Search Results

Search found 93631 results on 3746 pages for 'chaotic one'.

Page 410/3746 | < Previous Page | 406 407 408 409 410 411 412 413 414 415 416 417  | Next Page >

  • Useful WatiN Extension Methods

    - by Steve Wilkes
    I've been doing a fair amount of UI testing using WatiN recently – here’s some extension methods I've found useful. This checks if a WatiN TextField is actually a hidden field. WatiN makes no distinction between text and hidden inputs, so this can come in handy if you render an input sometimes as hidden and sometimes as a visible text field. Note that this doesn't check if an input is visible (I've got another extension method for that in a moment), it checks if it’s hidden. public static bool IsHiddenField(this TextField textField) { if (textField == null || !textField.Exists) { return false; } var textFieldType = textField.GetAttributeValue("type"); return (textFieldType != null) && textFieldType.ToLowerInvariant() == "hidden"; } The next method quickly sets the value of a text field to a given string. By default WatiN types the text you give it into a text field one character at a time which can be necessary if you have behaviour you want to test which is triggered by individual key presses, but which most of time is just painfully slow; this method dumps the text in in one go. Note that if it's not a hidden field then it gives it focus first; this helps trigger validation once the value has been set and focus moves elsewhere. public static void SetText(this TextField textField, string value) { if ((textField == null) || !textField.Exists) { return; } if (!textField.IsHiddenField()) { textField.Focus(); } textField.Value = value; } Finally, here's a method which checks if an Element is currently visible. It does so by walking up the DOM and checking for a Style.Display of 'none' on any element between the one on which the method is invoked, and any of its ancestors. public static bool IsElementVisible(this Element element) { if ((element == null) || !element.Exists) { return false; } while ((element != null) && element.Exists) { if (element.Style.Display.ToLowerInvariant().Contains("none")) { return false; } element = element.Parent; } return true; } Hope they come in handy

    Read the article

  • Centrally managing 100+ websites without bankrupting a small company

    - by palintropos
    I'm mainly interested in opinions on the trade-offs between having a single central server all the websites connect to as opposed to each website mirroring a subset of the master database with all the products in it. For example, will I run into severe performance issues (or even security issues, or restrictions) making queries to an offsite database? Will we hit scalability issues we can't handle early on from the sheer bandwidth required to maintain this? If we do go with something like a script that keeps smaller databases (each containing a subset of the central master data) in sync, what sorts of issues will we likely encounter there? I would really like the opinions of people far more knowledgeable than I am regarding the pros and cons of both setups and what headaches we are likely to encounter. CLARIFICATION: This should not be viewed as a question about whether we should implement one database vs multiple databases. This question has been answered numerous times. The question is regarding the pros and cons for a deployment like this having the ability to manage all the websites centrally (one server) vs trying to keep them all in sync if they each have their own db (multiple servers). REAL-WORLD EXAMPLE: We are a t-shirt company, and we have individual websites for our different kinds of t-shirts, but we're looking at a central order management integrated with our single shopping cart (which is ColdFusion + MySQL). Now, let's say we have a t-shirt that's on 10 of our websites and we change an image for it. Ideally we would change that in one place and the change would propagate, but how would we set this up?

    Read the article

  • What is the program "Additional Drivers" (jockey-gtk) talking me about?

    - by Robert Vila
    The program says: "No proprietary drivers are in use on this system" But it doesn't say if it is talking about graphical drivers only or what. Then, it lists two drivers: NVIDIA accelerated graphics driver (version 173). NVIDIA accelerated graphics driver (version current) [recomended] Both have exactly the same description. What is the difference then? When I select the 1st one, it says: "This river is not activated",and there's a button to "activate" it. When I select the 2nd one, it says: "This river is activated but it is not currently in use", and the button is to "remove". So which one is in use? Why or what for should I have activated (enabled) and not in use? If it is in use it is activated? What is the difference between activate and remove? and what is the relationship between installed, activated, in use, enabled and removed, disabled, inactive and not-installed? Why can I activate the inactivated and remove (but not deactivate) the activated that is not in use? All this is very puzzling... What other drivers can I use for an Apple MacBook pro 3,1 and how? I see that there's a nouveau and I heard that there was going to be a new open source even better. > -display > description: VGA compatible controller > product: G84 [GeForce 8600M GT] > vendor: nVidia Corporation

    Read the article

  • How to develop a Windows 8 app in 30 days!

