Search Results

Search found 51125 results on 2045 pages for 'access point'.

Page 409/2045 | < Previous Page | 405 406 407 408 409 410 411 412 413 414 415 416  | Next Page >

  • Use Google Tasks in Thunderbird?

    - by BenA
    I'm using the GDataProvider along with Lightning to access my Google Calendar from Thunderbird. However I'd also like to have access to my Google Tasks as well. Does anybody know if this is possible at present? The GDataProvider wiki suggests that they will support this eventually (they've been stuck waiting for a Tasks API), but I'm wondering if anybody has managed to get this working any other way?

    Read the article

  • Place mail back onto POP server

    - by Nippysaurus
    I have used Entourage to access a POP mailbox where it would delete messages once they had been received, and would now like to use Mail(.app) to read my mail using IMAP. Is it possible to place the messages that Entourage removed from the server back so that Mail can access them?

    Read the article

  • Use-cases for assigning multiple IP addresses to 1 NIC

    - by Harry
    What would be some of major use-cases in which you would want to assign multiple IP addresses to your NIC? Knowing of any standard/well-known 'gotchas' associated with each use-case would also be helpful. For example, I heard someone saying that a user with access to such a machine will automatically get access to both networks, which could be a security issue. You can assume a Linux-based environment.

    Read the article

  • MySQL locking problem

    - by teehoo
    I have a simple setup of a set of writers and a set of readers working with a MySQL ISAM table. The writers are only inserting rows while the readers are only checking for new rows. OK, so I know that I don't need a lock in this situation, since I'm not modifying existing rows. However my Writers are accessing one more table that does need a lock. I piece of information seems irrelevant except for the following limitation stated in the MySQL documentation: A session that requires locks must acquire all the locks that it needs in a single LOCK TABLES statement. While the locks thus obtained are held, the session can access only the locked tables. For example, in the following sequence of statements, an error occurs for the attempt to access t2 because it was not locked in the LOCK TABLES statement: So to access the table I want to insert rows into, I NEED to lock it, which is causing me performance problems. Any suggestions of how to get around this?

    Read the article

  • How to share drive space from vmware server 2 host to a guest?

    - by matnagel
    In the vmware tools in the guest there is an option to access shares from the host. What is the way to create such shares on a vmware 2 host? I did not find where in infrastructure web access. I also went through the vmware server 2 user's guide but did not see it mentioned. Can you help? This is an ubuntu 64 bit server 8.04 LTS host.

    Read the article

  • How do API Keys and Secret Keys work?

    - by viatropos
    I am just starting to think about how api keys and secret keys work. Just 2 days ago I signed up for Amazon S3 and installed the S3Fox Plugin. They asked me for both my Access Key and Secret Access Key, both of which require me to login to access. So I'm wondering, if they're asking me for my secret key, they must be storing it somewhere right? Isn't that basically the same thing as asking me for my credit card numbers or password and storing that in their own database? How are secret keys and api keys supposed to work? How secret do they need to be? Are these applications that use the secret keys storing it somehow? Thanks for the insight.

    Read the article

  • Preferred Method Of Application Purchase

    - by Chuck
    This is more of a "programmers" question, but felt that it was technical enough to belong on Stack Overflow instead. I'm launching an application soon that will follow the shareware model of purchase. I've thought about implementing this in a few ways: Limited access to the application until they purchase Full access to the application but expires after 30 day, requiring them to purchase to retain utility. Full access to the application indefinitely, but with a 10-15 second pop-up box on start-up asking them to register -- like mIRC does (or used to do). The method of authentication will be web-based. I'll provide them with an authentication key and they'll put it in the application. Whenever the application boots up, it'll check my web service and determine whether the application is genuine or not. This isn't my question. My question is: Is there a preferred method of implementation? I'd like to piss off the users as little as possible, but I'd also like to get paid for my work.

