Search Results

Search found 30062 results on 1203 pages for 'horizontal line'.

Page 394/1203 | < Previous Page | 390 391 392 393 394 395 396 397 398 399 400 401  | Next Page >

• Kerning problems when drawing text character by character

  - by shekel

  I'm trying to draw strings character by character to add lighting effects to shapes composed of text. while (i != line.length()) { c = line.substring(i, i + 1); cWidth = g.getFontMetrics().stringWidth(c); g.drawString(c, xx += cWidth, yy); i++; } The problem is, the width of a character isn't the actual distance it's drawn from another character when those two characters are printed as a string. Is there any way to get the correct distance in graphics2d?

  Read the article

• How do I do a join in ActiveRecord after records have been returned?

  - by Russ Bradberry

  I am using ActiveRecord in Rails 3 to pull data from two different tables in two different databases. These databases can not join on each other, but I have the need to do a simple join after-the-fact. I would like to preserve the relation so that I can chain it down the line. here is a simplified version of what I am doing browsers = Browser.all # <-- this is fairly small and can reside in memory events = Event.where(:row_date=>Date.today).select(:name, :browser_id) So as you can see, I want to join browsers in on the events relation, where browser_id should equal browsers.name. events is a relation and I can still add clauses to it down the line, so I dont want to run the query on the db just yet. How would I accomplish this?

  Read the article

• How to skip extra lines before the header of a tab delimited delimited file in R

  - by Michael Dunn

  The software I am using produces log files with a variable number of lines of summary information followed by lots of tab delimited data. I am trying to write a function that will read the data from these log files into a data frame ignoring the summary information. The summary information never contains a tab, so the following function works: read.parameters <- function(file.name, ...){ lines <- scan("tmp.log", what="character", sep="\n") first.line <- min(grep("\\t", lines)) return(read.delim(file.name, skip=first.line-1, ...)) } However, these logfiles are quite big, and so reading the file twice is very slow. Surely there is a better way?

  Read the article

• Python - werid behavior

  - by orokusaki

  I've done what I shouldn't have done and written 4 modules (6 hours or so) without running any tests along the way. I have a method inside of /mydir/__init__.py called get_hash(), and a class inside of /mydir/utils.py called SpamClass. /mydir/utils.py imports get_hash() from /mydir/__init__. /mydir/__init__.py imports SpamClass from /mydir/utils.py. Both the class and the method work fine on their own but for some reason if I try to import /mydir/, I get an import error saying "Cannot import name get_hash" from /mydir/__init__.py. The only stack trace is the line saying that __init__.py imported SpamClass. The next line is where the error occurs in in SpamClass when trying to import get_hash. Why is this?

  Read the article

• Use matching value of a RegExp to name the output file.

  - by fx42

  I have this file "file.txt" which I want to split into many smaller ones. Each line of the file has an id field which looks like "id:1" for a line belonging to id 1. For each id in the file, I like to create a file named idid.txt and put all lines that belong to this id in that file. My brute force bash script solution reads as follows. count=1 while [ $count -lt 19945 ] do cat file.txt | grep "id:$count " >> ./sets/id$count.txt count='expr $count + 1' done Now this is very inefficient as I have do read through the file about 20.000 times. Is there a way to do the same operation with only one pass through the file? - What I'm probably asking for is a way to use the value that matches for a regular expression to name the associated output file.

  Read the article

• NSUserDefaults and default language used for I18N

  - by fedmest

  I have searched around a lot for this and found some answers that sounded quite like what I wanted but never worked. I simply need to have my iPhone app load NIBs and Localizable.strings that I decide (through user selection) rather than the ones that are established through the global iPhone/iPad settings. General consensus seems to be that this line [[NSUserDefaults standardUserDefaults] setObject:[NSArray arrayWithObject:@"ro"] forKey:@"AppleLanguages"]; would do the trick (in this specific case, load the NIBs and Localizable.strings in ro.lproj) but I have not had such luck. It keeps on looking for the files in en.lproj or whatever language I chose in the Settings app. I have then tried adding this line [[NSUserDefaults standardUserDefaults] setObject:[NSArray arrayWithObject:@"ro_RO"] forKey:@"AppleLocale"]; and to my great surprise, it worked! ...only once :-( then back to the same issue. Has anyone got any idea how to solve this issue? The aforementioned code was added at the very start of applicationDidFinishLaunching, which is before any NIBs or strings files should be loaded.