    - by Scott Spradlin
    Begin your 30-day journey to create a Windows Store style app. Sign up to get started and receive: Insider tips and tricks on Windows 8 application development. Personal on-the-phone access to a Windows 8 architect*. An exclusive one-on-one Windows Store design consultation*. An opportunity to get expert help from a Microsoft Services Engineer at an App Excellence Lab. Sign up today and get started. Your new Windows 8 app could be mere days away. * Offer good only to legal residents in the 50 United States & D.C., age 18 or older to hobbyists, professionals or developers in the field of software tech who sign up for building a Windows 8 application on www.generationapp.com. Offer limited to 250 design consultations per month and 500 technical review consultations per month, on a first come first served basis. Limit of one session of each offer type per person. This offer is non-transferable and cannot be combined with any other offer. This offer ends when supplies are exhausted, and is not redeemable for cash.

    Read the article

  • How to factorize code in Unreal Kismet (i.e. "Material Function"s for Kismet)

    - by Georges Dupéron
    In the Unreal Development Kit, when using the Material Editor, one can factorize frequently-used groups of nodes by creating a Material Function (content Browser ? right-click ? new matrial function, IIRC). When defining the behaviour of some actor in Kismet, one can easily have a dozen nodes involved. If I have many actors that share the same behaviour, then I'll copy-paste these nodes, and change the variables so they point to the other actors. This leads to inconsistencies (a modification in the behaviour of an actor isn't propagated in the copy-pasted nodes), complexity (you end up with hundreds of nodes), and generally useless effort. My question is : Can I create a "kismet function", just like a material function ? Note: I'd rather avoid using UnrealScript. I don't even know where to type UnrealScripts, don't know where the documentation is and more generally don't have enough time to invest in learning UnrealScript. This "kismet function" feature must be usable by graphists (with little programming knowledge). If a (simple) script suffices to add this feature in the Kismet editor, so that one can create several "functions" without using UnrealScript, then fine, but I don't really want to have to write a script each time I want to factorize a few nodes. Thanks for any information !

    Read the article

  • Does LINQ require significantly more processing cycles and memory than lower-level data iteration techniques?

    - by Matthew Patrick Cashatt
    Background I am recently in the process of enduring grueling tech interviews for positions that use the .NET stack, some of which include silly questions like this one, and some questions that are more valid. I recently came across an issue that may be valid but I want to check with the community here to be sure. When asked by an interviewer how I would count the frequency of words in a text document and rank the results, I answered that I would Use a stream object put the text file in memory as a string. Split the string into an array on spaces while ignoring punctuation. Use LINQ against the array to .GroupBy() and .Count(), then OrderBy() said count. I got this answer wrong for two reasons: Streaming an entire text file into memory could be disasterous. What if it was an entire encyclopedia? Instead I should stream one block at a time and begin building a hash table. LINQ is too expensive and requires too many processing cycles. I should have built a hash table instead and, for each iteration, only added a word to the hash table if it didn't otherwise exist and then increment it's count. The first reason seems, well, reasonable. But the second gives me more pause. I thought that one of the selling points of LINQ is that it simply abstracts away lower-level operations like hash tables but that, under the veil, it is still the same implementation. Question Aside from a few additional processing cycles to call any abstracted methods, does LINQ require significantly more processing cycles to accomplish a given data iteration task than a lower-level task (such as building a hash table) would?

    Read the article

  • How can I get SLI working with 295.40?

