA or .net (This one is really good, with work-flow drag and drop logic designer!) Talend: it is just an ETL tool, but the concept is what I want to bring up. Drag and drop, point and click logic design. Custom code can be added if it is needed, but the drag and drop process already finished the structure and most of the coding of the web app one needs to build. I want to list Adobe Flex, but it is more like a GUI designer + IDE, not exactly what I want to describe here. The drag and drop/ work-flow logic designer is a key for the app. I could go for the CMS route by learning how to extend them, but it is not that flexible for me and is a long learning curve. Anybody came across this type of app before? Or any idea of how can I find those apps? I googled them for long time, I don't see any of them for php and just few (just 2) for Java. Thanks in advance!

    Read the article

  • How to Create Own HashMap in Java?

    - by Taranfx
    I know about hashing algorithm and hashCode() to convert "key" into an equivalent integer (using some mathematically random expression) that is then compressed and stored into buckets. But can someone point me to an implementation or at least data structure that should be used as baseline? I haven't found it anywhere on the web.

    Read the article

  • stock trade app help

    - by Rajesh Kumar Chandra
    Ok my last post disapper so I ask again. Ok if you cant send me code to stock trading app, i understand its dificult for to get code from forum can you point me to techonologies to use for making stock app. i got job from online brocker copany, they need to display both bombay exchange and others java, or c . or asp maybe thanks

    Read the article

  • c++ class member functions instatiated by traits

    - by Jive Dadson
    I am reluctant to say I can't figure this out, but I can't figure this out. I've googled and searched stackoverflow, and come up empty. The abstract, and possibly overly vague form of the question is, how can I use the traits-pattern to instantiate non-virtual member functions? The question came up while modernizing a set of multivariate function optimizers that I wrote more than 10 years ago. The optimizers all operate by selecting a straight-line path through the parameter space away from the current best point (the "update"), then finding a better point on that line (the "line search"), then testing for the "done" condition, and if not done, iterating. There are different methods for doing the update, the line-search, and conceivably for the done test, and other things. Mix and match. Different update formulae require different state-variable data. For example, the LMQN update requires a vector, and the BFGS update requires a matrix. If evaluating gradients is cheap, the line-search should do so. If not, it should use function evaluations only. Some methods require more accurate line-searches than others. Those are just some examples. The original version instantiates several of the combinations by means of virtual functions. Some traits are selected by setting mode bits that are tested at runtime. Yuck. It would be trivial to define the traits with #define's and the member functions with #ifdef's and macros. But that's so twenty years ago. It bugs me that I cannot figure out a whiz-bang modern way. If there were only one trait that varied, I could use the curiously recurring template pattern. But I see no way to extend that to arbitrary combinations of traits. I tried doing it using boost::enable_if, etc.. The specialized state info was easy. I managed to get the functions done, but only by resorting to non-friend external functions that have the this-pointer as a parameter. I never even figured out how to make the functions friends, much less member functions. The compiler (vc++ 2008) always complained that things didn't match. I would yell, "SFINAE, you moron!" but the moron is probably me. Perhaps tag-dispatch is the key. I haven't gotten very deeply into that. Surely it's possible, right? If so, what is best practice?

    Read the article

  • What would you suggest as a high school first language?

    - by ldigas
    Edit by OA: After reading some answers I'll just update the question a little. At first I put it a little bluntly, but some of those gave me some good arguments which have to be taken into consideration while making a stand on this one. (these are mostly picked up from comments and answers below). A few things to take into account: to many pupils this is a first programming language - at this stage most of them have trouble grasping a difference between data types, variable passing, ... and whatnot, less alone pointers and similar 'low level stuff' :) they will all have to pass this to get into next grade (well, big majority of them anyway) not all of them have computers at home, not all of them are willing to learn this, less alone interested in - so the concepts have to be taught on a finite time scale in school hours (as well as practice on computers) free literature is a bonus - the teacher will make some scripts and handaways, but still ... I wouldn't like to bear the parents with the burden of buying expensive literature (also, english is not a native language here ... and although they are all learning it, their ability to read it fluently is somewhat questionable) somebody gave an argument - "a language which does not get in the way of ideas" - good one accessibility on different platforms in not expecially important at this point - although most of the suggested ones are available on win as well as linux - not many macs in this part of europe (their prices are sky high for anything but specialised usage) I will check what are the licencing issues on ms express editions about using it massively in high schools for purposes like this - if someone has any info about this, please, do not be shy with it :) A friend of mine, informatics teacher - in EU it comes as something as junior cs teacher, in a local high school asked me what I thought about what should be the first language pupils should be taught? It is a technical school (a little more oriented towards mathematics than the gymnasium, but not computer oriented totally). So I'm asking you - what do you think should be the first language pupils are exposed to in highschool? They have been teaching Pascal so far, but she's not sure that's a good course. She thought about switching to C (which I resented; considering not all pupils have interests in programming, to start with, and should be taught something higher level since they are just gripping the idea of a loop and such ... for a start), I suggested python or ruby (preferably py since it handles all paradigms). What is your opinion on this one? I looked, but didn't find a similar question on SO, so if there is one, please just point me towards it. Edit: The assumption is that none of the pupils have been exposed to any programming in junior school. See also: What is the best way to teach young kids some basic programming concepts? Best ways to teach a beginner to program How and when do you teach a kid to code What is the easiest language to start with? High School Programming

    Read the article

  • Do Qt Applications require KDE?

