Search Results

Search found 29682 results on 1188 pages for 'josh line'.

Page 393/1188 | < Previous Page | 389 390 391 392 393 394 395 396 397 398 399 400  | Next Page >

• Force NCover 1.5.8 to use v4 framework like testdriven.net does?

  - by Sam Holder

  I want to run coverage from the command line, but can't seem to get NCover 1.5.8 to instrument the code. It must be possible as when I run coverage tests with TestDriven.net it works. the difference seems to be that TD.NET is able to get NCover to use framework 4.0 (you get this in the log when it runs : MESSAGE: v4.0.30319) but from the command line I can't make it (I get this in the log : MESSAGE: v2.0.50727) So how can I make NCover play nice with nunit from the commandline, like it does with TD.NET?

  Read the article

• cutting a text file into multiple parts in emacs

  - by Gaurish Telang

  Hi I am using the GNU-Emacs-23 editor. I have this huge text file containing about 10,000 lines which I want to chop into multiple files. Using the mouse to select the required text to paste in another file is the really painful. Also this is prone to errors too. If I want to divide the text file according to the line numbers into say 4 file where first file:lines 1-2500 second file:lines 2500-5000 third file :lines 5000-7500 fourth file: lines: 7500-10000 how do I do this? At the very least, is there any efficient way to copy large regions of the file just by specifying line numbers

  Read the article

• DTD definition error

  - by Geln Yang

  Hi, It will get a error to define a dtd as follow: <!ELEMENT line (property*)> <!ATTLIST line showType (1|?|+|*) "1" > The error: The name token is required in the enumerated type list for the "showType" attribute declaration. It seems the value can't be special characters,such as "?","+","*". To change the characters to Latin-1 characters, like "& #42;"(add a blank before '#') , get the same error. How to resolve this problem? Thanks!

  Read the article

• Python - werid behavior

  - by orokusaki

  I've done what I shouldn't have done and written 4 modules (6 hours or so) without running any tests along the way. I have a method inside of /mydir/__init__.py called get_hash(), and a class inside of /mydir/utils.py called SpamClass. /mydir/utils.py imports get_hash() from /mydir/__init__. /mydir/__init__.py imports SpamClass from /mydir/utils.py. Both the class and the method work fine on their own but for some reason if I try to import /mydir/, I get an import error saying "Cannot import name get_hash" from /mydir/__init__.py. The only stack trace is the line saying that __init__.py imported SpamClass. The next line is where the error occurs in in SpamClass when trying to import get_hash. Why is this?

  Read the article

• Use matching value of a RegExp to name the output file.

  - by fx42

  I have this file "file.txt" which I want to split into many smaller ones. Each line of the file has an id field which looks like "id:1" for a line belonging to id 1. For each id in the file, I like to create a file named idid.txt and put all lines that belong to this id in that file. My brute force bash script solution reads as follows. count=1 while [ $count -lt 19945 ] do cat file.txt | grep "id:$count " >> ./sets/id$count.txt count='expr $count + 1' done Now this is very inefficient as I have do read through the file about 20.000 times. Is there a way to do the same operation with only one pass through the file? - What I'm probably asking for is a way to use the value that matches for a regular expression to name the associated output file.

  Read the article

• Why first arg to execve() must be path to executable

  - by EBM

  I understand that execve() and family require the first argument of its argument array to be the same as the executable that is also pointed to by its first argument. That is, in this: execve(prog, args, env); args[0] will usually be the same as prog. But I can't seem to find information as to why this is. I also understand that executables (er, at least shell scripts) always have their calling path as the first argument when running, but I would think that the shell would do the work to put it there, and execve() would just call the executable using the path given in its first argument ("prog" from above), then passing the argument array ("args" from above) as one would on the command line.... i.e., I don't call scripts on the command line with a duplicate executable path in the args list.... /bin/ls /bin/ls /home/john Can someone explain?

  Read the article

• Kerning problems when drawing text character by character

  - by shekel

  I'm trying to draw strings character by character to add lighting effects to shapes composed of text. while (i != line.length()) { c = line.substring(i, i + 1); cWidth = g.getFontMetrics().stringWidth(c); g.drawString(c, xx += cWidth, yy); i++; } The problem is, the width of a character isn't the actual distance it's drawn from another character when those two characters are printed as a string. Is there any way to get the correct distance in graphics2d?