    - by Steve
    I've been doing a lot of googling these last few hours and I'm not having much luck. Perhaps I don't know exactly what I am looking for. I just recently installed Ubuntu 12.04LTS x86_64. Looks beautiful! I have two GTX470's in SLI, and I am finally migrating my desktop over given the hopeful gaming support as of late. My laptop has been enjoying multiple distros of Ubuntu for a couple years now. However, new problems come with unexplored territory, here. At first, I only had one working monitor of my two. Over on nvidia-xconfig I fixed that, but the only solution that actually worked was twinview. Just recently I read here that twinview is not compatible with SLI. Sweet. When I try to tell it, oh hey, use a separate XScreen, configure it the way I want it, click save to configuration file, enter my password, then a sudo restart lightdm, it's broken. One screen blacks or whites out (Couldn't tell you the specific conditions for each, I'm dubious at this point,) and I get this huge error dialogue box upon login. Something about incompatible resolutions if I remember right. Though I am sure I set the resolutions for each screen correctly. Anyway, when I try to enable SLI (sudo nvidia-xconfig --sli=On) despite the fact it hates twinview, unity breaks. The sidebar is there, but only one screen works, the mouse is trapped running along the left edge of it, and the background of the sidebar is a solid blue. Anyway, this ended up being entirely too verbose, I'm sorry, but could anyone part some wisdom please? It would be appreciated!

    Read the article

  • Matrices: Arrays or separate member variables?

    - by bjz
    I'm teaching myself 3D maths and in the process building my own rudimentary engine (of sorts). I was wondering what would be the best way to structure my matrix class. There are a few options: Separate member variables: struct Mat4 { float m11, m12, m13, m14, m21, m22, m23, m24, m31, m32, m33, m34, m41, m42, m43, m44; // methods } A multi-dimensional array: struct Mat4 { float[4][4] m; // methods } An array of vectors struct Mat4 { Vec4[4] m; // methods } I'm guessing there would be positives and negatives to each. From 3D Math Primer for Graphics and Game Development, 2nd Edition p.155: Matrices use 1-based indices, so the first row and column are numbered 1. For example, a12 (read “a one two,” not “a twelve”) is the element in the first row, second column. Notice that this is different from programming languages such as C++ and Java, which use 0-based array indices. A matrix does not have a column 0 or row 0. This difference in indexing can cause some confusion if matrices are stored using an actual array data type. For this reason, it’s common for classes that store small, fixed size matrices of the type used for geometric purposes to give each element its own named member variable, such as float a11, instead of using the language’s native array support with something like float elem[3][3]. So that's one vote for method one. Is this really the accepted way to do things? It seems rather unwieldy if the only benefit would be sticking with the conventional math notation.

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Implementing coroutines in Java

    - by JUST MY correct OPINION
    This question is related to my question on existing coroutine implementations in Java. If, as I suspect, it turns out that there is no full implementation of coroutines currently available in Java, what would be required to implement them? As I said in that question, I know about the following: You can implement "coroutines" as threads/thread pools behind the scenes. You can do tricksy things with JVM bytecode behind the scenes to make coroutines possible. The so-called "Da Vinci Machine" JVM implementation has primitives that make coroutines doable without bytecode manipulation. There are various JNI-based approaches to coroutines also possible. I'll address each one's deficiencies in turn. Thread-based coroutines This "solution" is pathological. The whole point of coroutines is to avoid the overhead of threading, locking, kernel scheduling, etc. Coroutines are supposed to be light and fast and to execute only in user space. Implementing them in terms of full-tilt threads with tight restrictions gets rid of all the advantages. JVM bytecode manipulation This solution is more practical, albeit a bit difficult to pull off. This is roughly the same as jumping down into assembly language for coroutine libraries in C (which is how many of them work) with the advantage that you have only one architecture to worry about and get right. It also ties you down to only running your code on fully-compliant JVM stacks (which means, for example, no Android) unless you can find a way to do the same thing on the non-compliant stack. If you do find a way to do this, however, you have now doubled your system complexity and testing needs. The Da Vinci Machine The Da Vinci Machine is cool for experimentation, but since it is not a standard JVM its features aren't going to be available everywhere. Indeed I suspect most production environments would specifically forbid the use of the Da Vinci Machine. Thus I could use this to make cool experiments but not for any code I expect to release to the real world. This also has the added problem similar to the JVM bytecode manipulation solution above: won't work on alternative stacks (like Android's). JNI implementation This solution renders the point of doing this in Java at all moot. Each combination of CPU and operating system requires independent testing and each is a point of potentially frustrating subtle failure. Alternatively, of course, I could tie myself down to one platform entirely but this, too, makes the point of doing things in Java entirely moot. So... Is there any way to implement coroutines in Java without using one of these four techniques? Or will I be forced to use the one of those four that smells the least (JVM manipulation) instead?

