Search Results

Search found 10417 results on 417 pages for 'large'.

Page 39/417 | < Previous Page | 35 36 37 38 39 40 41 42 43 44 45 46  | Next Page >

  • handling large arrays with array_diff

    - by bigmac
    I have been trying to compare two arrays. Using array_intersect presents no problems. When using array_diff and arrays with ~5,000 values, it works. When I get to ~10,000 values, the script dies when I get to array_diff. Turning on error_reporting did not produce anything. I tried creating my own array_diff function: function manual_array_diff($arraya, $arrayb) { foreach ($arraya as $keya => $valuea) { if (in_array($valuea, $arrayb)) { unset($arraya[$keya]); } } return $arraya; } source: http://stackoverflow.com/questions/2479963/how-does-array-diff-work I would expect it to be less efficient that than the official array_diff, but it can handle arrays of ~10,000. Unfortunately, both array_diffs fail when I get to ~15,000. I tried the same code on a different machine and it runs fine, so it's not an issue with the code or PHP. There must be some limit set somewhere on that particular server. Any idea how I can get around that limit or alter it or just find out what it is?

    Read the article

  • Efficient paging with large tables in sql 2008

    - by Kumar
    for tables with 1,000,000 rows and possibly many many more ! haven't done any benchmarking myself so wanted to get the experts opinion. Looked at some articles on row_number() but it seems to have performance implications What are the other choices/alternatives ?

    Read the article

  • Large File Download - Connection With Server Reset

    - by daveywc
    I have an asp.net website that allows the user to download largish files - 30mb to about 60mb. Sometimes the download works fine but often it fails at some varying point before the download finishes with the message saying that the connection with the server was reset. Originally I was simply using Server.TransmitFile but after reading up a bit I am now using the code posted below. I am also setting the Server.ScriptTimeout value to 3600 in the Page_Init event. private void DownloadFile(string fname, bool forceDownload) { string path = MapPath(fname); string name = Path.GetFileName(path); string ext = Path.GetExtension(path); string type = ""; // set known types based on file extension if (ext != null) { switch (ext.ToLower()) { case ".mp3": type = "audio/mpeg"; break; case ".htm": case ".html": type = "text/HTML"; break; case ".txt": type = "text/plain"; break; case ".doc": case ".rtf": type = "Application/msword"; break; } } if (forceDownload) { Response.AppendHeader("content-disposition", "attachment; filename=" + name.Replace(" ", "_")); } if (type != "") { Response.ContentType = type; } else { Response.ContentType = "application/x-msdownload"; } System.IO.Stream iStream = null; // Buffer to read 10K bytes in chunk: byte[] buffer = new Byte[10000]; // Length of the file: int length; // Total bytes to read: long dataToRead; try { // Open the file. iStream = new System.IO.FileStream(path, System.IO.FileMode.Open, System.IO.FileAccess.Read, System.IO.FileShare.Read); // Total bytes to read: dataToRead = iStream.Length; //Response.ContentType = "application/octet-stream"; //Response.AddHeader("Content-Disposition", "attachment; filename=" + filename); // Read the bytes. while (dataToRead > 0) { // Verify that the client is connected. if (Response.IsClientConnected) { // Read the data in buffer. length = iStream.Read(buffer, 0, 10000); // Write the data to the current output stream. Response.OutputStream.Write(buffer, 0, length); // Flush the data to the HTML output. Response.Flush(); buffer = new Byte[10000]; dataToRead = dataToRead - length; } else { //prevent infinite loop if user disconnects dataToRead = -1; } } } catch (Exception ex) { // Trap the error, if any. Response.Write("Error : " + ex.Message); } finally { if (iStream != null) { //Close the file. iStream.Close(); } Response.Close(); } }

    Read the article

  • How do you refactor a large messy codebase?