  Read the article

• passing parameters to javacsript using php

  - by ayush

  i have the following line of code - <a href="javascript:;" onClick="tweeet('myid')">My Tweets!</a> Now while this is working perfectly fine the following line is not - <a href="javascript:;" onClick="tweeet(<?php echo 'myid'; ?>)">My Tweets!</a> Can anyone help me out why it is not working and suggest any changes. The variable i want to pass to the javascript function is a php variable. also i have tried the php with single quotes and double quotes but it is not working.

  Read the article

• Cloning a selector + all its children in jQuery?

  - by HipHop-opatamus

  I'm having trouble getting the following JQuery script to function properly - its functionality is as follows: 1) Hide the content below each headline 2) Upon clicking a headline, substitute the "#first-post" with the headline + the hidden content below the headline. I can only seem to get the script to clone the headline itself to #first-post, not the headline + the content beneath it. Any idea why? <HTML> <HEAD> <script src="http://code.jquery.com/jquery-latest.js"></script> </HEAD> <script> $(document).ready( function(){ $('.title').siblings().hide(); $('.title').click( function() { $('#first-post').replaceWith($(this).closest(".comment").clone().attr('id','first-post')); $('html, body').animate({scrollTop:0}, 'fast'); return false; }); }); </script> <BODY> <div id="first-post"> <div class="content"><p>This is a test discussion topic</p> </div> </div> <div class="comment"> <h2 class="title"><a href="#1">1st Post</a></h2> <div class="content"> <p>this is 1st reply to the original post</p> </div> <div class="test">1st post second line</div> </div> <div class="comment"> <h2 class="title"><a href="#2">2nd Post</a></h2> <div class="content"> <p>this is 2nd reply to the original post</p> </div> <div class="test">2nd post second line</div> </div> </div> <div class="comment"> <h2 class="title"><a href="#3">3rd Post</a></h2> <div class="content"> <p>this is 3rd reply to the original post</p> </div> <div class="test">3rd post second line</div> </div> </div> </BODY> </HTML>

  Read the article

• Loading .sql files from within PHP

  - by Josh Smeaton

  I'm creating an installation script for an application that I'm developing and need to create databases dynamically from within PHP. I've got it to create the database but now I need to load in several .sql files. I had planned to open the file and mysql_query it a line at a time - until I looked at the schema files and realised they aren't just one query per line. So, please.. how do I load an sql file from within PHP? (as phpMyAdmin does with it's import command).

  Read the article

• How to extract a Sub-Matrix from a Matrix ?

  - by ZaZu

  Hello, I have a matrix in a txt file and I want to load the matrix based on my input of number of rows and columns For example, I have a 5 by 5 matrix in the file. I want to extract a 3 by 3 matrix, how can I do that ? I created a nested loop using : FILE *sample sample=fopen("randomfile.txt","r"); for(i=0;i<rows;i++){ for(j=0;j<cols;j++){ fscanf(sample,"%f",&matrix[i][j]); } fscanf(sample,"\n",&matrix[i][j]); } fclose(sample); Sadly the code does not work .. If I have this matrix : 5.00 4.00 5.00 6.00 5.00 4.00 3.00 25.00 5.00 3.00 4.00 23.00 5.00 2.00 352.00 6.00 And inputting 3 for rows and 3 for columns, I get : 5.00 4.00 5.00 6.00 5.00 4.00 3.00 25.00 5.00 Which is obviously wrong , its reading line by line rather than skipping the unmentioned column ... What am I doing wrong ? Thanks !

  Read the article

• Given two lines on a plane, how to find integer points closest to their interseciton?

  - by Lukasz Lew

  I can't solve it: You are given 8 integers: A, B, C representing a line on a plane with equation A*x + B*y = C a, b, c representing another line x, y representing a point on a plane The two lines are not parallel therefore divide plane into 4 pieces. Point (x, y) lies inside of one these pieces. Problem: Write a fast algorithm that will find a point with integer coordinates in the same piece as (x,y) that is closest to the cross point of the two given lines. Note: This is not a homework, this is old Euler-type task that I have absolutely no idea how to approach.