    Read the article

  • Hosting and domain registrations for multiple clients under a single hosting account of mine?

    - by letseatfood
    I am finally getting regular work designing, developing, and deploying websites for small businesses and individuals. So far the websites utilize single-user content management systems, so the websites create, as far as I know, minimal load on the shared servers. I have always required that each of my clients purchase annual shared hosting at Dreamhost. For domain registration, I ask that they register with Dreamhost, but some already have a registered domain elsewhere and this is fine with me. I do this so the billing issues are the client's responsibility, not mine. My question is: Since I can register unlimited domains and connect them to my one shared hosting account at Dreamhost, should I not be requiring clients to individually pay for shared hosting and a domain? Should I actually be paying for one hosting account and then hosting all of my client's websites on that account? As I said before, I currently have each client buy their own hosting, because I feel that, for example, if there is high traffic to their site, there would be less a chance of the site going down than if their site was hosted with many others on one account. I am famous for being long-winded, please let me know if I can clarify at all. Thanks!

    Read the article

  • how to architect this to make it unit testable

    - by SOfanatic
    I'm currently working on a project where I'm receiving an object via web service (WSDL). The overall process is the following: Receive object - add/delete/update parts (or all) of it - and return the object with the changes made. The thing is that sometimes these changes are complicated and there is some logic involved, other databases, other web services, etc. so to facilitate this I'm creating a custom object that mimics the original one but has some enhanced functionality to make some things easier. So I'm trying to have this process: Receive original object - convert/copy it to custom object - add/delete/update - convert/copy it back to original object - return original object. Example: public class Row { public List<Field> Fields { get; set; } public string RowId { get; set; } public Row() { this.Fields = new List<Field>(); } } public class Field { public string Number { get; set; } public string Value { get; set; } } So for example, one of the "actions" to perform on this would be to find all Fields in a Row that match a Value equal to something, and update them with some other value. I have a CustomRow class that represents the Row class, how can I make this class unit testable? Do I have to create an interface ICustomRow to mock it in the unit test? If one of the actions is to sum all of the Values in the Fields that have a Number equal to 10, like this function, how can design the custom class to facilitate unit tests. Sample function: public int Sum(FieldNumber number) { return row.Fields.Where(x => x.FieldNumber.Equals(number)).Sum(x => x.FieldValue); } Am I approaching this the wrong way?

    Read the article

  • java web application best practices

    - by Bruce
    Hi all I'm trying to figure out the optimum way to develop and release a fairly simple web application, and I'm running into several problems. I'll outline the decisions I've made, because somewhere I've clearly gone off the rails.. Hugely grateful for any help! I have what I think is a fairly simple web application. It contains a couple of jsps that reference a couple of java beans, and the usual static html, js, css and images. Decision 1) I wanted to have a clear and clean release procedure, such that I could develop on my local machine and then release reliably to a production machine. I therefore made the decision to package the application into a war file (including all the static resources), to minimize the separate bits and pieces I would need to release. So far so good? Decision 2) I wanted things on my local machine to be as similar as possible to the production environment. So in my html, for example, I may have a reference to a static file such as http://static.foo.com/file . To keep this code working seamlessly on dev and prod, I decided to put static.foo.com in my /etc/hosts when developing locally, so that all the urls work correctly without changing anything. Decision 3) I decided to use eclipse and maven to give me a best practice environment for administering and building my project. So I have a nice tight set up now, except that: Every time I want to change anything in development, like one line in an html file, I have to rebuild the entire project and then wait for tomcat to load the war before I can see if it's what I wanted. So my questions are: 1) Is there a way to connect up eclipse and tomcat so that I don't have to rebuild the war each time? ie tomcat is looking straight at my actual workspace to serve up the static files? 2)I think I'm maybe making things harder by using /etc/hosts to reflect production urls - is there a better way that doesn't involve manually changing over urls (relative urls are fine of course, but where you have many subdomains, say one for static files and one for dynamic, you have to write out the full path, surely?) 3) Is this really best practice?? How do people set things up so that they balance the requirement for an automated, all-encompassing build process on the one hand, and the speed and flexibility to be able to develop javascript and html and css quickly, as quickly as if one just pointed apache at the directory and developed live? What do people find works? Many thanks!