    Read the article

  • Google Maps API v3 not working

    - by user1496322
    I've been banging my head on the wall after going through the documentation on this several times! I can't seem to get past the API error to get the map to appear on my site. I am getting the following error message from the web page where I want the map to be displayed: ~~~~~~~~~~~ Google has disabled use of the Maps API for this application. The provided key is not a valid Google API Key, or it is not authorized for the Google Maps Javascript API v3 on this site. If you are the owner of this application, you can learn about obtaining a valid key here: https://developers.google.com/maps/documentation/javascript/tutorial#Obtaining_Key ~~~~~~~~~~~ I have (several times now) gone into my account and 1) enabled the Maps v3 API service. 2) Generated a new API key. and 3) added my allowed referrers to the key. (both www.domain.com and domain.com URLs) I have the following added to the head of the web page: < script src="http://maps.googleapis.com/maps/api/js?sensor=false&key=MY_API_KEY_HERE" type="text/JavaScript" language="JavaScript" And... I have the following javascript function that executes when a link is clicked on the page: alert("viewMap()"); var map = new GMap3(document.getElementById("map_canvas")); var geocoder = new GClientGeocoder(); var address = "1600 Amphitheatre Parkway, Mountain View"; alert("Calling getLatLng ..."); geocoder.getLatLng(address, function(point) { var latitude = point.y; var longitude = point.x; // do something with the lat lng alert("Lat:"+latitude+" - Lng:"+longitude); }); The initial 'viewMap' alert is displayed and then is followed by the 'Google has disbled use...' error message. The error console is also showing 'GMap3 is not defined'. Can anyone please assist with showing me the errors of my ways?!?!? Thank you in advance for any help you can provide. -Dennis

    Read the article

  • How secure is a subnet?

    - by HorusKol
    I have an unfortunate complication in my network - some users/computers are attached to a completely private and firewalled office network that we administer (10.n.n.x/24 intranet), but others are attached to a subnet provided by a third party (129.n.n.x/25) as they need to access the internet via the third party's proxy. I have previously set up a gateway/router to allow the 10.n.n.x/24 network internet access: # Allow established connections, and those !not! coming from the public interface # eth0 = public interface # eth1 = private interface iptables -A INPUT -m state --state ESTABLISHED,RELATED -j ACCEPT iptables -A INPUT -m state --state NEW ! -i eth0 -j ACCEPT iptables -A FORWARD -i eth0 -o eth1 -m state --state ESTABLISHED,RELATED -j ACCEPT # Allow outgoing connections from the private interface iptables -A FORWARD -i eth1 -o eth0 -j ACCEPT # Masquerade (NAT) iptables -t nat -A POSTROUTING -o eth0 -j MASQUERADE # Don't forward any other traffic from the public to the private iptables -A FORWARD -i eth0 -o eth1 -j REJECT However, I now need to enable access to users on our 129.n.n.x/25 subnet to some private servers on the 10.n.n.x/24 network. I figured that I could do something like: # Allow established connections, and those !not! coming from the public interface # eth0 = public interface # eth1 = private interface #1 (10.n.n.x/24) # eth2 = private interface #2 (129.n.n.x/25) iptables -A INPUT -m state --state ESTABLISHED,RELATED -j ACCEPT iptables -A INPUT -m state --state NEW ! -i eth0 -j ACCEPT iptables -A FORWARD -i eth0 -o eth1 -m state --state ESTABLISHED,RELATED -j ACCEPT iptables -A FORWARD -i eth0 -o eth2 -m state --state ESTABLISHED,RELATED -j ACCEPT # Allow outgoing connections from the private interfaces iptables -A FORWARD -i eth1 -o eth0 -j ACCEPT iptables -A FORWARD -i eth2 -o eth0 -j ACCEPT # Allow the two public connections to talk to each other iptables -A FORWARD -i eth1 -o eth2 -j ACCEPT iptables -A FORWARD -i eth2 -o eth1 -j ACCEPT # Masquerade (NAT) iptables -t nat -A POSTROUTING -o eth0 -j MASQUERADE # Don't forward any other traffic from the public to the private iptables -A FORWARD -i eth0 -o eth1 -j REJECT iptables -A FORWARD -i eth0 -o eth2 -j REJECT My concern is that I know that the computers on our 129.n.n.x/25 subnet can be accessed via a VPN through the larger network operated by the provider - therefore, would it be possible for someone on the provider's supernet (correct term? inverse of subnet?) to be able to access our private 10.n.n.x/24 intranet?

    Read the article

  • What signing method to use for public open-source projects?

    - by Irchi
    I'm publishing an open-source library on CodePlex, and want the dll files to have strong names so that they can be added to GAC. What's the best option for signing? Should I use SNK? If so, everyone have access to the key. I don't have a problem with everyone having access, but is it a good approach? Should I use PFX? If so, does it mean that other people downloading the source code are not able to build the solution? What I like to do is that I am the only one person to have access to the key, so that the signed assemblies also have a level of authenticity, but meanwhile don't prevent other developers to download, build, or change the source code for themselves, and be able to post changes for the main project.

