Search Results

Search found 93603 results on 3745 pages for 'some one'.

Page 408/3745 | < Previous Page | 404 405 406 407 408 409 410 411 412 413 414 415  | Next Page >

  • How to create shared home directories across multiple computers?

    - by Joe D
    I know there are ways to share a folder across computers making it easy to move files. But I was wondering how one would setup a single login which lets you access the same files regardless of which machine you login on? What I would like is something similar to something you would see in a college campus where students login on machines in the lab and see their files regardless of which machine they use. I know there are server involved here. I have a need to create this on a smaller scale where we have a few computers available (and one of these could act as the server if needed and host the files) that every one shares. Note, the specific install of software might be different on each computer but the login and OS are the same. Since some computers have additional capability that our group members will need to use at rotating schedules (software licenses or hardware components, etc.). I have not done this before, so I would appreciate detailed instructions if possible or a reference to a guide that describes this. Thanks in advance.

    Read the article

  • Is learning how to use C (or C++) a requirement in order to be a good (excellent) programmer?

    - by blueberryfields
    When I first started to learn how to program, real programmers could write assembly in their sleep. Any serious schooling in computer science would include a hefty bit of training and practice in programming using assembly. That has since changed, to the point where I see Computer Science degrees with assembly, if included at all, is relegated to one assignment, and one chapter, for a total of two weeks' work out of 4 years' schooling. C/C++ programming seems to have followed a similar path. I'm no longer surprised to interview university graduates who have not spent more than two weeks programming in C++, and have only read of C in a book somewhere. While the most serious CS degrees still seem to include significant time learning and using one or both of the languages, the trend is clearly towards less enforced C/C++ in school. It's clearly possible to make a career producing good work without ever reading or writing a single line of C or C++ code. Given all of that, is learning the two languages worth the effort? Are they at all required to excel? (beyond the obvious, non-language specific advice, such as "a good selection of languages is probably important for a comprehensive education", and "it's probably a good idea to keep trying out and learning new languages throughout a programmers' career, just to stretch the gray cells")

    Read the article

  • Homepage not showing on Google

    - by MIke Mayberry
    About six weeks ago my homepage (mayberrykayakingdotcodotuk) disappeared from the google organic search for "kayaking pembrokeshire" despite it having been number 2 within a few weeks of it's launch last summer. My previous site (www.mikemayberrykayakingdotcodotuk) had been 2nd for about six years and has 301 redirects for all pages to the new site. Google toolbar still rates the homepage as 3/10 and the domain is still showing in search results, just not the homepage. A little research suggests that this is most likely to be due to an issue with google treating two pages as identical content (one with www. and one with not) since the changes in their algorithms around that time and that the way to fix this is to add some code somewhere. This makes sense to me as my print advertising doesn't have the www part of the address. I have cpanel access but a limited knowledge on web coding, having picked things up as I've gone along and paid for designers etc., when needed. Would someone be able to let me know where I have to go to add the code and what code I need to add to redirect the crawlers to one page? Or is there another issue that is causing this? Thanks in advance.

    Read the article

  • Naming conventions: camelCase versus underscore_case ? what are your thoughts about it?

    - by poelinca
    I've been using underscore_case for about 2 years and I recently switched to camelCase because of the new job (been using the later one for about 2 months and I still think underscore_case is better suited for large projects where there are alot of programmers involved, mainly because the code is easyer to read). Now everybody at work uses camelCase because (so they say) the code looks more elegant . What are you're thoughts about camelCase or underscore_case p.s. please excuse my bad english Edit Some update first: platform used is PHP (but I'm not expecting strict PHP platform related answers , anybody can share their thoughts on which would be the best to use , that's why I came here in the first place) I use camelCase just as everibody else in the team (just as most of you recomend) we use Zend Framework which also recommends camelCase Some examples (related to PHP) : Codeigniter framework recommends underscore_case , and honestly the code is easier to read . ZF recomends camelCase and I'm not the only one who thinks ZF code is a tad harder to follow through. So my question would be rephrased: Let's take a case where you have the platform Foo which doesn't recommend any naming conventions and it's the team leader's choice to pick one. You are that team leader, why would you pick camelCase or why underscore_case? p.s. thanks everybody for the prompt answers so far