  Read the article

• python logparse search specific text

  - by krisdigitx

  hi, I am using this function in my code to return the strings i want from reading the log file, I want to grep the "exim" process and return the results, but running the code gives no error, but the output is limited to three lines, how can i just get the output only related to exim process.. #output: {'date': '13', 'process': 'syslogd', 'time': '06:27:33', 'month': 'May'} {'date': '13', 'process': 'exim[23168]:', 'time': '06:27:33', 'month': 'May'} {'May': ['syslogd']} #function: def generate_log_report(logfile): report_dict = {} for line in logfile: line_dict = dictify_logline(line) print line_dict try: month = line_dict['month'] date = line_dict['date'] time = line_dict['time'] #process = line_dict['process'] if "exim" in line_dict['process']: process = line_dict['process'] break else: process = line_dict['process'] except ValueError: continue report_dict.setdefault(month, []).append(process) return report_dict

  Read the article

• Newline not showing correctly in textbox

  - by TheGateKeeper

  I am loading a string from my database which among other things contains line breaks (\r\n). However, this isn't being rendered as a new line but instead as \r\n. If I type it directly in instead of loading it from a string, it works just fine but I need to be able to load it from a string. Any ideas? Edit: Upon closer inspection, it looks like the string is being returned as: Changed test7\\r\\nChanged test8\\r\\nChanged test9Changed test7 From the database. I tried running a .Replace(@"\\", @"\") on it but this had no effect at all. Any ideas?

  Read the article

• Error with swig: undefined symbol: _ZN7hosters11hostersLink7getLinkEi

  - by Eduardo

  I'm trying to make a python binding for the this library: http://code.google.com/p/hosterslib/. I'm using swig, heres is the code: %module pyhosters %{ include "hosters/hosters.hpp" %} %include "hosters/hosters.hpp" I run "swig -c++ -python -o swig_wrap.cxx swig.i" and I compile with "g++ -O2 -fPIC -shared -o _pyhosters.so swig_wrap.cxx python-config --libs --cflags -lhosters -lcln -lhtmlcxx pkg-config libglog --libs --cflags -I/usr/include/python2.6 -Wall -Wextra" But when I run python and I import it, I get: import pyhosters Traceback (most recent call last): File "", line 1, in File "./pyhosters.py", line 7, in import _pyhosters ImportError: ./_pyhosters.so: undefined symbol: _ZN7hosters11hostersLink7getLinkEi How can I solve that? Thanks.

  Read the article

• Scanner cuts off my String after about 2400 characters

  - by Ventrue

  I've got some very basic code like while (scan.hasNextLine()) { String temp = scan.nextLine(); System.out.println(temp); } where scan is a Scanner over a file. However, on one particular line, which is about 6k chars long, temp cuts out after something like 2470 characters. There's nothing special about when it cuts out; it's in the middle of the word "Australia." If I delete characters from the line, the place where it cuts out changes; e.g. if I delete characters 0-100 in the file then Scanner will get what was previously 100-2570. I've used Scanner for larger strings before. Any idea what could be going wrong?

  Read the article

• System.Diagnostics.Debugger.Debug() stopped working

  - by Andrew Miner

  I'm working on a program which uses the System.Diagnostics.Debugger.Break() method to allow the user to set a breakpoint from the command-line. This has worked fine for many weeks now. However, when I was working on fixing a unit test today, I tried to use the debug switch from the command-line, and it didn't work. Here's what I've tried: I've confirmed that the Debug() method is really being called (by putting a System.Console.WriteLine() after it) I've confirmed that the build is still in Debug I've done a clean build I've restarted Product Studio A quick Google search didn't reveal anything, and the API documentation for .Net doesn't mention anything about this function not performing correctly. So... any ideas?