    - by Ricket
    I have a big mess of code. Admittedly, I wrote it myself - a year ago. It's not well commented but it's not very complicated either, so I can understand it -- just not well enough to know where to start as far as refactoring it. I violated every rule that I have read about over the past year. There are classes with multiple responsibilities, there are indirect accesses (I forget the technical term - something like foo.bar.doSomething()), and like I said it is not well commented. On top of that, it's the beginnings of a game, so the graphics is coupled with the data, or the places where I tried to decouple graphics and data, I made the data public in order for the graphics to be able to access the data it needs... It's a huge mess! Where do I start? How would you start on something like this? My current approach is to take variables and switch them to private and then refactor the pieces that break, but that doesn't seem to be enough. Please suggest other strategies for wading through this mess and turning it into something clean so that I can continue where I left off!

    Read the article

  • Best Zend Framework architecture for large reporting site?

    - by Andy
    I have a site of about 60 tabular report pages. Want to convert this to Zend. The report has two states: empty report and filled in with data report. Each report has its own set of input boxes and select drop downs to narrow down searches. You click on submit and it retrieves the data. Thats all each page does. Do I create 60 controllers with each one with default index action and getData action? All I have read online do not really describe how to architect a real site.

    Read the article

  • WPF drawing performance with large numbers of geometries

    - by MyFaJoArCo
    Hello, I have problems with WPF drawing performance. There are a lot of small EllipseGeometry objects (1024 ellipses, for example), which are added to three separate GeometryGroups with different foreground brushes. After, I render it all on simple Image control. Code: DrawingGroup tmpDrawing = new DrawingGroup(); GeometryGroup onGroup = new GeometryGroup(); GeometryGroup offGroup = new GeometryGroup(); GeometryGroup disabledGroup = new GeometryGroup(); for (int x = 0; x < DisplayWidth; ++x) { for (int y = 0; y < DisplayHeight; ++y) { if (States[x, y] == true) onGroup.Children.Add(new EllipseGeometry(new Rect((double)x * EDGE, (double)y * EDGE, EDGE, EDGE))); else if (States[x, y] == false) offGroup.Children.Add(new EllipseGeometry(new Rect((double)x * EDGE, (double)y * EDGE, EDGE, EDGE))); else disabledGroup.Children.Add(new EllipseGeometry(new Rect((double)x * EDGE, (double)y * EDGE, EDGE, EDGE))); } } tmpDrawing.Children.Add(new GeometryDrawing(OnBrush, null, onGroup)); tmpDrawing.Children.Add(new GeometryDrawing(OffBrush, null, offGroup)); tmpDrawing.Children.Add(new GeometryDrawing(DisabledBrush, null, disabledGroup)); DisplayImage.Source = new DrawingImage(tmpDrawing); It works fine, but takes too much time - 0.5s on Core 2 Quad, 2s on Pentium 4. I need <0.1s everywhere. All Ellipses, how you can see, are equal. Background of control, where is my DisplayImage, is solid (black, for example), so we can use this fact. I tried to use 1024 Ellipse elements instead of Image with EllipseGeometries, and it was working much faster (~0.5s), but not enough. How to speed up it? Regards, Oleg Eremeev P.S. Sorry for my English.

    Read the article

  • Best practice to structure large html-based project

    - by AntonAL
    I develop Rails based website, enjoying using partials for some common "components" Recently, i faced a problem, that states with CSS interference. Styles for one component (described in css) override styles for another components. For example, one component has ... <ul class="items"> ... and another component has it too. But that ul's has different meaning in these two components. On the other hand, i want to "inherit" some styles for one component from another. For example: Let, we have one component, called "post" <div class="post"> <!-- post's stuff --> <ul class="items"> ... </ul> </div And another component, called "new-post": <div class="new-post"> <!-- post's stuff --> <ul class="items"> ... </ul> <!-- new-post's stuff --> <div class="tools">...</div> </div Post and new-post have something similar ("post's stuff") and i want to make CSS rules to handle both "post" and "new-post" New post has "subcomponents", for example - editing tools, that has also: <ul class="items"> This is where CSS rules starting to interfer - some rules, targeted for ul.items (in post and new-post) applies subcomponent of new-post, called "tools" On the one hand - i want to inherit some styles On the other hand, i want to get better incapsulation What are the best practices, to avoid such kind of problems ?

