Search Results

Search found 39440 results on 1578 pages for 'possible homework'.

Page 40/1578 | < Previous Page | 36 37 38 39 40 41 42 43 44 45 46 47  | Next Page >

  • My PHP script for sending emails wont send

    - by James
    Well I'm working on a school project, and I uploaded my script to send emails. I'm pretty much using whats defined here: http://www.webcheatsheet.com/PHP/send_email_text_html_attachment.php . Now, all I really changed(other than the contents), is the receiver, to my email address. However, I'm not getting it in my inbox. Is there something else I need? Do I need to do something with the settings on the server(or have my school enable something)?

    Read the article

  • what is the best algorithm to use for this problem

    - by slim
    Equilibrium index of a sequence is an index such that the sum of elements at lower indexes is equal to the sum of elements at higher indexes. For example, in a sequence A: A[0]=-7 A[1]=1 A[2]=5 A[3]=2 A[4]=-4 A[5]=3 A[6]=0 3 is an equilibrium index, because: A[0]+A[1]+A[2]=A[4]+A[5]+A[6] 6 is also an equilibrium index, because: A[0]+A[1]+A[2]+A[3]+A[4]+A[5]=0 (sum of zero elements is zero) 7 is not an equilibrium index, because it is not a valid index of sequence A. If you still have doubts, this is a precise definition: the integer k is an equilibrium index of a sequence if and only if and . Assume the sum of zero elements is equal zero. Write a function int equi(int[] A); that given a sequence, returns its equilibrium index (any) or -1 if no equilibrium indexes exist. Assume that the sequence may be very long.

    Read the article

  • Efficient Multiplication of Varying-Length #s [Conceptual]

    - by Milan Patel
    Write the pseudocode of an algorithm that takes in two arbitrary length numbers (provided as strings), and computes the product of these numbers. Use an efficient procedure for multiplication of large numbers of arbitrary length. Analyze the efficiency of your algorithm. I decided to take the (semi) easy way out and use the Russian Peasant Algorithm. It works like this: a * b = a/2 * 2b if a is even a * b = (a-1)/2 * 2b + a if a is odd My pseudocode is: rpa(x, y){ if x is 1 return y if x is even return rpa(x/2, 2y) if x is odd return rpa((x-1)/2, 2y) + y } I have 3 questions: Is this efficient for arbitrary length numbers? I implemented it in C and tried varying length numbers. The run-time in was near-instant in all cases so it's hard to tell empirically... Can I apply the Master's Theorem to understand the complexity...? a = # subproblems in recursion = 1 (max 1 recursive call across all states) n / b = size of each subproblem = n / 1 - b = 1 (problem doesn't change size...?) f(n^d) = work done outside recursive calls = 1 - d = 0 (the addition when a is odd) a = 1, b^d = 1, a = b^d - complexity is in n^d*log(n) = log(n) this makes sense logically since we are halving the problem at each step, right? What might my professor mean by providing arbitrary length numbers "as strings". Why do that? Many thanks in advance

    Read the article

  • What is the purpose of this string argument in a JavaScript function?

    - by Adel
    In the following function, there is the line: var username=getCookie("username"); Here's the whole function: function checkCookie() { var username=getCookie("username"); if (username!=null && username!="") { alert("Welcome again " + username); } else { username=prompt("Please enter your name:",""); if (username!=null && username!="") { setCookie("username",username,365); } } What is the point of the "username" argument being passed above? function getCookie(c_name) { var i,x,y,ARRcookies=document.cookie.split(";"); for (i=0;i<ARRcookies.length;i++) { x=ARRcookies[i].substr(0,ARRcookies[i].indexOf("=")); y=ARRcookies[i].substr(ARRcookies[i].indexOf("=")+1); x=x.replace(/^\s+|\s+$/g,""); if (x==c_name) { return unescape(y); } } } The whole code is here Thanks!

    Read the article

  • Why does this code sample produce a memory leak?

    - by citronas
    In the university we were given the following code sample and we were being told, that there is a memory leak when running this code. The sample should demonstrate that this is a situation where the garbage collector can't work. As far as my object oriented programming goes, the only codeline able to create a memory leak would be items=Arrays.copyOf(items,2 * size+1); The documentation says, that the elements are copied. Does that mean the reference is copied (and therefore another entry on the heap is created) or the object itself is being copied? As far as I know, Object and therefore Object[] are implemented as a reference type. So assigning a new value to 'items' would allow the garbage collector to find that the old 'item' is no longer referenced and can therefore be collected. In my eyes, this the codesample does not produce a memory leak. Could somebody prove me wrong? =) import java.util.Arrays; public class Foo { private Object[] items; private int size=0; private static final int ISIZE=10; public Foo() { items= new Object[ISIZE]; } public void push(final Object o){ checkSize(); items[size++]=o; } public Object pop(){ if (size==0) throw new ///... return items[--size]; } private void checkSize(){ if (items.length==size){ items=Arrays.copyOf(items,2 * size+1); } } }

    Read the article

  • Identifying the parts of this typedef struct in C?