    - by Evans
    Do all Qt applications require KDE to be installed? Is it enough if the Qt runtime is installed along with GNOME? Can I make a Qt application look exactly like a GTK application under GNOME? Could anyone please point me to some article detailing the relationship between Qt, GTK, KDE, GNOME, X?

    Read the article

  • Design patterns and interview question

    - by user160758
    When I was learning to code, I read up on the design patterns like a good boy. Long after this, I started to actually understand them. Design discussions such as those on this site constantly try to make the rules more and more general, which is good. But there is a line, over which it becomes over-analysis starts to feed off itself and as such I think begins to obfuscate the original point - for example the "What's Alternative to Singleton" post and the links contained therein. http://stackoverflow.com/questions/1300655/whats-alternative-to-singleton I say this having been asked in both interviews I’ve had over the last 2 weeks what a singleton is and what criticisms I have of it. I have used it a few times for items such as user data (simple key-value eg. last file opened by this user) and logging (very common i'm sure). I've never ever used it just to have what is essentially global application data, as this is clearly stupid. In the first interview, I reply that I have no criticisms of it. He seemed disappointed by this but as the job wasn’t really for me, I forgot about it. In the next one, I was asked again and, as I wanted this job, I thought about it on the spot and made some objections, similar to those contained in the post linked to above (I suggested use of a factory or dependency injection instead). He seemed happy with this. But my problem is that I have used the singleton without ever using it in this kind of stupid way, which I had to describe on the spot. Using it for global data and the like isn’t something I did then realised was stupid, or read was stupid so didn’t do, it was just something I knew was stupid from the start. Essentially I’m supposed to be able to think of ways of how to misuse a pattern in the interview? Which class of programmers can best answer this question? The best ones? The medium ones? I'm not sure.... And these were both bright guys. I read more than enough to get better at my job but had never actually bothered to seek out criticisms of the most simple of the design patterns like this one. Do people think such questions are valid and that I ought to know the objections off by heart? Or that it is reasonable to be able to work out what other people who are missing the point would do on the fly? Or do you think I’m at least partially right that the question is too unsubtle and that the questions ought to be better thought out in order to make sure only good candidates can answer. PS. Please don’t think I’m saying that I’m just so clever that I know everything automatically - I’ve learnt the hard way like everyone else. But avoiding global data is hardly revolutionary.

    Read the article

  • Writing a Python extension in Go (golang)

    - by tehwalrus
    I currently use Cython to link C and Python, and get speedup in slow bits of python code. However, I'd like to use go routines to implement a really slow (and very parallelizable) bit of code, but it must be callable from python. (I've already seen this question) I'm (sort of) happy to go via C (or Cython) to set up data structures etc if necessary, but avoiding this extra layer would be good from a bug fix/avoidance point of view. What is the simplest way to do this without having to reinvent any wheels?

    Read the article

  • C#: Drawing only a portion of a path

    - by John
    I have a series of points in a GraphicsPath; for our purpose lets assume its the outline of an uppercase B. I want to be able to be able to draw only the bottom portion that would resemble an uppercase L. I'd like to be able to select a window of points from the GraphicsPath. Is there a handy way to do this without doing point interpolation?

    Read the article

  • Lisp data security/validation

    - by Wayne Werner
    This is really just a conceptual question for me at this point. In Lisp, programs are data and data are programs. The REPL does exactly that - reads and then evaluates. So how does one go about getting input from the user in a secure way? Obviously it's possible - I mean viaweb - now Yahoo!Stores is pretty secure, so how is it done?