    Read the article

  • Sharing password-protected videos on social media

    - by PaulJ
    We are developing a site where users will be able to watch and download videos that they've recorded of themselves in a public event. The videos will be password protected, and will be available only to users who have paid for them at the event... ...But on the other hand, we also want users to share those videos on social media, since they will be an attractive publicity for our events. Having people log into our site with their password, download the video and then re-upload it to Youtube/Facebook will be too cumbersome, and I suspect that few users will be willing to do that. So the obvious alternative is to have one of those convenient "share" buttons, but the problem with that approach will be that: The video will be physically hosted (and linked to) in our site. What happens if those videos go viral and our bandwidth cost explodes? The video is password protected. The solution I've thought of for this is: Upload the user's video to our (password-protected site) and to Youtube at the same time, as an unlisted video. The user can access our site with his password and download his video (to watch on his TV or whatever). If the users hits the "share" button, we show him the Youtube link... and we turn the video into a listed one. This seems in line with the ideas in Using YouTube as a CDN, and there didn't seem to be any objections in that question. I'm posting this just to confirm that my idea doesn't violate any Youtube TOS, and also to see if it is a good one or there might be better alternatives.

    Read the article

  • BoundingSpheres move when they should not

    - by NDraskovic
    I have a XNA 4.0 project in which I load a file that contains type and coordinates of items I need to draw to the screen. Also I need to check if one particular type (the only movable one) is passing in front or trough other items. This is the code I use to load the configuration: if (ks.IsKeyDown(Microsoft.Xna.Framework.Input.Keys.L)) { this.GraphicsDevice.Clear(Color.CornflowerBlue); Otvaranje.ShowDialog(); try { using (StreamReader sr = new StreamReader(Otvaranje.FileName)) { String linija; while ((linija = sr.ReadLine()) != null) { red = linija.Split(','); model = red[0]; x = red[1]; y = red[2]; z = red[3]; elementi.Add(Convert.ToInt32(model)); podatci.Add(new Vector3(Convert.ToSingle(x), Convert.ToSingle(y), Convert.ToSingle(z))); sfere.Add(new BoundingSphere(new Vector3(Convert.ToSingle(x), Convert.ToSingle(y), Convert.ToSingle(z)), 1f)); } } } catch (Exception ex) { Window.Title = ex.ToString(); } } The "Otvaranje" is an OpenFileDialog object, "elementi" is a List (determines the type of item that would be drawn), podatci is a List (determines the location where the items will be drawn) and sfere is a List. Now I solved the picking algorithm (checking for ray and bounding sphere intersection) and it works fine, but the collision detection does not. I noticed, while using picking, that BoundingSphere's move even though the objects that they correspond to do not. The movable object is drawn to the world1 Matrix, and the static objects are drawn into the world2 Matrix (world1 and world2 have the same values, I just separated them so that the static elements would not move when the movable one does). The problem is that when I move the item I want, all boundingSpheres move accordingly. How can I move only the boundingSphere that corresponds to that particular item, and leave the rest where they are?

    Read the article

  • why doesn't my computer resume after sleeping overnight?

    - by bamdad
    i'm having a weird, weird bug that's been haunting me since 11.10. if i listen to music or watch a video and my computer automatically goes to sleep at night, it won't properly resume in the morning. otherwise, suspend and resume works just fine. what happens is that the wi-fi and bluetooth indicator (that turns from white to orange when suspending) stays orange, the display doesn't turn on, and the only option i have is to hard reset the machine. here's what i've tried so far: installing (and uninstalling and reinstalling) laptop-mode-tools switching the proprietary wireless driver (broadcom-wl) to the open source one (brcmsmac & bcma) and back unloading (and blacklisting) all bluetooth modules (rfcomm, btusb, bnep, bluetooth) and stopping (# stop bluetooth) and disabling (# echo 'manual' /etc/init/bluetooth.override) the bluetooth service creating a custom pm sleep action as suggested here: http://ubuntuforums.org/showthread.php?p=11926504 not watching youtube / any stuff that uses flash before going to sleep (i have flashblock, and i checked $ ps aux | grep flash) because i suspected flash to be the culprit trying out different versions of fglrx (the one from the repos, then installing the latest one from amd's site via generated .deb files, then back to the official ones) none of these worked. i remember back in the days of 10.04, there was a gconf key called network sleep: i thought about disabling that, since re-enabling the wireless card seems to be the problem (according to the indicator led), but the option appears to be missing from gnome 3 (unity-2d, whatever). does anyone have any ideas? thanks, bamdad