    - by Tommy
    Please help me identify the parts of this typdef struct and what each part does and how it can be used: typedef struct my_struct { int a; int b; int c; } struct_int, *p_s; struct_int struct_array[5]; my_struct is the...? struct_int is the...? *p_s is the...and can be used to point to what? struct_array is the...? Also, when creating the array of structs, why do we use struct_int instead of my_struct ? Thank You!

    Read the article

  • How do I make software that preserves database integrity and correctness? Please help, confused.

    - by user287745
    i have made an application project in vs 08 c#, sql server from vs 08. the database has like 20 tables and many fields in each have made an interface for adding deleting editting and retrieving data according to predefined needs of the users. now i have to 1) make to project in to a software which i can deliver to professor. that is he can just double click the icon and the software simply starts. no vs 08 needed to start the debugging 2) the database will be on one powerful computer (dual core latest everything win xp) and the user will access it from another computer connected using LAN i am able to change the connection string to the shared database using vs 08/ debugger whenever the server changes but how am i supposed to do that when its a software? 3)there will by many clients am i supposed to give the same software to every one, so they all can connect to the database, how will the integrity and correctness of the database be maintained? i mean the db.mdf file will be in a folder which will be shared with read and write access. so its not necessary that only one user will write at a time. so is there any coding for this or? please help me out here i am stuck do not know what to do i have no practical experience, would appreciate all the help thank you

    Read the article

  • Hashmap method not accepting defined parameters

    - by Ocasta Eshu
    My assignment is to implement a contact list in a HashMap. All has gone well except for the problem in the code below. the HashMap method put(K key, V value) isnt accepting the defined parameters String, List. public ContactList(){ private HashMap<String, List<String>> map; public void update(String name, List<String> number){ this.map.put(name, number) The error is: The method put(String, List<String>) is undefined for the type ContactList How do I correct this?

    Read the article

  • toString() Method question

    - by cdominguez13
    I've been working on this assignemnt here's code: public class Student { private String fname; private String lname; private String studentId; private double gpa; public Student(String studentFname,String studentLname,String stuId,double studentGpa) { fname = studentFname; lname = studentLname; studentId = stuId; gpa = studentGpa; } public double getGpa() { return gpa; } public String getStudentId() { return studentId; } public String getName() { return lname + ", " + fname; } public void setGpa(double gpaReplacement) { if (gpaReplacement >= 0.0 && gpaReplacement <= 4.0) gpa = gpaReplacement; else System.out.println("Invalid GPA! Please try again."); System.exit(0); } } Now I need to create a toString() method that returns a String formatted something like this: Name: Wilson, Mary Ann ID number: 12345 GPA: 3.5

    Read the article

  • Does python have a session variable concept???

    - by gizgok
    I have a datetime.date variable in python.I need to pass it to a function do operations according to the date given and then increment the date for the next set of operations.The problem is I have to do the operations in diff pages and hence I need the date as a variable which can go from page to page. Can we do this in python.......

    Read the article

  • overflow technique in stack

    - by metashockwave
    int main(void) { problem2(); } void doit2(void) { int overflowme[16]; //overflowme[37] =0; } void problem2(void) { int x = 42; doit2(); printf("x is %d\n", x); printf("the address of x is 0x%x\n", &x); } Would someone help me understand why overflowme[37] =0; from the doit2 function will overwrite the value of x? (please include Program Counter and Frame Pointer of the function doit2 in your explanation) Thank you! It works every time with Project properties-Configuration properties-C/C++ -Code Generation-Basic Runtime Checks set to "Default". so it's not an undefined behavior.

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Help with shopping cart in javascript