  Read the article

• Cannot import SQLite with Python 2.6

  - by David McLaughlin

  I'm running Python 2.6 on Unix and when I run the interactive prompt (SQLite is supposed to be preinstalled) I get: [root@idev htdocs]# python Python 2.6 (r26:66714, Oct 23 2008, 16:25:34) [GCC 3.2.2 20030222 (Red Hat Linux 3.2.2-5)] on linux2 Type "help", "copyright", "credits" or "license" for more information. >>> import sqlite Traceback (most recent call last): File "<stdin>", line 1, in <module> ImportError: No module named sqlite >>> import sqlite Traceback (most recent call last): File "<stdin>", line 1, in <module> ImportError: No module named sqlite >>> How do I resolve this?

  Read the article

• Form validation with optional File Upload field callback

  - by MotiveKyle

  I have a form with some input fields and a file upload field in the same form. I am trying to include a callback into the form validation to check for file upload errors. Here is the controller for adding and the callback: public function add() { if ($this->ion_auth->logged_in()): //validate form input $this->form_validation->set_rules('title', 'title', 'trim|required|max_length[66]|min_length[2]'); // link url $this->form_validation->set_rules('link', 'link', 'trim|required|max_length[255]|min_length[2]'); // optional content $this->form_validation->set_rules('content', 'content', 'trim|min_length[2]'); $this->form_validation->set_rules('userfile', 'image', 'callback_validate_upload'); $this->form_validation->set_error_delimiters('<small class="error">', '</small>'); // if form was submitted, process form if ($this->form_validation->run()) { // add pin $pin_id = $this->pin_model->create(); $slug = strtolower(url_title($this->input->post('title'), TRUE)); // path to pin folder $file_path = './uploads/' . $pin_id . '/'; // if folder doesn't exist, create it if (!is_dir($file_path)) { mkdir($file_path); } // file upload config variables $config['upload_path'] = $file_path; $config['allowed_types'] = 'jpg|png'; $config['max_size'] = '2048'; $config['max_width'] = '1920'; $config['max_height'] = '1080'; $config['encrypt_name'] = TRUE; $this->load->library('upload', $config); // upload image file if ($this->upload->do_upload()) { $this->load->model('file_model'); $image_id = $this->file_model->insert_image_to_db($pin_id); $this->file_model->add_image_id_to_pin($pin_id, $image_id); } } // build page else: // User not logged in redirect("login", 'refresh'); endif; } The callback: function validate_upload() { if ($_FILES AND $_FILES['userfile']['name']): if ($this->upload->do_upload()): return true; else: $this->form_validation->set_message('validate_upload', $this->upload->display_errors()); return false; endif; else: return true; endif; } I am getting the error Fatal error: Call to a member function do_upload() on a non-object on line 92 when I try to run this. Line 92 is the if ($this->upload->do_upload()): line in the validate_upload callback. Am I going about this the right way? What's triggering this error?

  Read the article

• How do I set up Scala plugin for NetBeans to copy the Scala runtime library?

  - by Alexey Romanov

  Versions: NetBeans 6.8, Scala Kit 0.16.1 When I compile my project, I get the following output: init: deps-jar: Compiling 2 source files to F:\MyProgramming\NorvigSpellChecker\build\classes compile: Created dir: F:\MyProgramming\NorvigSpellChecker\dist Building jar: F:\MyProgramming\NorvigSpellChecker\dist\NorvigSpellChecker.jar Not copying the libraries. To run this application from the command line without Ant, try: java -jar "F:\MyProgramming\NorvigSpellChecker\dist\NorvigSpellChecker.jar" jar: BUILD SUCCESSFUL (total time: 3 seconds) Of course, the libraries should be copied, so I can't actually run it by using this command line. I don't see any options to copy the library in the project configuration. The plugin uses Ant for building, but I don't have any experience with it; presumably it should be easy enough to tell Ant to copy the libraries. Here is build-impl.xml, what should I do in build.xml?

  Read the article

• Python: User-Defined Exception That Proves The Rule

  - by bandana

  Python documentations states: Exceptions should typically be derived from the Exception class, either directly or indirectly. the word 'typically' leaves me in an ambiguous state. consider the code: class good(Exception): pass class bad(object): pass Heaven = good() Hell = bad() >>> raise Heaven Traceback (most recent call last): File "<pyshell#163>", line 1, in <module> raise Heaven good >>> raise Hell Traceback (most recent call last): File "<pyshell#171>", line 1, in <module> raise Hell TypeError: exceptions must be classes or instances, not bad so when reading the python docs, should i change 'typically' with ''? what if i have a class hierarchy that has nothing to do with the Exception class, and i want to 'raise' objects belonging to the hierarchy? i can always raise an exception with an argument: raise Exception, Hell This seems slightly awkward to me What's so special about the Exception class, that only its family members can be raised?