    Read the article

  • Creating Ubuntu Browser App Frames

    - by user73006
    After watching the video i am inspired to create one browser but stuck at one place, could you please help me with this. Requirement = - Like you displayed in your Video i wan create Multiple Buttons in my Toolbar which will open Second ToolBar or Popup Window. - From that Pop Window i wanted to Select Specific Button Which will open My Required Browser. Question - - As displayed in your Video i create new BUtton and If i try to open new link using that it works but now i want to display tool bar or Popup window once any one click on that button, how can i do that.The Second Tool Bar Need to be Activated only after clicking on that button. Things i Tried - - As per my understanding i create Second Toolbar and on that tool bar i have created Button, now i wan know how do i link that tool bar with my Browser Toolbar button. - I tried that by passing Signal Property in Second Toolbar in Quickly but something is missing. MY Code class TvbrowserWindow(Window): gtype_name = "TvbrowserWindow" def finish_initializing(self, builder): # pylint: disable=E1002 """Set up the main window""" super(TvbrowserWindow, self).finish_initializing(builder) self.AboutDialog = AboutTvbrowserDialog self.PreferencesDialog = PreferencesTvbrowserDialog # Code for other initialization actions should be added here. self.refreshbutton=self.builder.get_object("refreshbutton") self.SONY=self.builder.get_object("SONY") self.urlentry=self.builder.get_object("urlentry") self.scrolledwindow1=self.builder.get_object("scrolledwindow1") self.webview = WebKit.WebView() self.scrolledwindow1.add(self.webview) self.webview.show() def on_refreshbutton_clicked(self, widget): print "refresh" def on_urlentry_activate(self, widget): url = widget.get_text() print url self.webview.open(url)

    Read the article

  • sudoers - simple explanation requested

    - by Redsandro
    Everytime I want to be able to run something that requires me to be a sudoer too many times, I need to google for the formatting of /etc/sudoers to remind me again what exactly is the proper way to write it. Now I see different writing styles in my sudoers file, which is the consequence of different google results over the months. I've also noticed that the second example (below) seems to work in XFCE, but not in Cinnamon (Gnome 3). This could be totally unrelated, but nontheless I'd like to know once and for all, what is the correct grammar of the sudoer line, and what is the difference between the given examples? redsandro ALL=NOPASSWD:/path/to/command redsandro ALL=(ALL) NOPASSWD:/path/to/command redsandro ALL=(ALL:ALL) NOPASSWD:/path/to/command Also, what are all the ALL's for? One user, one command, yet I need to use the ALL keyword up to three times? Am I doing this wrong? Of course, omitting NOPASSWD: makes you enter your password before you are permitted to run the command, but one point of confusion is the usage of = and :, for the final command that is the subject of the line can be prepended by either =, :, , or ), confusing grammar for similar semantics.

    Read the article

  • Packing up files on my machine, sending it to a server, and unpacking it

    - by MxyL
    I am implementing a feature in my application that sends all files in a specified folder to a server. I have the basic FTP transaction set up using Apache Commons FTPClient: it sets up a connection and transfers a file from one place to another. So I can simply loop over the directory and use this connection to transfer all the files. However, this could be better. Rather than transferring each file one by one, it makes more sense to pack it up in a compressed archive and then send the whole file at once. Saves time and bandwidth, since these are just text files so they compress nicely. So I would like to add automatic archive packing and unpacking. This is the workflow I have planned out, using zip compression: Zip all files in the folder Send the file over Unzip the files at its destination 1 and 2 are easy since the files are on the local machine, but I'm not sure how to accomplish the last step, when the files are now on a remote server. What are my options? I have control over what I can put and run on the server. Perhaps it is not necessary to do the packing/unpacking myself?

