Search Results

Search found 49151 results on 1967 pages for 'google local search'.

Page 426/1967 | < Previous Page | 422 423 424 425 426 427 428 429 430 431 432 433  | Next Page >

• SQL Server: pulling and updating local data

  - by SDReyes

  Hi guys, I have two SQL Server 2008 databases called Anna and Bob. Bob has to pull and transform data from Anna to keep updated his tables. Ideally Bob will be always synchronized with Anna, but some delay would be acceptable. What is the best way to do this? Thanks in advance.

  Read the article

• Search XDocument with LINQ with out knowing the Namespace

  - by BarDev

  Is there a way to search a XDocument without knowing the Namespace. I have a process that logs all soap requests and encrypts the sensitive data. I want to find any elements based on name. Something like, give me all elements where the name is CreditCard. I don't care what the namespace is. My problem seems to be with LINQ and requiring a xml namespace. I have other processes that retrieve values from XML, but I know the namespace for these other process. XDocument xDocument = XDocument.Load(@"C:\temp\Packet.xml"); XNamespace xNamespace = "http://CompanyName.AppName.Service.Contracts"; var elements = xDocument.Root.DescendantsAndSelf().Elements().Where(d = d.Name == xNamespace + "CreditCardNumber"); But what I really want, is to have the ability to search xml without knowing about namespaces, something like this: XDocument xDocument = XDocument.Load(@"C:\temp\Packet.xml"); var elements = xDocument.Root.DescendantsAndSelf().Elements().Where(d = d.Name == "CreditCardNumber") But of course this will not work be cause I do no have a namespace. BarDev

  Read the article

• Help Email Account Management among multiple users

  - by CogitoErgoSum

  So I preface this with saying this may belong in IT Security, not too sure feel free to move. Currently we have an email account [email protected] - hosted via google apps (as is all our email). We had an incident where we had to terminate an employee. This employee however had the password for this account as we have 20-30 people utilizing it at any given point to manage customer emails etc. Thinking on this I feel there must be a better way to manage access. With Google you can associate upto 10 email accounts to another the problem is we have more like 20-30 people going. We were evaluating tools such as SalesForce and Assistly where people have their own login credentials and then the system contains the appropriate smtp information for the [email protected] email address to send emails from it rather than a users personal account. Aside from those options does anyone have any other thoughts? One suggestion floated was moving everyone to desktop clients and saving the PW info there so they could only login from their physical workstation but we may have situations where we'd like employees to work remotely. Does anyone have experience with this sort of system where ~20-30 people are responding from one email box and how to manage security and access?

  Read the article

• Completely remove Postgres on Mac OSX Lion

  - by Nai

  I'm trying to get postgis running on my machine. Running brew install postgis seems to have installed postgres 9.2.1 on to my machine. I would like to remove my previous version 9.1.2 to keep my environment clean. Running brew uninstall postgres removes 9.2.1. What's the best way to do this? UPDATE nai@nyc ~ $ brew versions postgresql 9.2.1 git checkout ed92469 /usr/local/Library/Formula/postgresql.rb 9.2.0 git checkout 2f6cbc6 /usr/local/Library/Formula/postgresql.rb 9.1.5 git checkout 6b8d25f /usr/local/Library/Formula/postgresql.rb 9.1.4 git checkout c40c7bf /usr/local/Library/Formula/postgresql.rb 9.1.3 git checkout 05c7954 /usr/local/Library/Formula/postgresql.rb 9.1.2 git checkout dfcc838 /usr/local/Library/Formula/postgresql.rb 9.1.1 git checkout 4ef8fb0 /usr/local/Library/Formula/postgresql.rb 9.0.4 git checkout 2accac4 /usr/local/Library/Formula/postgresql.rb 9.0.3 git checkout b782d9d /usr/local/Library/Formula/postgresql.rb 9.0.2 git checkout 2c3b88a /usr/local/Library/Formula/postgresql.rb 9.0.1 git checkout b7fab6c /usr/local/Library/Formula/postgresql.rb 9.0.0 git checkout 1168d8f /usr/local/Library/Formula/postgresql.rb 8.4.4 git checkout c32bea0 /usr/local/Library/Formula/postgresql.rb 8.4.3 git checkout 237d1c5 /usr/local/Library/Formula/postgresql.rb