    Read the article

  • Cannot call DLL import entry in C# from C++ project. EntryPointNotFoundException

    - by kriau
    I'm trying to call from C# a function in a custom DLL written in C++. However I'm getting the warning during code analysis and the error at runtime: Warning: CA1400 : Microsoft.Interoperability : Correct the declaration of 'SafeNativeMethods.SetHook()' so that it correctly points to an existing entry point in 'wi.dll'. The unmanaged entry point name currently linked to is SetHook. Error: System.EntryPointNotFoundException was unhandled. Unable to find an entry point named 'SetHook' in DLL 'wi.dll'. Both projects wi.dll and C# exe has been compiled in to the same DEBUG folder, both files reside here. There is only one file with the name wi.dll in the whole file system. C++ function definition looks like: #define WI_API __declspec(dllexport) bool WI_API SetHook(); I can see exported function using Dependency Walker: as decorated: bool SetHook(void) as undecorated: ?SetHook@@YA_NXZ C# DLL import looks like (I've defined these lines using CLRInsideOut from MSDN magazine): [DllImport("wi.dll", EntryPoint = "SetHook", CallingConvention = CallingConvention.Cdecl)] [return: MarshalAsAttribute(UnmanagedType.I1)] internal static extern bool SetHook(); I've tried without EntryPoint and CallingConvention definitions as well. Both projects are 32-bits, I'm using W7 64 bits, VS 2010 RC. I believe that I simply have overlooked something.... Thanks in advance.

    Read the article

  • Local IP address same as Google's external

    - by GRIGORE-TURBODISEL
    I'm exampling Google's IPs, but you get the idea. What happens if somebody configures a router's LAN address pool to range from 62.231.75.2 to 62.231.75.255, then his computer's IP address to 62.231.75.232 and someone else on the network tries to access Google? Or better off, is there any case in which someone in that network can, by merely attempting to access Google, accidentally bump into another computer on the network?

    Read the article

  • Is there a way to set windows 2008 file and folder sharing permission so you only get prompted for a

    - by Matt
    Is there a way to set windows 2008 file and folder sharing permission so you only get prompted for a password on certain shares? That is, right now, when I got to \theserver\ I get prompted for a password despite having some shared folders that permit anonymous access. Is there a way, asides from setting the policy sharing model to guest rather than Classic to allow a user from a non-domain pc to go to \theserver\ and see the shares and permit him or her to enter a folder with anonymous access without having to enter a username or password?

    Read the article

  • How should I configure postfix to avoid sent emails bouncing because of "Invalid HELO name"

    - by Vlad Socaciu
    Some mail sent from sites on my server bounce back with the following mail.log message Nov 26 17:27:53 blogu postfix/smtp[16858]: C4DD22908EC0: to=, relay=rejecting-domain.ro[rejecting-ip]:25, delay=2.5, delays=0.1/0/2.3/0.04, dsn=5.0.0, status=bounced (host rejecting-domain.ro[rejecting-ip] said: 550 Access denied - Invalid HELO name (See RFC2821 4.1.1.1) (in reply to MAIL FROM command)) On the receiving end, my emails are logged like this: 2011-11-22 15:09:35 H=static.39.80.4.46.clients.your-server.de (Ubuntu-1004-lucid-64-minimal) [my-server-ip] rejected MAIL : Access denied - Invalid HELO name (See RFC2821 4.1.1.1)

    Read the article

  • trouble accessing localhost from ie7 running on parallels (win xp) on mac os x

    - by Karl R
    I'm running the app engine devserver on localhost:8080, and want to access it from ie7 running on parallels. I've tried all of the tips here: http://stackoverflow.com/questions/61449/how-do-i-access-the-host-from-vmware-fusion And they seem like they should work, particularly accessing via the gateway ip address. I've also sudo ipfw add allow tcp from 8080 to 8089 for good measure. Still no dice. I can access the external internet from ie7. The connection settings on parallels are set to 'Shared networking'. I'm out of ideas.

    Read the article

  • R: How can I use apply on rows of a data.frame and get out $column_name?