    Read the article

  • Adding files and folders to a Root Folder (inode/directory)

    - by xBaldwin
    Ok so I'm fairly new to Ubuntu and wasn't even the one who put it one this computer(my friend did while I was storing it at his house because I was in the middle of transitioning between houses), but It's on here so I need to learn what I can so I can use it more effectively. My question at the moment is "Would it be safe to add files/folders to a folder (inode/directory) that requires Root access?" I continue to be informed by the system that the directory I am using is running low on space which I found odd seeing how I should have a lot more room on this computer. That's when I started looking at the directories and found that there are two with a bunch of un-used space on them. One says it has 46.9 GB of free space and the other has 24.9 GB of free space. Seems like a complete waste to not use that space and yet they both say they require Root access to add to them. I know that Root folders and files are normally all system folders and files. I also know that changing or deleting them can mess up the computer which right now I cant afford to do. I just don't know if it would mess anything up to add something to those folders. Thank you in advance to anyone who takes the time to reply and try to teach me about how all that works. I really do appreciate it and will do the same if by some crazy (completely unlikely) reason I have an answer to your question. :-)`

    Read the article

  • Ubuntu Server 12.04 as a router. Problem with DNS?? Or Routing table?

    - by Lorenzo
    I have a virtualbox lab made up of 4 Windows 2008 R2 servers (DC/DNS,SQL,SHAREPOINT, EXCHANGE) that are configured with static ip addresses with NIC's attached to Internal network. Everything works. I had the requirement to execute some tests that also access external services available on the internet. To keep things clean and similar to the production environment I have installed another VM, with Ubuntu Server 12.04 64 bit and configured (I hope) to work as a router like described on this post. This VM has two network interfaces: first is Bridged with the host and is used as a WAN connection and the other one attached in the Internal Network with its own static IP address on the internal network subnet. But actually the Windows servers does not connect to the internet while the unix one connects. I did a route command. this is the result: Kernel IP Routing table Destination Gateway Genmask Flags Metric Ref Use Iface default 10.69.121.1 0.0.0.0 UG 100 0 0 eth0 10.69.121.0 * 255.255.255.0 U 0 0 0 eth0 192.168.83.0 * 255.255.255.0 U 0 0 0 eth1 Can somebody help me with this configuration? :) Thanks! Addendum: I forgot to mention that one of the windows server hosts a DNS service for which I should maybe configure a forwarding server but I do not exactly know which server to forward on... :(

    Read the article

  • overwrite existing entity via bulkloader.Loader

    - by Ray Yun
    I was going to CSV based export/import for large data with app engine. My idea was just simple. First column of CSV would be key of entity. If it's not empty, that row means existing entity and should overwrite old one. Else, that row is new entity and should create new one. I could export key of entity by adding key property. class FrontExporter(bulkloader.Exporter): def __init__(self): bulkloader.Exporter.__init__(self, 'Front', [ ('__key__', str, None), ('name', str, None), ]) But when I was trying to upload CSV, it had failed because bulkloader.Loader.generate_key() was just for "key_name" not "key" itself. That means all exported entities in CSV should have unique 'key_name' if I want to modify-and-reupload them. class FrontLoader(bulkloader.Loader): def __init__(self): bulkloader.Loader.__init__(self, 'Front', [ ('_UNUSED', lambda x: None), ('name', lambda x: x.decode('utf-8')), ]) def generate_key(self,i,values): # first column is key keystr = values[0] if len(keystr)==0: return None return keystr I also tried to load key directly without using generate_key(), but both failed. class FrontLoader(bulkloader.Loader): def __init__(self): bulkloader.Loader.__init__(self, 'Front', [ ('Key', db.Key), # not working. just create new one. ('__key__', db.Key), # same... So, how can I overwrite existing entity which has no 'key_name'? It would be horrible if I should give unique name to all entities..... From the first answer, I could handle this problem. :) def create_entity(self, values, key_name=None, parent=None): # if key_name is None: # print 'key_name is None' # else: # print 'key_name=<',key_name,'> : length=',len(key_name) Validate(values, (list, tuple)) assert len(values) == len(self._Loader__properties), ( 'Expected %d columns, found %d.' % (len(self._Loader__properties), len(values))) model_class = GetImplementationClass(self.kind) properties = { 'key_name': key_name, 'parent': parent, } for (name, converter), val in zip(self._Loader__properties, values): if converter is bool and val.lower() in ('0', 'false', 'no'): val = False properties[name] = converter(val) if key_name is None: entity = model_class(**properties) #print 'create new one' else: entity = model_class.get(key_name) for key, value in properties.items(): setattr(entity, key, value) #print 'overwrite old one' entities = self.handle_entity(entity) if entities: if not isinstance(entities, (list, tuple)): entities = [entities] for entity in entities: if not isinstance(entity, db.Model): raise TypeError('Expected a db.Model, received %s (a %s).' % (entity, entity.__class__)) return entities def generate_key(self,i,values): # first column is key if values[0] is None or values[0] in ('',' ','-','.'): return None return values[0]

    Read the article

  • Partition does not start on physical sector boundary?