  Read the article

• IIS7 permit access only to local network

  - by user335518

  Hi, I am having a problem with the IIS 7 on a Win 2008 server. I only want to have access to it inside my network and denied access from anyone outside the network. I had created a rule to permit access to the group of computers with the IP: 192.168.0.1 (255.255.255.0). In the IIS6 this was enougth to prevent access of any IP that don't belong to the network. Any idea of how can I block these access? Thanks!

  Read the article

• Cannot play local WMV in silverlight MediElement

  - by Nick

  Hello, I am trying to play a video in WMV format in a silverlight MediaElement. <StackPanel> <Grid x:Name="LayoutRoot"> <MediaElement x:Name="media" Source="C:\Bounce.wmv" Width="300" Height="300" AutoPlay="True" /> </Grid> </StackPanel> This does nothiing.. but if I change the source attribute to point to some WMV out on the web it works. What am I doing wrong? Thanks, Nick

  Read the article

• Blackberry read local properties file in project

  - by Dachmt

  Hi, I have a config.properties file at the root of my blackberry project (same place as Blackberry_App_Descriptor.xml file), and I try to access the file to read and write into it. See below my class: public class Configuration { private String file; private String fileName; public Configuration(String pathToFile) { this.fileName = pathToFile; try { // Try to load the file and read it System.out.println("---------- Start to read the file"); file = readFile(fileName); System.out.println("---------- Property file:"); System.out.println(file); } catch (Exception e) { System.out.println("---------- Error reading file"); System.out.println(e.getMessage()); } } /** * Read a file and return it in a String * @param fName * @return */ private String readFile(String fName) { String properties = null; try { System.out.println("---------- Opening the file"); //to actually retrieve the resource prefix the name of the file with a "/" InputStream is = this.getClass().getResourceAsStream(fName); //we now have an input stream. Create a reader and read out //each character in the stream. System.out.println("---------- Input stream"); InputStreamReader isr = new InputStreamReader(is); char c; System.out.println("---------- Append string now"); while ((c = (char)isr.read()) != -1) { properties += c; } } catch (Exception e) { } return properties; } } I call my class constructor like this: Configuration config = new Configuration("/config.properties"); So in my class, "file" should have all the content of the config.properties file, and the fileName should have this value "/config.properties". But the "name" is null because the file cannot be found... I know this is the path of the file which should be different, but I don't know what i can change... The class is in the package com.mycompany.blackberry.utils Thank you!

  Read the article

• multiple keys and values with google-collections

  - by flash3000

  Hello, I would like use google-collection in order to save the following file in a Hash with multiple keys and values Key1_1, Key2_1, Key3_1, data1_1, 0, 0 Key1_2, Key2_2, Key3_2, data1_2, 0, 0 Key1_3, Key2_3, Key3_3, data1_3, 0, 0 Key1_4, Key2_4, Key3_4, data1_4, 0, 0 The first three columns are the different keys and the last two integer are the two different values. I have already prepare a code which spilt the lines in chunks. import java.io.BufferedReader; import java.io.FileNotFoundException; import java.io.FileReader; import java.io.IOException; public class HashMapKey { public static void main(String[] args) throws FileNotFoundException, IOException { String inputFile = "inputData.txt"; BufferedReader br = new BufferedReader(new FileReader(inputFile)); String strLine; while ((strLine = br.readLine()) != null) { String[] line = strLine.replaceAll(" ", "").trim().split(","); for (int i = 0; i < line.length; i++) { System.out.print("[" + line[i] + "]"); } System.out.println(); } } } Unfortunately, I do not know how to save these information in google-collection? Thank you in advance. Best regards,

  Read the article

• Search for string allowing for one mismatches in any location of the string, Python

  - by Vincent

  I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

  Read the article

• Is there a normal search in Windows 7?