    - by user228390
    Hey guys, I'm having problems with my shopping cart. What I am trying to do is make a function that will add an item the cart and then and function that will view the cart and show the details. But what I have got so far does not do that, it just simply adds and goes straight to view cart. Also I wanted to store the name of each items in different global arrays (name, price and sum) but I can't get it work that way. Can any help me overcome this problem? Edit: I've tried to get it to work by adding some more items and attaching it to another html page, but now the code does not seem to work at all , before it showed the price and total and now I get nothing . javascript code function round_total (c) { var pennies = c * 100; pennies = Math.round(pennies); var strPennies = "" + pennies; var len = strPennies.length; return parseFloat(strPennies.substring(0, len - 2) + "." + strPennies.substring(len - 2, len)); } // End of round_total function. /* Start of generate_page function. */ function generate_page (form) { tax = 0.08; delivery_p = 2.99; var odate = new Date(); var qty = form.quantity.value; var product_v = new String(form.product.value); var total_price = product_v.substr(product_v.indexOf("$") + 1, product_v.length - product_v.indexOf("$")); var price_without_tax = round_total(qty * total_price); var ttax = round_total(price_without_tax * tax); var delivery = round_total(qty * delivery_p); var total_p = round_total(price_without_tax + ttax + delivery); document.writeln("Quantity: " + qty + "<br>"); document.writeln("Price: $" + total_price + "<br>"); document.writeln("Delivery: $" + delivery + "<br>"); document.writeln("Total: $" + total_p + "<br>"); document.writeln("Order placed on: " + odate.toGMTString()); } function calculate() { round_total (c)(); generate_page (form)(); } HTML code: Shopping cart Welcome, Guest Login Sign Up Stay Updated: Subscribe via RSS Email Updates <div id="header"> <div id="branding" class="container"> <h1>The Finest Toy<br /> Store Online</h1> <p class="desc">If you're looking for a toy shop then look no further.<br/> Go on, treat the kids with our huge selection of<br/>online toy shops selling toys for all ages.</p> </div><!-- end branding --> <div id="navigation"> <ul id="menu" class="container"> <li><a href="#">HOME</a></li> <li><a href="#">ABOUT</a></li> <li><a href="#">Online Store</a></li> <li><a href="#">CONTACT</a></li> </ul> </div><!-- end navigation --> </div><!-- end header --> Shopping Cart Nintendo DS Xbox Product: Console £149.99 Console + Games £169.99 Quantity: Product: Console £149.99 Console + Games £169.99 Quantity:     Playstation 3 Wii Product: Console £149.99 Console + Games £169.99 Quantity:   Product: Console £149.99 Console + Games £169.99 Quantity:        <input type="submit" value="Add to cart" name="submit" onClick="cart()";/><input , type="reset" value="Reset" name="reset" Copyright © 2010 shopping cart. Content and Header © |Back to top Do I need to show my CSS as well? (Sorry about the coding its not working properly for me, its not showing up the way it should be)

    Read the article

  • How to calculate "holes" in timetable

    - by genesiss
    I've got a 2-dimensional array like this (it represents a timetable): http://www.shrani.si/f/28/L6/37YvFye/timetable.png Orange cells are lectures and whites are free time. How could I calculate number of free hours between lectures in the same day? (columns are days and rows are hours) For example, in this table the result should be: 2 for first column 0 for second colum -- The function returns 2 (because 2+0=2)

    Read the article

  • problem with join SQL Server 2000

    - by eyalb
    I have 3 tables - Items, Props, Items_To_Props i need to return all items that match all properties that i send example items 1 2 3 4 props T1 T2 T3 items_to_props 1 T1 1 T2 1 T3 2 T1 3 T1 when i send T1,T2 i need to get only item 1

    Read the article

  • help implementing algorithm

    - by davit-datuashvili
    http://en.wikipedia.org/wiki/All_nearest_smaller_values this is site of the problem and here is my code but i have some trouble to implement it import java.util.*; public class stack{ public static void main(String[]args){ int x[]=new int[]{ 0, 8, 4, 12, 2, 10, 6, 14, 1, 9, 5, 13, 3, 11, 7, 15 }; Stack<Integer> st=new Stack<Integer>(); for (int a:x){ while (!st.empty() && st.pop()>=a){ System.out.println( st.pop()); if (st.empty()){ break; } else{ st.push(a); } } } } } and here is pseudo code from site S = new empty stack data structure for x in the input sequence: while S is nonempty and the top element of S is greater than or equal to x: pop S if S is empty: x has no preceding smaller value else: the nearest smaller value to x is the top element of S push x onto S

    Read the article

  • C# Finding 2 positions 1-dimArray

    - by Chris
    Hello, In a method i am calculating the longest row of elements. The 1-dim array is filled up with random values (0 or 1). The method looks up the longest row (being 0 or 1, whatever is the longest). Meaning in for example: 1110100 --> the longest row would be 3 (3 * 1) 0110000 --> the longest row would be 4 (4 * 0) My problem is i am trying to perform some type of linear search to show the position of the row in the array. The first example has the longest row of 3 elements (3 times 1). For 1110100 the position in the array would be 0 - 2 (index) For 0110000 the position in the array would be 3 - 6 (index) I have been trying with foreaches, for loops etc..but i cannot seem to get the proper indexes of both. Cannot seem to display both positions properly. For the first example the correct output wouldbe: The largest row of same elements of the array consists of 3 elements on the position 0 - 2. The longest row of elements gets of same elements get calculated as the following: public int BerekenDeelrij (int [] table) ( int count = 0; final int value = 0; int largest = 0; foreach (int value in table) ( if (value == last value) counter + +; else ( largest = Math.Max largest (largest, counter); final value = value count = 1; ) ) Math.Max return (largest, counter); ) Best Regards.

    Read the article

< Previous Page | 36 37 38 39 40 41 42 43 44 45 46 47  | Next Page >