    Read the article

  • How to use R-Tree for plotting large number of map markers on google maps

    - by Eeyore
    After searching SO and multiple articles I haven't found a solution to my problem. What I am trying to achieve is to load 20,000 markers on Google Maps. R-Tree seems like a good approach but it's only helpful when searching for points within the visible part of the map. When the map is zoomed out it will return all of the points and...crash the browser. There is also the problem with dragging the map and at the end of dragging re-running the query. I would like to know how I can use R-Tree and be able to achieve the all of the above.

    Read the article

  • Does Python work in larger teams?

    - by Kugel
    I read this post last night and it got me thinking. I like python and "batteries", pypi and such. But I've only done python solo. Never tried it in a team. Are the points that Ted mentions valid? If they are how do teams cope with them? Does Python work in teams or even large teams? Or it kills productivity? I personally see the problems he mentions when I come back to my old code. Even when working with other modules sometimes I need to peek inside. I would like to hear people with experience on this.

    Read the article

  • Speeding up jQuery empty() or replaceWith() Functions When Dealing with Large DOM Elements

    - by Levi Hackwith
    Let me start off by apologizing for not giving a code snippet. The project I'm working on is proprietary and I'm afraid I can't show exactly what I'm working on. However, I'll do my best to be descriptive. Here's a breakdown of what goes on in my application: User clicks a button Server retrieves a list of images in the form of a data-table Each row in the table contains 8 data-cells that in turn each contain one hyperlink Each request by the user can contain up to 50 rows (I can change this number if need be) That means the table contains upwards of 800 individual DOM elements My analysis shows that jQuery("#dataTable").empty() and jQuery("#dataTable).replaceWith(tableCloneObject) take up 97% of my overall processing time and take on average 4 - 6 seconds to complete. I'm looking for a way to speed up either of the above mentioned jQuery functions when dealing with massive DOM elements that need to be removed / replaced. I hope my explanation helps.

    Read the article

  • Python 3.1 - Memory Error during sampling of a large list

    - by jimy
    The input list can be more than 1 million numbers. When I run the following code with smaller 'repeats', its fine; def sample(x): length = 1000000 new_array = random.sample((list(x)),length) return (new_array) def repeat_sample(x): i = 0 repeats = 100 list_of_samples = [] for i in range(repeats): list_of_samples.append(sample(x)) return(list_of_samples) repeat_sample(large_array) However, using high repeats such as the 100 above, results in MemoryError. Traceback is as follows; Traceback (most recent call last): File "C:\Python31\rnd.py", line 221, in <module> STORED_REPEAT_SAMPLE = repeat_sample(STORED_ARRAY) File "C:\Python31\rnd.py", line 129, in repeat_sample list_of_samples.append(sample(x)) File "C:\Python31\rnd.py", line 121, in sample new_array = random.sample((list(x)),length) File "C:\Python31\lib\random.py", line 309, in sample result = [None] * k MemoryError I am assuming I'm running out of memory. I do not know how to get around this problem. Thank you for your time!

    Read the article

  • Non standard interaction among two tables to avoid very large merge

    - by riko
    Suppose I have two tables A and B. Table A has a multi-level index (a, b) and one column (ts). b determines univocally ts. A = pd.DataFrame( [('a', 'x', 4), ('a', 'y', 6), ('a', 'z', 5), ('b', 'x', 4), ('b', 'z', 5), ('c', 'y', 6)], columns=['a', 'b', 'ts']).set_index(['a', 'b']) AA = A.reset_index() Table B is another one-column (ts) table with non-unique index (a). The ts's are sorted "inside" each group, i.e., B.ix[x] is sorted for each x. Moreover, there is always a value in B.ix[x] that is greater than or equal to the values in A. B = pd.DataFrame( dict(a=list('aaaaabbcccccc'), ts=[1, 2, 4, 5, 7, 7, 8, 1, 2, 4, 5, 8, 9])).set_index('a') The semantics in this is that B contains observations of occurrences of an event of type indicated by the index. I would like to find from B the timestamp of the first occurrence of each event type after the timestamp specified in A for each value of b. In other words, I would like to get a table with the same shape of A, that instead of ts contains the "minimum value occurring after ts" as specified by table B. So, my goal would be: C: ('a', 'x') 4 ('a', 'y') 7 ('a', 'z') 5 ('b', 'x') 7 ('b', 'z') 7 ('c', 'y') 8 I have some working code, but is terribly slow. C = AA.apply(lambda row: ( row[0], row[1], B.ix[row[0]].irow(np.searchsorted(B.ts[row[0]], row[2]))), axis=1).set_index(['a', 'b']) Profiling shows the culprit is obviously B.ix[row[0]].irow(np.searchsorted(B.ts[row[0]], row[2]))). However, standard solutions using merge/join would take too much RAM in the long run. Consider that now I have 1000 a's, assume constant the average number of b's per a (probably 100-200), and consider that the number of observations per a is probably in the order of 300. In production I will have 1000 more a's. 1,000,000 x 200 x 300 = 60,000,000,000 rows may be a bit too much to keep in RAM, especially considering that the data I need is perfectly described by a C like the one I discussed above. How would I improve the performance?