  - by atch

  Which basically mean where I could specify more than just a file name;

  Read the article

• microsoft local report page width problem when table column hide

  - by Hamid

  I create some dynamic report. by default, create a table with all available field and hidden by expression, therefore column hide when user want (by checkbox in aspx page) problem: my report is "right to left" therefore when hiding some column, report must shown from right, but as you know, when report render, it create table column from left, my question is how to render report from right ???? for solving this problem i create some column without data and set hidden expression != main column hidden state, therefore my problem solved but found another problem, report width!!! because page width really must 8.5in but when hiding some column, page Width not decrease and remain 15in!!! how to solve this problem ??? Please help me, Thanks in advanced

  Read the article

• jruby rubygems update breaks jgem

  - by brad

  Has anyone seen this: ?? No jgem command works at all?? Though jruby -S gem list does work. I'm using jruby 1.3.1 and Sun Java6 jre root@test:/usr/local: jgem --version 1.3.3 root@test:/usr/local: jgem update --system JRuby limited openssl loaded. gem install jruby-openssl for full support. http://wiki.jruby.org/wiki/JRuby_Builtin_OpenSSL Updating RubyGems Updating rubygems-update Successfully installed rubygems-update-1.3.6 /usr/local/jruby/lib/ruby/site_ruby/1.8/rubygems/commands/update_command.rb:103:Warning: Gem::SourceIndex#search support for String patterns is deprecated Updating RubyGems to 1.3.6 Installing RubyGems 1.3.6 RubyGems 1.3.6 installed root@test:/usr/local: jgem list /usr/local/jruby/bin/jgem: line 8: require: command not found /usr/local/jruby/bin/jgem: line 9: require: command not found /usr/local/jruby/bin/jgem: line 10: require: command not found /usr/local/jruby/bin/jgem: line 12: required_version: command not found /usr/local/jruby/bin/jgem: line 14: unless: command not found /usr/local/jruby/bin/jgem: line 15: abort: command not found /usr/local/jruby/bin/jgem: line 16: end: command not found /usr/local/jruby/bin/jgem: line 18: args: command not found /usr/local/jruby/bin/jgem: line 20: begin: command not found /usr/local/jruby/bin/jgem: line 21: Gem::GemRunner.new.run: command not found /usr/local/jruby/bin/jgem: line 22: rescue: command not found /usr/local/jruby/bin/jgem: line 23: exit: e.exit_code: numeric argument required

  Read the article

• Scribe-LinkedIn Search API

  - by Rupeshit

  Hi folks, I want to fetch data from the LinkedIn API for that I am using the Scribe library.All requests are giving me data as expected but when I tried two facet in the url then scribe is not able to get data from LinkedIn API. If I gave this URL : http://api.linkedin.com/v1/people-search?facets=location,network&facet=location,in:0 then it gives me proper result but if I entered this URL: http://api.linkedin.com/v1/people-search?facets=location,network&facet=location,in:0&facet=network,F i.e. URL containing multiple facets then it gives me this output: <?xml version="1.0" encoding="UTF-8" standalone="yes"?> <error> <status>401</status> <timestamp>1292487039516</timestamp> <error-code>0</error-code> <message> [unauthorized].OAU:CiEgwWDkA5BFpNrc0RfGyVuSlOh4tig5kOTZ9q97qcXNrFl7zqk- Ts7DqRGaKDCV|94f13544-9844-41eb-9d53-8fe36535bbc3|*01|*01:1292487039:VseHXaJXM2gerxJyn6kHhIka7zw=</message> </error> Any kind of help to solve this will be appreciated.Thanks.

  Read the article

• Question on multi-probe Local Sensitive Hashing

  - by Yijinsei

  Hey guys sorry to be asking this kind noob question, but because I really need some guidance on how to use Multi probe LSH pretty urgently, so I did not do much research myself. I realize there is a lib call LSHKIT available that implemented that algorithm, but I have trouble trying to figure out how to use it. Right now, I have a few thousand feature vector 296 dimension, each representing an image. The vector is used to query an user input image, to retrieve the most similar image. The method I used to derive the distance between vector is euclidean distance. I know this might be a rather noob question, but do you guys have knowledge on how should i implement multi probe LSH? I am really very grateful to any answer or response.