    - by John
    I'm trying to access $a using the following example: df<-data.frame(a=c("x","x","y","y"),b=c(1,2,3,4)) > df a b 1 x 1 2 x 2 3 y 3 4 y 4 test_fun <- function (data.frame_in) { print (data.frame_in[1]) } I can now access $a if I use an index for the first column: apply(df, 1, test_fun) a "x" a "x" a "y" a "y" [1] "x" "x" "y" "y" But I cannot access column $a with the $ notation: error: "$ operator is invalid for atomic vectors" test_fun_2 <- function (data.frame_in) { print (data.frame_in$a) } >apply(df, 1, test_fun_2) Error in data.frame_in$a : $ operator is invalid for atomic vectors Is this not possible?

    Read the article

  • Squid free domain prompt authentication

    - by Tobia
    i have a squid proxy, i would like to leave free access (without proxy login prompt) to some domains and request a user login for all other domains. I tried this configuration: http_access allow allowDomains http_access deny !loggedUser where allowDomains is an acl with all free-domains, and loggedUsers is the user authentication acl. With this configuration i can access free domains also with an empty login, but what i would like to do is to not ask authentication at all (no prompt)... how can i do? Thanks.

    Read the article

  • Multithread Communication

    - by Robert
    I'm creating a WPF application that uses a custom object to populate all the controls. The constructor of that object is initiated by an EventHandler that waits for an API. The problem I'm having is when I try to access any information from that object using a button for example, it returns an error saying "The calling thread cannot access this object because a different thread owns it". I'm assuming this is because the EventHandler creates a new thread which doesn't allow the MainThread to have access to it. Any ideas on how to get around this?

    Read the article

  • How to make some functions of a class as private for third level of inheritance.

    - by Shantanu Gupta
    I have created a class say A which has some functions defined as protected. Now Class B inherits A and class C inherits B. Class A has private default constructor and protected parameterized constructor. I want Class B to be able to access all the protected functions defined in Class A but class C can have access on some of the functions only not all the functions and class C is inheriting class B. How can I restrict access to some of the functions of Class A from Class C ? Class A { private A(){} protected A(int ){} protected calc(){} protected allow(){} } Class B : A {} // calc() and allow() should be accessible here CLass C:B { // calc() should not be accessible here but allow() should be accessible here. }

    Read the article

  • Why doesn't this data binding work?

    - by Qwertie
    I have a ViewModel class that contains a list of points, and I am trying to bind it to a Polyline. The Polyline picks up the initial list of points, but does not notice when additional points are added even though I implement INotifyPropertyChanged. What's wrong? <StackPanel> <Button Click="Button_Click">Add!</Button> <Polyline x:Name="_line" Points="{Binding Pts}" Stroke="Black" StrokeThickness="5"/> </StackPanel> C# side: // code-behind _line.DataContext = new ViewModel(); private void Button_Click(object sender, RoutedEventArgs e) { // The problem is here: NOTHING HAPPENS ON-SCREEN! ((ViewModel)_line.DataContext).AddPoint(); } // ViewModel class public class ViewModel : INotifyPropertyChanged { public event PropertyChangedEventHandler PropertyChanged; public PointCollection Pts { get; set; } public ViewModel() { Pts = new PointCollection(); Pts.Add(new Point(1, 1)); Pts.Add(new Point(11, 11)); } public void AddPoint() { Pts.Add(new Point(25, 13)); if (PropertyChanged != null) PropertyChanged(this, new PropertyChangedEventArgs("Pts")); } }

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Can a browser maintain multiple sessions with one server?

    - by Blaine
    Is there a way to maintain multiple sessions with one server within the browser? Here is what I am trying to accomplish: User1 has exclusive access to ContentA and User2 has exclusive access to ContentB. I want to be able to allow User3 to login multiple times, to allow access to ContentA and ContentB. I admit that this scenario seems almost silly but it stems from the fact that I can't change the way the server handles content permissions. Any ideas on how I could accomplish this without touching the server? In say Safari on the iPhone?

    Read the article

  • Is there a way to create a cmd shortcut for a specific folder on W7 or/and W8?

    - by Hinstein
    Let say i have 3 different folders that i want to access with CMD C:\Users\Henok\Documents\Visual Studio 2012\Projects\TestApp1\Debug C:\Users\Henok\Documents\Visual Studio 2012\Projects\TestApp2\Debug C:\Users\Henok\Documents\Visual Studio 2012\Projects\TestApp3\Debug I wonder if there is a way to create 3 different cmd shortcuts to access those directory (folders) individually without changing the default cmd directory location. Forgive me for my broken English, and thanks for your time.

    Read the article

< Previous Page | 405 406 407 408 409 410 411 412 413 414 415 416  | Next Page >