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • approximating log10[x^k0 + k1]

    - by Yale Zhang
    Greetings. I'm trying to approximate the function Log10[x^k0 + k1], where .21 < k0 < 21, 0 < k1 < ~2000, and x is integer < 2^14. k0 & k1 are constant. For practical purposes, you can assume k0 = 2.12, k1 = 2660. The desired accuracy is 5*10^-4 relative error. This function is virtually identical to Log[x], except near 0, where it differs a lot. I already have came up with a SIMD implementation that is ~1.15x faster than a simple lookup table, but would like to improve it if possible, which I think is very hard due to lack of efficient instructions. My SIMD implementation uses 16bit fixed point arithmetic to evaluate a 3rd degree polynomial (I use least squares fit). The polynomial uses different coefficients for different input ranges. There are 8 ranges, and range i spans (64)2^i to (64)2^(i + 1). The rational behind this is the derivatives of Log[x] drop rapidly with x, meaning a polynomial will fit it more accurately since polynomials are an exact fit for functions that have a derivative of 0 beyond a certain order. SIMD table lookups are done very efficiently with a single _mm_shuffle_epi8(). I use SSE's float to int conversion to get the exponent and significand used for the fixed point approximation. I also software pipelined the loop to get ~1.25x speedup, so further code optimizations are probably unlikely. What I'm asking is if there's a more efficient approximation at a higher level? For example: Can this function be decomposed into functions with a limited domain like log2((2^x) * significand) = x + log2(significand) hence eliminating the need to deal with different ranges (table lookups). The main problem I think is adding the k1 term kills all those nice log properties that we know and love, making it not possible. Or is it? Iterative method? don't think so because the Newton method for log[x] is already a complicated expression Exploiting locality of neighboring pixels? - if the range of the 8 inputs fall in the same approximation range, then I can look up a single coefficient, instead of looking up separate coefficients for each element. Thus, I can use this as a fast common case, and use a slower, general code path when it isn't. But for my data, the range needs to be ~2000 before this property hold 70% of the time, which doesn't seem to make this method competitive. Please, give me some opinion, especially if you're an applied mathematician, even if you say it can't be done. Thanks.

    Read the article

  • Visual Studio: Where are global settings stored?

    - by Philipp
    Hi, sometimes after logging out and in again, my settings in Tools/Options/Projects and Solutions/VC++ Directories are lost. To investigate the problem I tried to find the file where Visual Studio (2008 Team) stores those settings on disk. (Or is it in the registry?) Can anybody point me to where it is? Thanks a lot!

    Read the article

  • WPF: How to programmatically utilize the ErrorTemplate of an Control?

    - by geeraija
    Hi, is there a way to programmatically set and remove the ErrorTemplate of an Control without the whole Validation mechanism? Basically, what I'd like to do, is to retrieve the ErrorTemplate of an Control at some point like this: ControlTemplate errTemplate = Validation.GetErrorTemplate(myTxtBx); and temporarily use it as it's ControlTemplate like this: myTxtBx.Template = errTemplate; Can you somehow do this?

    Read the article

  • Mail attachement on iPhone

    - by Infinity
    Hello guys! Is there a way to get the attachements from the Mail app on the iPhone? I've seen some apps which can do it. But how? Can you point me on the right way? I was trying with the MessageUI, but I don't think it is the right way.

    Read the article

  • "For money, always decimal" ???

    - by Dryadwoods
    Well, the rule "For money, always decimal" isn't applied inside the Microsoft development team, because if it was: Namespace: Microsoft.VisualBasic Assembly: Microsoft.VisualBasic (in Microsoft.VisualBasic.dll) Financial.IPmt and all the other methods would receive/return decimal and not double as it is. Now I wonder if I can use this methods without worry with round mistakes? Should I use some other libraries to work with finances? If yes, could you point me some good ones (for C# use) ? Thank you.

    Read the article

  • mixing OpenGL and Interface Builder/ UI Controls - bad idea? Why? (iPhone)

    - by Adam
    I've heard that OpenGL ES and standard iPhone UI controls don't play well together, but I'm wondering if anyone knows why, and what the effects are? I'm writing an OpenGL based game, and the view is loaded from a nib file with ui controls, and it seems to work ok, but the game is really simple at this point... does using ui controls cause some kind of performance hit?

    Read the article

  • Effect of 'myObj = [[[[MyClass alloc] init] autorelease] retain];'?

    - by filipe
    I've just downloaded the Facebook iOS SDK and I noticed that in the sample code that comes with the SDK whenever it creates an instance of the Facebook class it does it like this: _facebook = [[[[Facebook alloc] init] autorelease] retain]; where _facebook is a member variable of the calling object (i.e. not a local variable). Can anyone explain exactly what's the point of autoreleasing and then retaining it?

    Read the article

  • How to create entities in one Entity group ?

    - by Gopi
    I am building an app based on google app engine (Java) using JDO for persistence. Can someone give me an example or a point me to some code which shows persisting of multiple entities (of same type) using javax.jdo.PersistenceManager.makePersistentAll() within a transaction. Basically I need to understand how to put multiple entites in one Entity Group so that they can be saved using makePersistentAll() inside transaction.

    Read the article

< Previous Page | 385 386 387 388 389 390 391 392 393 394 395 396  | Next Page >