  Read the article

• System.Diagnostics.Debugger.Debug() stopped working

  - by Andrew Miner

  I'm working on a program which uses the System.Diagnostics.Debugger.Break() method to allow the user to set a breakpoint from the command-line. This has worked fine for many weeks now. However, when I was working on fixing a unit test today, I tried to use the debug switch from the command-line, and it didn't work. Here's what I've tried: I've confirmed that the Debug() method is really being called (by putting a System.Console.WriteLine() after it) I've confirmed that the build is still in Debug I've done a clean build I've restarted Product Studio A quick Google search didn't reveal anything, and the API documentation for .Net doesn't mention anything about this function not performing correctly. So... any ideas?

  Read the article

• How do I do a join in ActiveRecord after records have been returned?

  - by Russ Bradberry

  I am using ActiveRecord in Rails 3 to pull data from two different tables in two different databases. These databases can not join on each other, but I have the need to do a simple join after-the-fact. I would like to preserve the relation so that I can chain it down the line. here is a simplified version of what I am doing browsers = Browser.all # <-- this is fairly small and can reside in memory events = Event.where(:row_date=>Date.today).select(:name, :browser_id) So as you can see, I want to join browsers in on the events relation, where browser_id should equal browsers.name. events is a relation and I can still add clauses to it down the line, so I dont want to run the query on the db just yet. How would I accomplish this?

  Read the article

• Cloning a selector + all its children in jQuery?

  - by HipHop-opatamus

  I'm having trouble getting the following JQuery script to function properly - its functionality is as follows: 1) Hide the content below each headline 2) Upon clicking a headline, substitute the "#first-post" with the headline + the hidden content below the headline. I can only seem to get the script to clone the headline itself to #first-post, not the headline + the content beneath it. Any idea why? <HTML> <HEAD> <script src="http://code.jquery.com/jquery-latest.js"></script> </HEAD> <script> $(document).ready( function(){ $('.title').siblings().hide(); $('.title').click( function() { $('#first-post').replaceWith($(this).closest(".comment").clone().attr('id','first-post')); $('html, body').animate({scrollTop:0}, 'fast'); return false; }); }); </script> <BODY> <div id="first-post"> <div class="content"><p>This is a test discussion topic</p> </div> </div> <div class="comment"> <h2 class="title"><a href="#1">1st Post</a></h2> <div class="content"> <p>this is 1st reply to the original post</p> </div> <div class="test">1st post second line</div> </div> <div class="comment"> <h2 class="title"><a href="#2">2nd Post</a></h2> <div class="content"> <p>this is 2nd reply to the original post</p> </div> <div class="test">2nd post second line</div> </div> </div> <div class="comment"> <h2 class="title"><a href="#3">3rd Post</a></h2> <div class="content"> <p>this is 3rd reply to the original post</p> </div> <div class="test">3rd post second line</div> </div> </div> </BODY> </HTML>

  Read the article

• Access violation using LocalAlloc()