    Read the article

  • Leadership Tip&ndash;Vent Up!

    - by D'Arcy Lussier
    Leadership is difficult, for many reasons. One of those reasons is that we not only need to keep ourselves motivated when difficult or challenging times come, but we also need to motivate our teams and keep them focussed on the tasks at hand regardless of the mortars being rained down around them. Inexperienced (and experienced) leaders can fall into the “me-too” mentality – that is, the leader sees themselves as part of the team member instead of the leader of the team. Once a leader changes the teams view that he/she is a peer and not the leader, dynamics can change on the team. One of the biggest dangers is that the leader starts sharing frustrations, fears, concerns, etc. with the team that they’re supposed to be leading on to victory. This can destroy a team’s morale and productivity. One simple thing you can do to counter this is remember this rule when it comes to venting: Vent Up! Don’t vent sideways or down, vent up. Vent to the people above you – they’re the ones that tend to have the power to actually change things anyway. You as a leader stay healthy by getting your frustrations and concerns off your chest, your team is still insulated from it, and your superiors are aware of issues that need to be addressed or can coach you through the obstacles. D

    Read the article

  • Assigning a script to a keystroke to toggle touchpad

    - by sodiumnitrate
    Since my default sony vaio shortcuts don't completely work in Ubuntu 12.04, I'd like to assign a script to Fn + F1, which toggles the touchpad on and off, so that the cursor would stop moving while I'm typing. Since I use a mouse and rarely need to use the touchpad, I don't want to use "disable touchpad while writing", which doesn't really seem to work anyway. I figured that using a script with the following command (this works, but I have to open up a terminal each time): xinput set-prop 12 "Device Enabled" 0 I have two problems at this point. One is that I don't know how to write this script so that it will toggle it off if it is on, and on if it is off. I know I should use an if statement but I don't know what value I should be checking to see if it is on or off. The second one is that I am having problems creating a new shortcut. I use System Settings - Keyboard - Shortcuts. I tried to add, to custom shortcuts, a new one by clicking the '+' sign. I named it Toggle Touchpad, and added the path to the executable script with the line above, by typing /home/irem/.toggletouchpad I have made it an executable with chmod. The problem is that when I click apply, and then click back on it to define the keystroke, it re-opens the dialogue. I cannot define new keys. (It says disabled on the right column of the entry). I have also tried xbindkeys, which almost constantly crashes. I'd prefer the system settings, if I can set the shortcut. I'd appreciate if anyone can help. Thanks.

    Read the article

  • How do I update with a newly-created detached entity using NHibernate?

    - by Daniel T.
    Explanation: Let's say I have an object graph that's nested several levels deep and each entity has a bi-directional relationship with each other. A -> B -> C -> D -> E Or in other words, A has a collection of B and B has a reference back to A, and B has a collection of C and C has a reference back to B, etc... Now let's say I want to edit some data for an instance ofC. In Winforms, I would use something like this: var instanceOfC; using (var session = SessionFactory.OpenSession()) { // get the instance of C with Id = 3 instanceOfC = session.Linq<C>().Where(x => x.Id == 3); } SendToUIAndLetUserUpdateData(instanceOfC); using (var session = SessionFactory.OpenSession()) { // re-attach the detached entity and update it session.Update(instanceOfC); } In plain English, we grab a persistent instance out of the database, detach it, give it to the UI layer for editing, then re-attach it and save it back to the database. Problem: This works fine for Winform applications because we're using the same entity all throughout, the only difference being that it goes from persistent to detached to persistent again. The problem occurs when I'm using a web service and a browser, sending over JSON data. In this case, the data that comes back is no longer a detached entity, but rather a transient one that just happens to have the same ID as the persistent one. If I use this entity to update, it will wipe out the relationship to B and D unless I sent the entire object graph over to the UI and got it back in one piece. Question: My question is, how do I serialize detached entities over the web, receive them back, and save them, while preserving any relationships that I didn't explicitly change? I know about ISession.SaveOrUpdateCopy and ISession.Merge() (they seem to do the same thing?), but this will still wipe out the relationships if I don't explicitly set them. I could copy the fields from the transient entity to the persistent entity one by one, but this doesn't work too well when it comes to relationships and I'd have to handle version comparisons manually.