    Read the article

  • Indexing large DB's with Lucene/PHP

    - by thebluefox
    Afternoon chaps, Trying to index a 1.7million row table with the Zend port of Lucene. On small tests of a few thousand rows its worked perfectly, but as soon as I try and up the rows to a few tens of thousands, it times out. Obviously, I could increase the time php allows the script to run, but seeing as 360 seconds gets me ~10,000 rows, I'd hate to think how many seconds it'd take to do 1.7million. I've also tried making the script run a few thousand, refresh, and then run the next few thousand, but doing this clears the index each time. Any ideas guys? Thanks :)

    Read the article

  • Flex - weird display behavior on large number of Canvas

    - by itarato
    Hi, I have a Flex app (SDK 3.5 - FP10) that does mindmap trees. Every node is a Canvas (I'm using Canvas specific properties so I needed it). It has a shadow effect, background color and some small ui element on it (like icons, texts...). It works perfectly until it goes over ~700 nodes (Canvas). Over that number it shows grey rectangles: http://yfrog.com/bhw2pj . If I turn off the DropShadowFilter effect for the Canvas, they are also gone, so I assume it's a DropShadowFilter problem: http://yfrog.com/2d9y8j . The effect is simple: private static var _nodeDropShadow:DropShadowFilter = new DropShadowFilter(1, 45, 0x888888, 1, 1, 1); _backgroundComp.filters = _nodeDropShadow; Is it possible that Flex can't handle that much? Thanks in advance

    Read the article

  • Cache for large read only database recommendation

    - by paddydub
    I am building site on with Spring, Hibernate and Mysql. The mysql database contains information on coordinates and locations etc, it is never updated only queried. The database contains 15000 rows of coordinates and 48000 rows of coordinate connections. Every time a request is processed, the application needs to read all these coordinates which is taking approx 3-4 seconds. I would like to set up a cache, to allow quick access to the data. I'm researching memcached at the moment, can you please advise if this would be my best option?

    Read the article

  • Database for managing large volumes of (system) metrics

    - by symcbean
    Hi, I'm looking at building a system for managing and reporting stats on web page performance. I'll be collecting a lot more stats than are available in the standard log formats (approx 20 metrics) but compared to most types of database applications, the base data structure will be very simple. My problem is that I'll be accumulating a lot of data - in the region of 100,000 records (i.e. sets of metrics) per hour. Of course, resources are very limited! So that its possible to sensibly interact with the data, I'd need to consolidate each metric into one minute bins, broken down by URL, then for anything more than 1 day old, consolidated into 10 minute bins, then at 1 week, hourly bins. At the front end, I want to provide a view (prefereably as plots) of the last hour of data, with the facility for users to drill up/down through defined hierarchies of URLs (which do not always map directly to the hierarchy expressed in the path of the URL) and to view different time frames. Rather than coding all this myself and using a relational database, I was wondering if there were tools available which would facilitate both the management of the data and the reporting. I had a look at Mondrian however I can't see from the documentation I've looked at whether it's possible to drop the more granular information while maintaining the consolidated views of the data. RRDTool looks promising in terms of managing the data consolidation, but seems to be rather limited in terms of querying the dataset as a multi-dimensional/relational database. What else whould I be looking at?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Migrating from Physical SQL (SQL2000) To VMWare machine (SQL2008) - Transferring Large DB

    - by alex
    We're in the middle of migrating from a windows & SQL 2000 box to a Virtualised Win & SQL 2k8 box The VMWare box is on a different site, with better hardware, connectivity etc... The old(current) physical machine is still in constant use - I've taken a backup of the DB on this machine, which is 21GB Transfering this to our virtual machine took around 7+ hours - which isn't ideal when we do the "actual" switchover. My question is - How should I handle the migration better? Could i set up our current machine to do log shipping to the VM machine to keep up to date? then, schedule down time out of hours to do the switch over? Is there a better way?