  - by PaulH

  I have a Visual Studio 2008 Windows Mobile 6 C++ application that is using an API that requires the use of LocalAlloc(). To make my life easier, I created an implementation of a standard allocator that uses LocalAlloc() internally: /// Standard library allocator implementation using LocalAlloc and LocalReAlloc /// to create a dynamically-sized array. /// Memory allocated by this allocator is never deallocated. That is up to the /// user. template< class T, int max_allocations > class LocalAllocator { public: typedef T value_type; typedef size_t size_type; typedef ptrdiff_t difference_type; typedef T* pointer; typedef const T* const_pointer; typedef T& reference; typedef const T& const_reference; pointer address( reference r ) const { return &r; }; const_pointer address( const_reference r ) const { return &r; }; LocalAllocator() throw() : c_( NULL ) { }; /// Attempt to allocate a block of storage with enough space for n elements /// of type T. n>=1 && n<=max_allocations. /// If memory cannot be allocated, a std::bad_alloc() exception is thrown. pointer allocate( size_type n, const void* /*hint*/ = 0 ) { if( NULL == c_ ) { c_ = LocalAlloc( LPTR, sizeof( T ) * n ); } else { HLOCAL c = LocalReAlloc( c_, sizeof( T ) * n, LHND ); if( NULL == c ) LocalFree( c_ ); c_ = c; } if( NULL == c_ ) throw std::bad_alloc(); return reinterpret_cast< T* >( c_ ); }; /// Normally, this would release a block of previously allocated storage. /// Since that's not what we want, this function does nothing. void deallocate( pointer /*p*/, size_type /*n*/ ) { // no deallocation is performed. that is up to the user. }; /// maximum number of elements that can be allocated size_type max_size() const throw() { return max_allocations; }; private: /// current allocation point HLOCAL c_; }; // class LocalAllocator My application is using that allocator implementation in a std::vector< #define MAX_DIRECTORY_LISTING 512 std::vector< WIN32_FIND_DATA, LocalAllocator< WIN32_FIND_DATA, MAX_DIRECTORY_LISTING > > file_list; WIN32_FIND_DATA find_data = { 0 }; HANDLE find_file = ::FindFirstFile( folder.c_str(), &find_data ); if( NULL != find_file ) { do { // access violation here on the 257th item. file_list.push_back( find_data ); } while ( ::FindNextFile( find_file, &find_data ) ); ::FindClose( find_file ); } // data submitted to the API that requires LocalAlloc()'d array of WIN32_FIND_DATA structures SubmitData( &file_list.front() ); On the 257th item added to the vector<, the application crashes with an access violation: Data Abort: Thread=8e1b0400 Proc=8031c1b0 'rapiclnt' AKY=00008001 PC=03f9e3c8(coredll.dll+0x000543c8) RA=03f9ff04(coredll.dll+0x00055f04) BVA=21ae0020 FSR=00000007 First-chance exception at 0x03f9e3c8 in rapiclnt.exe: 0xC0000005: Access violation reading location 0x01ae0020. LocalAllocator::allocate is called with an n=512 and LocalReAlloc() succeeds. The actual Access Violation exception occurs within the std::vector< code after the LocalAllocator::allocate call: 0x03f9e3c8 0x03f9ff04 > MyLib.dll!stlp_std::priv::__copy_trivial(const void* __first = 0x01ae0020, const void* __last = 0x01b03020, void* __result = 0x01b10020) Line: 224, Byte Offsets: 0x3c C++ MyLib.dll!stlp_std::vector<_WIN32_FIND_DATAW,LocalAllocator<_WIN32_FIND_DATAW,512> >::_M_insert_overflow(_WIN32_FIND_DATAW* __pos = 0x01b03020, _WIN32_FIND_DATAW& __x = {...}, stlp_std::__true_type& __formal = {...}, unsigned int __fill_len = 1, bool __atend = true) Line: 112, Byte Offsets: 0x5c C++ MyLib.dll!stlp_std::vector<_WIN32_FIND_DATAW,LocalAllocator<_WIN32_FIND_DATAW,512> >::push_back(_WIN32_FIND_DATAW& __x = {...}) Line: 388, Byte Offsets: 0xa0 C++ MyLib.dll!Foo(unsigned long int cbInput = 16, unsigned char* pInput = 0x01a45620, unsigned long int* pcbOutput = 0x1dabfbbc, unsigned char** ppOutput = 0x1dabfbc0, IRAPIStream* __formal = 0x00000000) Line: 66, Byte Offsets: 0x1e4 C++ If anybody can point out what I may be doing wrong, I would appreciate it. Thanks, PaulH

  Read the article

• How do I set up Scala plugin for NetBeans to copy the Scala runtime library?

  - by Alexey Romanov

  Versions: NetBeans 6.8, Scala Kit 0.16.1 When I compile my project, I get the following output: init: deps-jar: Compiling 2 source files to F:\MyProgramming\NorvigSpellChecker\build\classes compile: Created dir: F:\MyProgramming\NorvigSpellChecker\dist Building jar: F:\MyProgramming\NorvigSpellChecker\dist\NorvigSpellChecker.jar Not copying the libraries. To run this application from the command line without Ant, try: java -jar "F:\MyProgramming\NorvigSpellChecker\dist\NorvigSpellChecker.jar" jar: BUILD SUCCESSFUL (total time: 3 seconds) Of course, the libraries should be copied, so I can't actually run it by using this command line. I don't see any options to copy the library in the project configuration. The plugin uses Ant for building, but I don't have any experience with it; presumably it should be easy enough to tell Ant to copy the libraries. Here is build-impl.xml, what should I do in build.xml?