  Read the article

• unsetting application role in classic ASP

  - by user303526

  Hi, I'm trying to unset an application role but have been failing miserably. I was able to get the cookie value after setting (sp_setapprole) the application role. But I haven't been able to use that cookie (type varbinary / byte array) in my query to unset using sp_unsetapprole. If it was any other stored procedure it wouldn't have been a problem. I was able to use Command object and create a parameter which takes data type input of adVarBinary (204) and execute the command line.. but to the Server the query goes as below. exec sp_executesql N'sp_unsetapprole @P1 ',N'@P1 varbinary(36)',0x01000000CD11697F8F0ED3627BC1DAD25FB9CEB3A2EC5B289C658235E510CD9F29230000 Since sp_setapprole and sp_unsetapprole have to be run ad hoc, the sql server is failing to run this line. And I'm finding it hard to append varbinary cookie value to a simple query such as 'sp_unsetapprole ' & varKookie so it runs "directly" on to the server. Any kind of suggestions are welcome. Thanks, Nandagopal

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• Experience using IRC to coordinate software development?

  - by momeara

  I am part of a growing software project with at least 200 active developer in 10 locations. I would like to set up an on-line chat forum for developers because I think it would help to coordinate efforts. We have an email mailing list but I feel like some questions or announcements are too informal to send to everyone while mentioning it in a chat forum might be a useful community resource. I have never participated in a software project that used an on-line chat forum so I would like to hear about peoples experiences. I am particularly interested in technical issues: Use of IRC vs. alternative platforms; how to manage access, eg. for developers only, allowing users to participate; the value of requiring certain announcements to be made on the chat forum eg who is resolving broken builds etc. If I pitch the idea to the community I would like to have some good arguments why it would be a good idea and some prospective of its usefulness in other software projects.

  Read the article

• Is there any way to tweak / rotate mouse orientation? Any applications? Registry edits?

  - by calbar

  I've got a very frustrating issue with my new Logitech Marathon Mouse M705. It is absolutely perfect for what I need, with the exception that it tracks on an angle for some reason. What I mean is when you slide the cursor to the left, it trends upward - when you slide to the right, it trends down. Moving the cursor along a flat horizontal line is no longer a natural motion - you need to fight what I suspect is a mechanical error of some kind. Unfortunately, I've already exchanged this mouse once and tested both on different Windows 7 and Mac OS X machines - the problem continues to occur. Is there a software solution for me? I'm incredibly surprised there is no simple way to adjust the orientation... how can every mouse manufacturer possibly adjust their hardware to track to everyone's tastes? What about those who need to flip orientation a full 90 or 180 degrees? I only need to adjust mine a few degrees, but I'm sure that need has arisen as well. Anyway, I'm running the latest SetPoint drivers (6.00) on Windows 7 and there are no orientation options available. I've checked out uberOptions and the M705 isn't supported yet (with the last version update over 6 months ago). MAF Mouse instructions are a very strange series of mouse clicks to activate. This app also seems a little overkill and costs $$ (which I'm willing to pay as a last resort). Is there no universal registry value for mouse orientation? How about for SetPoint drivers specifically? I've done a simple search in regedit without any luck. An XML file somewhere? Anything?