    - by jasmines
    I've one HD on my laptop, with two partitions (one ext3 with Ubuntu 12.04 installed and one swap). fdisk is giving me a Partition 1 does not start on physical sector boundary warning. What is the cause and do I need to fix it? If so, how? This is sudo fdisk -l: Disk /dev/sda: 750.2 GB, 750156374016 bytes 255 testine, 63 settori/tracce, 91201 cilindri, totale 1465149168 settori Unità = settori di 1 * 512 = 512 byte Sector size (logical/physical): 512 bytes / 4096 bytes I/O size (minimum/optimal): 4096 bytes / 4096 bytes Identificativo disco: 0x5a25087f Dispositivo Boot Start End Blocks Id System /dev/sda1 * 63 1448577023 724288480+ 83 Linux Partition 1 does not start on physical sector boundary. /dev/sda2 1448577024 1465147391 8285184 82 Linux swap / Solaris This is sudo lshw related result: *-disk description: ATA Disk product: WDC WD7500BPKT-0 vendor: Western Digital physical id: 0 bus info: scsi@0:0.0.0 logical name: /dev/sda version: 01.0 serial: WD-WX21CC1T0847 size: 698GiB (750GB) capabilities: partitioned partitioned:dos configuration: ansiversion=5 signature=5a25087f *-volume:0 description: EXT3 volume vendor: Linux physical id: 1 bus info: scsi@0:0.0.0,1 logical name: /dev/sda1 logical name: / version: 1.0 serial: cc5c562a-bc59-4a37-b589-805b27b2cbd7 size: 690GiB capacity: 690GiB capabilities: primary bootable journaled extended_attributes large_files recover ext3 ext2 initialized configuration: created=2010-02-27 09:18:28 filesystem=ext3 modified=2012-06-23 18:33:59 mount.fstype=ext3 mount.options=rw,relatime,errors=remount-ro,user_xattr,barrier=1,data=ordered mounted=2012-06-28 00:20:47 state=mounted *-volume:1 description: Linux swap volume physical id: 2 bus info: scsi@0:0.0.0,2 logical name: /dev/sda2 version: 1 serial: 16a7fee0-be9e-4e34-9dc3-28f4eeb61bf6 size: 8091MiB capacity: 8091MiB capabilities: primary nofs swap initialized configuration: filesystem=swap pagesize=4096 These are related /etc/fstab lines: UUID=cc5c562a-bc59-4a37-b589-805b27b2cbd7 / ext3 errors=remount-ro,user_xattr 0 1 UUID=16a7fee0-be9e-4e34-9dc3-28f4eeb61bf6 none swap sw 0 0

    Read the article

  • Which things instantly ring alarm bells when looking at code? [closed]

    - by FinnNk
    I attended a software craftsmanship event a couple of weeks ago and one of the comments made was "I'm sure we all recognize bad code when we see it" and everyone nodded sagely without further discussion. This sort of thing always worries me as there's that truism that everyone thinks they're an above average driver. Although I think I can recognize bad code I'd love to learn more about what other people consider to be code smells as it's rarely discussed in detail on people's blogs and only in a handful of books. In particular I think it'd be interesting to hear about anything that's a code smell in one language but not another. I'll start off with an easy one: Code in source control that has a high proportion of commented out code - why is it there? was it meant to be deleted? is it a half finished piece of work? maybe it shouldn't have been commented out and was only done when someone was testing something out? Personally I find this sort of thing really annoying even if it's just the odd line here and there, but when you see large blocks interspersed with the rest of the code it's totally unacceptable. It's also usually an indication that the rest of the code is likely to be of dubious quality as well.