  Read the article

• NSUserDefaults and default language used for I18N

  - by fedmest

  I have searched around a lot for this and found some answers that sounded quite like what I wanted but never worked. I simply need to have my iPhone app load NIBs and Localizable.strings that I decide (through user selection) rather than the ones that are established through the global iPhone/iPad settings. General consensus seems to be that this line [[NSUserDefaults standardUserDefaults] setObject:[NSArray arrayWithObject:@"ro"] forKey:@"AppleLanguages"]; would do the trick (in this specific case, load the NIBs and Localizable.strings in ro.lproj) but I have not had such luck. It keeps on looking for the files in en.lproj or whatever language I chose in the Settings app. I have then tried adding this line [[NSUserDefaults standardUserDefaults] setObject:[NSArray arrayWithObject:@"ro_RO"] forKey:@"AppleLocale"]; and to my great surprise, it worked! ...only once :-( then back to the same issue. Has anyone got any idea how to solve this issue? The aforementioned code was added at the very start of applicationDidFinishLaunching, which is before any NIBs or strings files should be loaded.

  Read the article

• passing parameters to javacsript using php

  - by ayush

  i have the following line of code - <a href="javascript:;" onClick="tweeet('myid')">My Tweets!</a> Now while this is working perfectly fine the following line is not - <a href="javascript:;" onClick="tweeet(<?php echo 'myid'; ?>)">My Tweets!</a> Can anyone help me out why it is not working and suggest any changes. The variable i want to pass to the javascript function is a php variable. also i have tried the php with single quotes and double quotes but it is not working.

  Read the article

• Which network protocol to use for lightweight notification of remote apps?

  - by Chris Thornton

  I have this situation.... Client-initiated SOAP 1.1 communication between one server and let's say, tens of thousands of clients. Clients are external, coming in through our firewall, authenticated by certificate, https, etc.. They can be anywhere, and usually have their own firewalls, NAT routers, etc... They're truely external, not just remote corporate offices. They could be in a corporate/campus network, DSL/Cable, even Dialup. Client uses Delphi (2005 + SOAP fixes from 2007), and the server is C#, but from an architecture/design standpoint, that shouldn't matter. Currently, clients push new data to the server and pull new data from the server on 15-minute polling loop. The server currently does not push data - the client hits the "messagecount" method, to see if there is new data to pull. If 0, it sleeps for another 15 min and checks again. We're trying to get that down to 7 seconds. If this were an internal app, with one or just a few dozen clients, we'd write a cilent "listener" soap service, and would push data to it. But since they're external, sit behind their own firewalls, and sometimes private networks behind NAT routers, this is not practical. So we're left with polling on a much quicker loop. 10K clients, each checking their messagecount every 10 seconds, is going to be 1000/sec messages that will mostly just waste bandwidth, server, firewall, and authenticator resources. So I'm trying to design something better than what would amount to a self-inflicted DoS attack. I don't think it's practical to have the server send soap messages to the client (push) as this would require too much configuration at the client end. But I think there are alternatives that I don't know about. Such as: 1) Is there a way for the client to make a request for GetMessageCount() via Soap 1.1, and get the response, and then perhaps, "stay on the line" for perhaps 5-10 minutes to get additional responses in case new data arrives? i.e the server says "0", then a minute later in response to some SQL trigger (the server is C# on Sql Server, btw), knows that this client is still "on the line" and sends the updated message count of "5"? 2) Is there some other protocol that we could use to "ping" the client, using information gathered from their last GetMessageCount() request? 3) I don't even know. I guess I'm looking for some magic protocol where the client can send a GetMessageCount() request, which would include info for "oh by the way, in case the answer changes in the next hour, ping me at this address...". Also, I'm assuming that any of these "keep the line open" schemes would seriously impact the server sizing, as it would need to keep many thousands of connections open, simultaneously. That would likely impact the firewalls too, I think. Is there anything out there like that? Or am I pretty much stuck with polling? TIA, Chris