    Read the article

  • Performance impact of Zones.

    - by nospam(at)example.com (Joerg Moellenkamp)
    I was really astonished when i saw this question. Because this question was a old acquaintance from years ago, that i didn't heard for a long time. However there was it again. The question: "What's the overhead of Zones?". Sun was and Oracle is not saying "zero". We saying saying minimal. However during all the performance analysis gigs on customer systems i made since the introduction of Zones i failed to measure any overhead caused by zones. What i saw however, was additional load intoduced by processes that wouldn't be there when you would use only one zone Like additional monitoring daemons, like additional daemons having a controlling or supervising job for the application that resulted in slighly longer runtimes of processes, because such additional daemons wanted some cycles on the CPU as well. So i ask when someone wants to tell me that he measured a slight slowdown, if he or she has really measured the impact of the virtualization layer or of a side effect described above. It seems to be a little bit hard to believe, that a virtualisation technology has no overhead, however keep in mind that there is no hypervisor and just one kernel running that looks and behaves like many operating system instances to apps and users. While this imposes some limits to the technology (because there is just one kernel running you can't have zones with different kernels versions running ... obvious even to the cursory observer), but that is key to it's lightweightness and thus to the low overhead. Continue reading "Performance impact of Zones."

    Read the article

  • Is it a good programming practice to have a class with several .h files?

    - by Jim Thio
    I suppose the class have several different interfaces. Some it shows to some class, some it shows to other classes. Are there any good reason for that? One thing I can think of is with one .h per class, interface would either be public or private. What about if I want some interface to be available to some friends' class and some interface to be truly public? Sample: @interface listNewController:BadgerStandardViewViewController <UITableViewDelegate,UITableViewDataSource,UITextFieldDelegate,NSFetchedResultsControllerDelegate,UIScrollViewDelegate,UIGestureRecognizerDelegate> { } @property (nonatomic) IBOutlet NSFetchedResultsController *FetchController; @property (nonatomic) IBOutlet UITextField *searchBar1; @property (nonatomic) IBOutlet UITableView *tableViewA; + (listNewController *) singleton; //For Easier Access -(void)collapseAll; -(void)TitleViewClicked:(TitleView *) theTitleView; -(NSUInteger) countOfEachSection:(NSInteger)section; @end Many of those public properties and function are only ever called by just one other classes. I wonder why I need to make them available to many classes. It's in Objective-c by the way

    Read the article

  • How to plan/manage multi-platform (mobile) products?

    - by PhD
    Say I've to develop an app that runs on iOS, Android and Windows 8 Mobile. Now all three platforms are technically in different program languages. The only 'reuse' that I can see is that of the boxes-and-lines drawings (UML :) charts and nothing else. So how do companies/programmers manage the variation of the same product across different platforms especially since the implementation languages differ? It's 'easier' in the desktop world IMO given the plethora of languages and cross-platform libraries to make your life easier. Not so in the mobile world. More so, product line management principles don't seem to be all that applicable - what is same and variant doesn't really matter - the application is the same (conceptually) and the implementation is variant. Some difficulties that come to mind: Bug Fixing: Applications maybe designed in a similar manner but the bug identification and fixing would be radically different. A bug on iOS may/may-not be existent for that on Android. Or a bug fix approach on one platform may not be the same on another (unless it's a semantic bug like a!=b instead of a==b which would require the same 'approach' to fixing in essence Enhancements: Making a change on one platform would be radically different than on another Code-Design Divergence: They way the code is written/organized, the class structures etc., could be very different given the different implementation environments - leading to further reuse of the (above) UML models. There are of course many others - just keeping the development in sync and making sure all applications are up to the same version with the same set of features etc. Seems the effort is 3x that of a single application. So how exactly does one manage this nightmarish situation? Some thoughts: Split application to client/server to minimize the effect to client side only (not always doable) Use frameworks like Unity-3D that could take care of the cross-platform problem (mostly applicable to games and probably not to other applications etc.) Any other ways of managing a platform line? What are some proven approaches to managing/taming the effects?