    Read the article

  • Useful WatiN Extension Methods

    - by Steve Wilkes
    I've been doing a fair amount of UI testing using WatiN recently – here’s some extension methods I've found useful. This checks if a WatiN TextField is actually a hidden field. WatiN makes no distinction between text and hidden inputs, so this can come in handy if you render an input sometimes as hidden and sometimes as a visible text field. Note that this doesn't check if an input is visible (I've got another extension method for that in a moment), it checks if it’s hidden. public static bool IsHiddenField(this TextField textField) { if (textField == null || !textField.Exists) { return false; } var textFieldType = textField.GetAttributeValue("type"); return (textFieldType != null) && textFieldType.ToLowerInvariant() == "hidden"; } The next method quickly sets the value of a text field to a given string. By default WatiN types the text you give it into a text field one character at a time which can be necessary if you have behaviour you want to test which is triggered by individual key presses, but which most of time is just painfully slow; this method dumps the text in in one go. Note that if it's not a hidden field then it gives it focus first; this helps trigger validation once the value has been set and focus moves elsewhere. public static void SetText(this TextField textField, string value) { if ((textField == null) || !textField.Exists) { return; } if (!textField.IsHiddenField()) { textField.Focus(); } textField.Value = value; } Finally, here's a method which checks if an Element is currently visible. It does so by walking up the DOM and checking for a Style.Display of 'none' on any element between the one on which the method is invoked, and any of its ancestors. public static bool IsElementVisible(this Element element) { if ((element == null) || !element.Exists) { return false; } while ((element != null) && element.Exists) { if (element.Style.Display.ToLowerInvariant().Contains("none")) { return false; } element = element.Parent; } return true; } Hope they come in handy

    Read the article

  • What is the program "Additional Drivers" (jockey-gtk) talking me about?

    - by Robert Vila
    The program says: "No proprietary drivers are in use on this system" But it doesn't say if it is talking about graphical drivers only or what. Then, it lists two drivers: NVIDIA accelerated graphics driver (version 173). NVIDIA accelerated graphics driver (version current) [recomended] Both have exactly the same description. What is the difference then? When I select the 1st one, it says: "This river is not activated",and there's a button to "activate" it. When I select the 2nd one, it says: "This river is activated but it is not currently in use", and the button is to "remove". So which one is in use? Why or what for should I have activated (enabled) and not in use? If it is in use it is activated? What is the difference between activate and remove? and what is the relationship between installed, activated, in use, enabled and removed, disabled, inactive and not-installed? Why can I activate the inactivated and remove (but not deactivate) the activated that is not in use? All this is very puzzling... What other drivers can I use for an Apple MacBook pro 3,1 and how? I see that there's a nouveau and I heard that there was going to be a new open source even better. > -display > description: VGA compatible controller > product: G84 [GeForce 8600M GT] > vendor: nVidia Corporation

    Read the article

  • How to develop a Windows 8 app in 30 days!

    - by Scott Spradlin
    Begin your 30-day journey to create a Windows Store style app. Sign up to get started and receive: Insider tips and tricks on Windows 8 application development. Personal on-the-phone access to a Windows 8 architect*. An exclusive one-on-one Windows Store design consultation*. An opportunity to get expert help from a Microsoft Services Engineer at an App Excellence Lab. Sign up today and get started. Your new Windows 8 app could be mere days away. * Offer good only to legal residents in the 50 United States & D.C., age 18 or older to hobbyists, professionals or developers in the field of software tech who sign up for building a Windows 8 application on www.generationapp.com. Offer limited to 250 design consultations per month and 500 technical review consultations per month, on a first come first served basis. Limit of one session of each offer type per person. This offer is non-transferable and cannot be combined with any other offer. This offer ends when supplies are exhausted, and is not redeemable for cash.

    Read the article

  • Does LINQ require significantly more processing cycles and memory than lower-level data iteration techniques?