  Read the article

• Cannot import SQLite with Python 2.6

  - by David McLaughlin

  I'm running Python 2.6 on Unix and when I run the interactive prompt (SQLite is supposed to be preinstalled) I get: [root@idev htdocs]# python Python 2.6 (r26:66714, Oct 23 2008, 16:25:34) [GCC 3.2.2 20030222 (Red Hat Linux 3.2.2-5)] on linux2 Type "help", "copyright", "credits" or "license" for more information. >>> import sqlite Traceback (most recent call last): File "<stdin>", line 1, in <module> ImportError: No module named sqlite >>> import sqlite Traceback (most recent call last): File "<stdin>", line 1, in <module> ImportError: No module named sqlite >>> How do I resolve this?

  Read the article

• Scanner cuts off my String after about 2400 characters

  - by Ventrue

  I've got some very basic code like while (scan.hasNextLine()) { String temp = scan.nextLine(); System.out.println(temp); } where scan is a Scanner over a file. However, on one particular line, which is about 6k chars long, temp cuts out after something like 2470 characters. There's nothing special about when it cuts out; it's in the middle of the word "Australia." If I delete characters from the line, the place where it cuts out changes; e.g. if I delete characters 0-100 in the file then Scanner will get what was previously 100-2570. I've used Scanner for larger strings before. Any idea what could be going wrong?

  Read the article

• Error with swig: undefined symbol: _ZN7hosters11hostersLink7getLinkEi

  - by Eduardo

  I'm trying to make a python binding for the this library: http://code.google.com/p/hosterslib/. I'm using swig, heres is the code: %module pyhosters %{ include "hosters/hosters.hpp" %} %include "hosters/hosters.hpp" I run "swig -c++ -python -o swig_wrap.cxx swig.i" and I compile with "g++ -O2 -fPIC -shared -o _pyhosters.so swig_wrap.cxx python-config --libs --cflags -lhosters -lcln -lhtmlcxx pkg-config libglog --libs --cflags -I/usr/include/python2.6 -Wall -Wextra" But when I run python and I import it, I get: import pyhosters Traceback (most recent call last): File "", line 1, in File "./pyhosters.py", line 7, in import _pyhosters ImportError: ./_pyhosters.so: undefined symbol: _ZN7hosters11hostersLink7getLinkEi How can I solve that? Thanks.

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• How to skew a Textfield in Actionscript 3.0 ?

  - by algro

  How can I skew a Textfield in order to set a ascending space for each line. Following image should illustrate my intention:

  Read the article

• How to extract a Sub-Matrix from a Matrix ?

  - by ZaZu

  Hello, I have a matrix in a txt file and I want to load the matrix based on my input of number of rows and columns For example, I have a 5 by 5 matrix in the file. I want to extract a 3 by 3 matrix, how can I do that ? I created a nested loop using : FILE *sample sample=fopen("randomfile.txt","r"); for(i=0;i<rows;i++){ for(j=0;j<cols;j++){ fscanf(sample,"%f",&matrix[i][j]); } fscanf(sample,"\n",&matrix[i][j]); } fclose(sample); Sadly the code does not work .. If I have this matrix : 5.00 4.00 5.00 6.00 5.00 4.00 3.00 25.00 5.00 3.00 4.00 23.00 5.00 2.00 352.00 6.00 And inputting 3 for rows and 3 for columns, I get : 5.00 4.00 5.00 6.00 5.00 4.00 3.00 25.00 5.00 Which is obviously wrong , its reading line by line rather than skipping the unmentioned column ... What am I doing wrong ? Thanks !