    Read the article

  • Why is Python used for high-performance/scientific computing (but Ruby isn't)?

    - by Cyclops
    There's a quote from a PyCon 2011 talk that goes: At least in our shop (Argonne National Laboratory) we have three accepted languages for scientific computing. In this order they are C/C++, Fortran in all its dialects, and Python. You’ll notice the absolute and total lack of Ruby, Perl, Java. It was in the more general context of high-performance computing. Granted the quote is only from one shop, but another question about languages for HPC, also lists Python as one to learn (and not Ruby). Now, I can understand C/C++ and Fortran being used in that problem-space (and Perl/Java not being used). But I'm surprised that there would be a major difference in Python and Ruby use for HPC, given that they are fairly similar. (Note - I'm a fan of Python, but have nothing against Ruby). Is there some specific reason why the one language took off? Is it about the libraries available? Some specific language features? The community? Or maybe just historical contigency, and it could have gone the other way?

    Read the article

  • What is the simplest way to render video into memory (for drawing to a texture) in .NET?

    - by sebf
    In my project I would like to be able to play back video on surfaces in the world. I intend to do this by having the video frames rendered to a block of memory, then use this to update a texture each frame. Everything is in place - except for the part that actually gets the video. I have looked on Google and found that the video library world is very expansive (and geared towards video processing), and am having trouble finding a suitable one. FFMpeg is very comprehensive, but is an entire suite and would take a good amount of work to integrate. So far the most promising library I've found is the one based on the VLC player libraries - by virtue of it using the same resources as VLC Player it is known to be very capable; it also renders to blocks of memory, but the API (at least of the one on Codeplex) is more of a port of the C++ API rather than a managed wrapper. The 'solution' can be any wrapper/API/library, but with characteristics that make it suitable for use in a rendering engine, namely: Renders the video frame data to memory, so it can be picked up and passed to a texture on the GPU easily. Super simple - all that is needed is a way to load, jump and render a frame programatically - ideally it would use the systems codecs and not require an assortment of plugins. Permissive license (LGPL or more free-er) .NET bindings at least; all the better if it is natively managed Can anyone suggest a lightweight, (.NET) library, that can take a video file, and spit out some frames into a byte[]?

    Read the article

  • Setting up a Google Analytics Campaign

    - by Ashfame
    I will be doing a bunch of things to give one of my projects (main app) a big initial push for which I will be building a few small Facebook apps which will help in promoting the main apps. Traffic from these apps need to be tracked individually. My main app will be posting on the walls when the user needs to be notified. Traffic from these posts need to be tracked. Traffic from emails sent by the main app need to be tracked, like different types of email. I need to track all of these & possibly a couple of more but I need to be sure that I build my campaign URLs correctly as I won't get another chance to fix it. Correct me where I am wrong: Campaign Name: Launch Campaign Medium: Email Campaign Source: Type1 or Type2 (I can break it down for different types of email, right?) For apps: Campaign Name: Launch Campaign Medium: Apps Campaign Source: App1 or App2 (I can break it down here for different apps, right?) What if I want to track two different links within a single email or a single app? Any way of tracking them individually too but still keeping to track them as one because tracking them as one makes more sense for me. Campaign Term & Campaign content is irrelevant in my case, or I can/should use them for something? And I will also be tracking traffic of different apps. Should I do more? Let me know if my scenario wasn't clear enough & I need to explain more.

    Read the article

< Previous Page | 406 407 408 409 410 411 412 413 414 415 416 417  | Next Page >