    - by Matthew Patrick Cashatt
    Background I am recently in the process of enduring grueling tech interviews for positions that use the .NET stack, some of which include silly questions like this one, and some questions that are more valid. I recently came across an issue that may be valid but I want to check with the community here to be sure. When asked by an interviewer how I would count the frequency of words in a text document and rank the results, I answered that I would Use a stream object put the text file in memory as a string. Split the string into an array on spaces while ignoring punctuation. Use LINQ against the array to .GroupBy() and .Count(), then OrderBy() said count. I got this answer wrong for two reasons: Streaming an entire text file into memory could be disasterous. What if it was an entire encyclopedia? Instead I should stream one block at a time and begin building a hash table. LINQ is too expensive and requires too many processing cycles. I should have built a hash table instead and, for each iteration, only added a word to the hash table if it didn't otherwise exist and then increment it's count. The first reason seems, well, reasonable. But the second gives me more pause. I thought that one of the selling points of LINQ is that it simply abstracts away lower-level operations like hash tables but that, under the veil, it is still the same implementation. Question Aside from a few additional processing cycles to call any abstracted methods, does LINQ require significantly more processing cycles to accomplish a given data iteration task than a lower-level task (such as building a hash table) would?

    Read the article

  • How to factorize code in Unreal Kismet (i.e. "Material Function"s for Kismet)

    - by Georges Dupéron
    In the Unreal Development Kit, when using the Material Editor, one can factorize frequently-used groups of nodes by creating a Material Function (content Browser ? right-click ? new matrial function, IIRC). When defining the behaviour of some actor in Kismet, one can easily have a dozen nodes involved. If I have many actors that share the same behaviour, then I'll copy-paste these nodes, and change the variables so they point to the other actors. This leads to inconsistencies (a modification in the behaviour of an actor isn't propagated in the copy-pasted nodes), complexity (you end up with hundreds of nodes), and generally useless effort. My question is : Can I create a "kismet function", just like a material function ? Note: I'd rather avoid using UnrealScript. I don't even know where to type UnrealScripts, don't know where the documentation is and more generally don't have enough time to invest in learning UnrealScript. This "kismet function" feature must be usable by graphists (with little programming knowledge). If a (simple) script suffices to add this feature in the Kismet editor, so that one can create several "functions" without using UnrealScript, then fine, but I don't really want to have to write a script each time I want to factorize a few nodes. Thanks for any information !

    Read the article

  • Centrally managing 100+ websites without bankrupting a small company

    - by palintropos
    I'm mainly interested in opinions on the trade-offs between having a single central server all the websites connect to as opposed to each website mirroring a subset of the master database with all the products in it. For example, will I run into severe performance issues (or even security issues, or restrictions) making queries to an offsite database? Will we hit scalability issues we can't handle early on from the sheer bandwidth required to maintain this? If we do go with something like a script that keeps smaller databases (each containing a subset of the central master data) in sync, what sorts of issues will we likely encounter there? I would really like the opinions of people far more knowledgeable than I am regarding the pros and cons of both setups and what headaches we are likely to encounter. CLARIFICATION: This should not be viewed as a question about whether we should implement one database vs multiple databases. This question has been answered numerous times. The question is regarding the pros and cons for a deployment like this having the ability to manage all the websites centrally (one server) vs trying to keep them all in sync if they each have their own db (multiple servers). REAL-WORLD EXAMPLE: We are a t-shirt company, and we have individual websites for our different kinds of t-shirts, but we're looking at a central order management integrated with our single shopping cart (which is ColdFusion + MySQL). Now, let's say we have a t-shirt that's on 10 of our websites and we change an image for it. Ideally we would change that in one place and the change would propagate, but how would we set this up?

    Read the article

  • Hosting and domain registrations for multiple clients under a single hosting account of mine?

    - by letseatfood
    I am finally getting regular work designing, developing, and deploying websites for small businesses and individuals. So far the websites utilize single-user content management systems, so the websites create, as far as I know, minimal load on the shared servers. I have always required that each of my clients purchase annual shared hosting at Dreamhost. For domain registration, I ask that they register with Dreamhost, but some already have a registered domain elsewhere and this is fine with me. I do this so the billing issues are the client's responsibility, not mine. My question is: Since I can register unlimited domains and connect them to my one shared hosting account at Dreamhost, should I not be requiring clients to individually pay for shared hosting and a domain? Should I actually be paying for one hosting account and then hosting all of my client's websites on that account? As I said before, I currently have each client buy their own hosting, because I feel that, for example, if there is high traffic to their site, there would be less a chance of the site going down than if their site was hosted with many others on one account. I am famous for being long-winded, please let me know if I can clarify at all. Thanks!