    Read the article

  • Reverse massive text file in Java

    - by DanJanson
    What would be the best approach to reverse a large text file that is uploaded asynchronously to a servlet that reverses this file in a scalable and efficient way? text file can be massive (gigabytes long) can assume mulitple server/clustered environment to do this in a distributed manner. open source libraries are encouraged to consider I was thinking of using Java NIO to treat file as an array on disk (so that I don't have to treat the file as a string buffer in memory). Also, I am thinking of using MapReduce to break up the file and process it in separate machines. Any input is appreciated. Thanks. Daniel

    Read the article

  • bitshift large strings for encoding QR Codes

    - by icekreaman
    As an example, suppose a QR Code data stream contains 55 data words (each one byte in length) and 15 error correction words (again one byte). The data stream begins with a 12 bit header and ends with four 0 bits. So, 12 + 4 bits of header/footer and 15 bytes of error correction, leaves me 53 bytes to hold 53 alphanumeric characters. The 53 bytes of data and 15 bytes of ec are supplied in a string of length 68 (str68). The problem seems simple enough - concatenate 2 bytes of (right-shifted) header data with str68 and then left shift the entire 70 bytes by 4 bits. This is the first time in many years of programming that I have ever needed to do something like this, I am a c and bit shifting noob, so please be gentle... I have done a little investigation and so far have not been able to figure out how to bitshift 70 bytes of data; any help would be greatly appreciated. Larger QR codes can hold 2000 bytes of data...

    Read the article

  • Finding cause of memory leaks in large PHP stacks

    - by Mike B
    I have CLI script that runs over several thousand iterations between runs and it appears to have a memory leak. I'm using a tweaked version of Zend Framework with Smarty for view templating and each iteration uses several MB worth of code. The first run immediately uses nearly 8MB of memory (which is fine) but every following run adds about 80kb. My main loop looks like this (very simplified) $users = UsersModel::getUsers(); foreach($users as $user) { $obj = new doSomethingAwesome(); $obj->run($user); $obj = null; unset($obj); } The point is that everything in scope should be unset and the memory freed. My understanding is that PHP runs through its garbage collection process at it's own desire but it does so at the end of functions/methods/scripts. So something must be leaking memory inside doSomethingAwesome() but as I said it is a huge stack of code. Ideally, I would love to find some sort of tool that displayed all my variables no matter the scope at some point during execution. Some sort of symbol-table viewer for php. Does anything like that or any other tools that could help nail down memory leaks in php exist?

    Read the article

  • Large tables of static data with DBGhost

    - by Paulo Manuel Santos
    We are thinking of restructuring our database development and deployment processes by using DBGhost, we want to move away from the central development database and bring the database to the source control. One of the problems we have is a big table with static data (containing translated language strings), it has close to 200K rows. I know that our best solution is to move these stings into resource files, but until we implement that, will DbGhost be able to maintain all this static data and generate our development and deployment databases in a short time? And if not is there a good alternative to filling up this table whenever we need to?

    Read the article

  • Managing Large Database Entity Models

    - by ChiliYago
    I would like hear how other's are effectively (or not) working with the Visual Studio Entity Designer when many database tables exists. It seems to me that navigating the Designer is tough enough to find what you are looking for with just a few tables but how about a database with say 100 to 200 tables? When a table change is made at the database level how is the model updated? Does it overwrite any manual changes you have made to the model? How would you quickly find an entity in the designer to make a change or inspect a change? Seems unrealistic to be scrolling around looking for specific entity. Thanks for your feedback!

    Read the article

< Previous Page | 35 36 37 38 39 40 41 42 43 44 45 46  | Next Page >