  Read the article

• Access violation using LocalAlloc()

  - by PaulH

  I have a Visual Studio 2008 Windows Mobile 6 C++ application that is using an API that requires the use of LocalAlloc(). To make my life easier, I created an implementation of a standard allocator that uses LocalAlloc() internally: /// Standard library allocator implementation using LocalAlloc and LocalReAlloc /// to create a dynamically-sized array. /// Memory allocated by this allocator is never deallocated. That is up to the /// user. template< class T, int max_allocations > class LocalAllocator { public: typedef T value_type; typedef size_t size_type; typedef ptrdiff_t difference_type; typedef T* pointer; typedef const T* const_pointer; typedef T& reference; typedef const T& const_reference; pointer address( reference r ) const { return &r; }; const_pointer address( const_reference r ) const { return &r; }; LocalAllocator() throw() : c_( NULL ) { }; /// Attempt to allocate a block of storage with enough space for n elements /// of type T. n>=1 && n<=max_allocations. /// If memory cannot be allocated, a std::bad_alloc() exception is thrown. pointer allocate( size_type n, const void* /*hint*/ = 0 ) { if( NULL == c_ ) { c_ = LocalAlloc( LPTR, sizeof( T ) * n ); } else { HLOCAL c = LocalReAlloc( c_, sizeof( T ) * n, LHND ); if( NULL == c ) LocalFree( c_ ); c_ = c; } if( NULL == c_ ) throw std::bad_alloc(); return reinterpret_cast< T* >( c_ ); }; /// Normally, this would release a block of previously allocated storage. /// Since that's not what we want, this function does nothing. void deallocate( pointer /*p*/, size_type /*n*/ ) { // no deallocation is performed. that is up to the user. }; /// maximum number of elements that can be allocated size_type max_size() const throw() { return max_allocations; }; private: /// current allocation point HLOCAL c_; }; // class LocalAllocator My application is using that allocator implementation in a std::vector< #define MAX_DIRECTORY_LISTING 512 std::vector< WIN32_FIND_DATA, LocalAllocator< WIN32_FIND_DATA, MAX_DIRECTORY_LISTING > > file_list; WIN32_FIND_DATA find_data = { 0 }; HANDLE find_file = ::FindFirstFile( folder.c_str(), &find_data ); if( NULL != find_file ) { do { // access violation here on the 257th item. file_list.push_back( find_data ); } while ( ::FindNextFile( find_file, &find_data ) ); ::FindClose( find_file ); } // data submitted to the API that requires LocalAlloc()'d array of WIN32_FIND_DATA structures SubmitData( &file_list.front() ); On the 257th item added to the vector<, the application crashes with an access violation: Data Abort: Thread=8e1b0400 Proc=8031c1b0 'rapiclnt' AKY=00008001 PC=03f9e3c8(coredll.dll+0x000543c8) RA=03f9ff04(coredll.dll+0x00055f04) BVA=21ae0020 FSR=00000007 First-chance exception at 0x03f9e3c8 in rapiclnt.exe: 0xC0000005: Access violation reading location 0x01ae0020. LocalAllocator::allocate is called with an n=512 and LocalReAlloc() succeeds. The actual Access Violation exception occurs within the std::vector< code after the LocalAllocator::allocate call: 0x03f9e3c8 0x03f9ff04 > MyLib.dll!stlp_std::priv::__copy_trivial(const void* __first = 0x01ae0020, const void* __last = 0x01b03020, void* __result = 0x01b10020) Line: 224, Byte Offsets: 0x3c C++ MyLib.dll!stlp_std::vector<_WIN32_FIND_DATAW,LocalAllocator<_WIN32_FIND_DATAW,512> >::_M_insert_overflow(_WIN32_FIND_DATAW* __pos = 0x01b03020, _WIN32_FIND_DATAW& __x = {...}, stlp_std::__true_type& __formal = {...}, unsigned int __fill_len = 1, bool __atend = true) Line: 112, Byte Offsets: 0x5c C++ MyLib.dll!stlp_std::vector<_WIN32_FIND_DATAW,LocalAllocator<_WIN32_FIND_DATAW,512> >::push_back(_WIN32_FIND_DATAW& __x = {...}) Line: 388, Byte Offsets: 0xa0 C++ MyLib.dll!Foo(unsigned long int cbInput = 16, unsigned char* pInput = 0x01a45620, unsigned long int* pcbOutput = 0x1dabfbbc, unsigned char** ppOutput = 0x1dabfbc0, IRAPIStream* __formal = 0x00000000) Line: 66, Byte Offsets: 0x1e4 C++ If anybody can point out what I may be doing wrong, I would appreciate it. Thanks, PaulH

  Read the article

< Previous Page | 390 391 392 393 394 395 396 397 398 399 400 401  | Next Page >