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • How can I get SLI working with 295.40?

    - by Steve
    I've been doing a lot of googling these last few hours and I'm not having much luck. Perhaps I don't know exactly what I am looking for. I just recently installed Ubuntu 12.04LTS x86_64. Looks beautiful! I have two GTX470's in SLI, and I am finally migrating my desktop over given the hopeful gaming support as of late. My laptop has been enjoying multiple distros of Ubuntu for a couple years now. However, new problems come with unexplored territory, here. At first, I only had one working monitor of my two. Over on nvidia-xconfig I fixed that, but the only solution that actually worked was twinview. Just recently I read here that twinview is not compatible with SLI. Sweet. When I try to tell it, oh hey, use a separate XScreen, configure it the way I want it, click save to configuration file, enter my password, then a sudo restart lightdm, it's broken. One screen blacks or whites out (Couldn't tell you the specific conditions for each, I'm dubious at this point,) and I get this huge error dialogue box upon login. Something about incompatible resolutions if I remember right. Though I am sure I set the resolutions for each screen correctly. Anyway, when I try to enable SLI (sudo nvidia-xconfig --sli=On) despite the fact it hates twinview, unity breaks. The sidebar is there, but only one screen works, the mouse is trapped running along the left edge of it, and the background of the sidebar is a solid blue. Anyway, this ended up being entirely too verbose, I'm sorry, but could anyone part some wisdom please? It would be appreciated!

    Read the article

  • Matrices: Arrays or separate member variables?

    - by bjz
    I'm teaching myself 3D maths and in the process building my own rudimentary engine (of sorts). I was wondering what would be the best way to structure my matrix class. There are a few options: Separate member variables: struct Mat4 { float m11, m12, m13, m14, m21, m22, m23, m24, m31, m32, m33, m34, m41, m42, m43, m44; // methods } A multi-dimensional array: struct Mat4 { float[4][4] m; // methods } An array of vectors struct Mat4 { Vec4[4] m; // methods } I'm guessing there would be positives and negatives to each. From 3D Math Primer for Graphics and Game Development, 2nd Edition p.155: Matrices use 1-based indices, so the first row and column are numbered 1. For example, a12 (read “a one two,” not “a twelve”) is the element in the first row, second column. Notice that this is different from programming languages such as C++ and Java, which use 0-based array indices. A matrix does not have a column 0 or row 0. This difference in indexing can cause some confusion if matrices are stored using an actual array data type. For this reason, it’s common for classes that store small, fixed size matrices of the type used for geometric purposes to give each element its own named member variable, such as float a11, instead of using the language’s native array support with something like float elem[3][3]. So that's one vote for method one. Is this really the accepted way to do things? It seems rather unwieldy if the only benefit would be sticking with the conventional math notation.

    Read the article

  • how to architect this to make it unit testable

    - by SOfanatic
    I'm currently working on a project where I'm receiving an object via web service (WSDL). The overall process is the following: Receive object - add/delete/update parts (or all) of it - and return the object with the changes made. The thing is that sometimes these changes are complicated and there is some logic involved, other databases, other web services, etc. so to facilitate this I'm creating a custom object that mimics the original one but has some enhanced functionality to make some things easier. So I'm trying to have this process: Receive original object - convert/copy it to custom object - add/delete/update - convert/copy it back to original object - return original object. Example: public class Row { public List<Field> Fields { get; set; } public string RowId { get; set; } public Row() { this.Fields = new List<Field>(); } } public class Field { public string Number { get; set; } public string Value { get; set; } } So for example, one of the "actions" to perform on this would be to find all Fields in a Row that match a Value equal to something, and update them with some other value. I have a CustomRow class that represents the Row class, how can I make this class unit testable? Do I have to create an interface ICustomRow to mock it in the unit test? If one of the actions is to sum all of the Values in the Fields that have a Number equal to 10, like this function, how can design the custom class to facilitate unit tests. Sample function: public int Sum(FieldNumber number) { return row.Fields.Where(x => x.FieldNumber.Equals(number)).Sum(x => x.FieldValue); } Am I approaching this the wrong way?