  Read the article

• unsetting application role in classic ASP

  - by user303526

  Hi, I'm trying to unset an application role but have been failing miserably. I was able to get the cookie value after setting (sp_setapprole) the application role. But I haven't been able to use that cookie (type varbinary / byte array) in my query to unset using sp_unsetapprole. If it was any other stored procedure it wouldn't have been a problem. I was able to use Command object and create a parameter which takes data type input of adVarBinary (204) and execute the command line.. but to the Server the query goes as below. exec sp_executesql N'sp_unsetapprole @P1 ',N'@P1 varbinary(36)',0x01000000CD11697F8F0ED3627BC1DAD25FB9CEB3A2EC5B289C658235E510CD9F29230000 Since sp_setapprole and sp_unsetapprole have to be run ad hoc, the sql server is failing to run this line. And I'm finding it hard to append varbinary cookie value to a simple query such as 'sp_unsetapprole ' & varKookie so it runs "directly" on to the server. Any kind of suggestions are welcome. Thanks, Nandagopal

  Read the article

• Python: User-Defined Exception That Proves The Rule

  - by bandana

  Python documentations states: Exceptions should typically be derived from the Exception class, either directly or indirectly. the word 'typically' leaves me in an ambiguous state. consider the code: class good(Exception): pass class bad(object): pass Heaven = good() Hell = bad() >>> raise Heaven Traceback (most recent call last): File "<pyshell#163>", line 1, in <module> raise Heaven good >>> raise Hell Traceback (most recent call last): File "<pyshell#171>", line 1, in <module> raise Hell TypeError: exceptions must be classes or instances, not bad so when reading the python docs, should i change 'typically' with ''? what if i have a class hierarchy that has nothing to do with the Exception class, and i want to 'raise' objects belonging to the hierarchy? i can always raise an exception with an argument: raise Exception, Hell This seems slightly awkward to me What's so special about the Exception class, that only its family members can be raised?

  Read the article

• Form validation with optional File Upload field callback

  - by MotiveKyle

  I have a form with some input fields and a file upload field in the same form. I am trying to include a callback into the form validation to check for file upload errors. Here is the controller for adding and the callback: public function add() { if ($this->ion_auth->logged_in()): //validate form input $this->form_validation->set_rules('title', 'title', 'trim|required|max_length[66]|min_length[2]'); // link url $this->form_validation->set_rules('link', 'link', 'trim|required|max_length[255]|min_length[2]'); // optional content $this->form_validation->set_rules('content', 'content', 'trim|min_length[2]'); $this->form_validation->set_rules('userfile', 'image', 'callback_validate_upload'); $this->form_validation->set_error_delimiters('<small class="error">', '</small>'); // if form was submitted, process form if ($this->form_validation->run()) { // add pin $pin_id = $this->pin_model->create(); $slug = strtolower(url_title($this->input->post('title'), TRUE)); // path to pin folder $file_path = './uploads/' . $pin_id . '/'; // if folder doesn't exist, create it if (!is_dir($file_path)) { mkdir($file_path); } // file upload config variables $config['upload_path'] = $file_path; $config['allowed_types'] = 'jpg|png'; $config['max_size'] = '2048'; $config['max_width'] = '1920'; $config['max_height'] = '1080'; $config['encrypt_name'] = TRUE; $this->load->library('upload', $config); // upload image file if ($this->upload->do_upload()) { $this->load->model('file_model'); $image_id = $this->file_model->insert_image_to_db($pin_id); $this->file_model->add_image_id_to_pin($pin_id, $image_id); } } // build page else: // User not logged in redirect("login", 'refresh'); endif; } The callback: function validate_upload() { if ($_FILES AND $_FILES['userfile']['name']): if ($this->upload->do_upload()): return true; else: $this->form_validation->set_message('validate_upload', $this->upload->display_errors()); return false; endif; else: return true; endif; } I am getting the error Fatal error: Call to a member function do_upload() on a non-object on line 92 when I try to run this. Line 92 is the if ($this->upload->do_upload()): line in the validate_upload callback. Am I going about this the right way? What's triggering this error?

  Read the article

• Powershell equivilent of python's if __name__ == '__main__':

  - by Mark Mascolino

  I am really fond of python's capability to do things like this: if __name__ == '__main__': #setup testing code here #or setup a call a function with parameters and human format the output #etc... This is nice because I can treat a Python script file as something that can be called from the command line but it remains available for me to import its functions and classes into a separate python script file easily without triggering the default "run from the command line behavior". Does Powershell have a similar facility that I could exploit? And if it doesn't how should I be organizing my library of function files so that i can easily execute some of them while I am developing them?

  Read the article

< Previous Page | 389 390 391 392 393 394 395 396 397 398 399 400  | Next Page >