    Read the article

  • Implementing coroutines in Java

    - by JUST MY correct OPINION
    This question is related to my question on existing coroutine implementations in Java. If, as I suspect, it turns out that there is no full implementation of coroutines currently available in Java, what would be required to implement them? As I said in that question, I know about the following: You can implement "coroutines" as threads/thread pools behind the scenes. You can do tricksy things with JVM bytecode behind the scenes to make coroutines possible. The so-called "Da Vinci Machine" JVM implementation has primitives that make coroutines doable without bytecode manipulation. There are various JNI-based approaches to coroutines also possible. I'll address each one's deficiencies in turn. Thread-based coroutines This "solution" is pathological. The whole point of coroutines is to avoid the overhead of threading, locking, kernel scheduling, etc. Coroutines are supposed to be light and fast and to execute only in user space. Implementing them in terms of full-tilt threads with tight restrictions gets rid of all the advantages. JVM bytecode manipulation This solution is more practical, albeit a bit difficult to pull off. This is roughly the same as jumping down into assembly language for coroutine libraries in C (which is how many of them work) with the advantage that you have only one architecture to worry about and get right. It also ties you down to only running your code on fully-compliant JVM stacks (which means, for example, no Android) unless you can find a way to do the same thing on the non-compliant stack. If you do find a way to do this, however, you have now doubled your system complexity and testing needs. The Da Vinci Machine The Da Vinci Machine is cool for experimentation, but since it is not a standard JVM its features aren't going to be available everywhere. Indeed I suspect most production environments would specifically forbid the use of the Da Vinci Machine. Thus I could use this to make cool experiments but not for any code I expect to release to the real world. This also has the added problem similar to the JVM bytecode manipulation solution above: won't work on alternative stacks (like Android's). JNI implementation This solution renders the point of doing this in Java at all moot. Each combination of CPU and operating system requires independent testing and each is a point of potentially frustrating subtle failure. Alternatively, of course, I could tie myself down to one platform entirely but this, too, makes the point of doing things in Java entirely moot. So... Is there any way to implement coroutines in Java without using one of these four techniques? Or will I be forced to use the one of those four that smells the least (JVM manipulation) instead?

    Read the article

  • BoundingSpheres move when they should not

    - by NDraskovic
    I have a XNA 4.0 project in which I load a file that contains type and coordinates of items I need to draw to the screen. Also I need to check if one particular type (the only movable one) is passing in front or trough other items. This is the code I use to load the configuration: if (ks.IsKeyDown(Microsoft.Xna.Framework.Input.Keys.L)) { this.GraphicsDevice.Clear(Color.CornflowerBlue); Otvaranje.ShowDialog(); try { using (StreamReader sr = new StreamReader(Otvaranje.FileName)) { String linija; while ((linija = sr.ReadLine()) != null) { red = linija.Split(','); model = red[0]; x = red[1]; y = red[2]; z = red[3]; elementi.Add(Convert.ToInt32(model)); podatci.Add(new Vector3(Convert.ToSingle(x), Convert.ToSingle(y), Convert.ToSingle(z))); sfere.Add(new BoundingSphere(new Vector3(Convert.ToSingle(x), Convert.ToSingle(y), Convert.ToSingle(z)), 1f)); } } } catch (Exception ex) { Window.Title = ex.ToString(); } } The "Otvaranje" is an OpenFileDialog object, "elementi" is a List (determines the type of item that would be drawn), podatci is a List (determines the location where the items will be drawn) and sfere is a List. Now I solved the picking algorithm (checking for ray and bounding sphere intersection) and it works fine, but the collision detection does not. I noticed, while using picking, that BoundingSphere's move even though the objects that they correspond to do not. The movable object is drawn to the world1 Matrix, and the static objects are drawn into the world2 Matrix (world1 and world2 have the same values, I just separated them so that the static elements would not move when the movable one does). The problem is that when I move the item I want, all boundingSpheres move accordingly. How can I move only the boundingSphere that corresponds to that particular item, and leave the rest where they are?

    Read the article

< Previous Page | 404 405 406 407 408 409 410 411 412 413 414 415  | Next Page >