  Read the article

• Lexical and dynamic scoping in Mathematica: Local variables with Module, With, and Block

  - by dreeves

  The following code returns 14 as you'd expect: Block[{expr}, expr = 2 z; f[z_] = expr; f[7]] But if you change that Block to a Module then it returns 2*z. It seems to not matter what other variables besides expr you localize. I thought I understood Module, Block, and With in Mathematica but I can't explain the difference in behavior between Module and Block in this example. Related resources: Tutorial on Modularity and the Naming of Things from the Mathematica documentation Excerpt from a book by Paul R. Wellin, Richard J. Gaylord, and Samuel N. Kamin Explanation from Dave Withoff on the Mathematica newsgroup

  Read the article

• C# ASP.NET FILE TRANSFER FROM LOCAL MACHINE TO ANOTHER MACHINE

  - by Imcl

  I basically want to transfer a file from the client to the file storage server without actual login to the server so that the client cannot access the storage location on the server directly. I can do this only if i manually login to the storage server through windows login. I dont want to do that. This is a Web-Based Application. Using the link below, I wrote a code for my application. I am not able to get it right though, Please refer the link and help me ot with it... http://stackoverflow.com/questions/263518/c-uploading-files-to-file-server The following is my code:- protected void Button1_Click(object sender, EventArgs e) { filePath = FileUpload1.FileName; try { WebClient client = new WebClient(); NetworkCredential nc = new NetworkCredential(uName, password); Uri addy = new Uri("\\\\192.168.1.3\\upload\\"); client.Credentials = nc; byte[] arrReturn = client.UploadFile(addy, filePath); Console.WriteLine(arrReturn.ToString()); } catch (Exception ex) { Console.WriteLine(ex.Message); } } The following line doesn't execute... byte[] arrReturn = client.UploadFile(addy, filePath); THIS IS THE ERROR I GET :- "An exception occurred during a WebClient request"

  Read the article

• really weird DNS problem in Ubuntu {after one month, seems like ISP problem}

  - by OmniWired

  Hello everyone. I been having this random dns problem, in Ubuntu 10.04 and in 10.10 it started about 2 weeks ago after (I believe) an update. Basically when I go to a website randomly I get that the website I'm visiting is not available ("Oops! Google Chrome could not connect to ..." & "This webpage is not available."). I tested with Chromium "7.0.515.0 (58587)" and Firefox minefield (4.0ish) and 3.6.9. I did these 4 things already: /etc/default/grub GRUB_CMDLINE_LINUX="ipv6.disable=1" and this: /etc/sysctl.conf net.ipv6.conf.all.disable_ipv6 = 1 net.ipv6.conf.default.disable_ipv6 = 1 net.ipv6.conf.lo.disable_ipv6 = 1 *disabling Chromium DNS pre-fetching *using Google and OpenDNS servers as well as ISP DNS servers. But didn't improve, also no other computers in my network have the same problem. All computer wired to the same router. I'm a software engineer that run out of ideas, please help me. Thanks in advance. UPDATE: some programs (synaptic / firefox update/ vuze(azureus)) say connection refused for the error. Most of the time a second try will fix the "refusal". UPDATE2: I found out with Wireshark, that everytime I have this problem i've got this 192.168.0.10 8.8.8.8 ICMP Destination unreachable (Port unreachable) Confirmed an ISP error. ISP;Speedy Location: Argentina, Buenos Aires (capital Federal) Area.

  Read the article

• Extracting the fitted terms in the local polynomial of a loess (in R)

  - by Tal Galili

  Hi all, How can I extract what the loess function has fitted for the polynomial function, for a particular x of my data? Thanks, Tal

  Read the article

• Explaining verity index and document search limits

  - by Ahmad

  As present, we currently have a CF8 standard edition server which have some limitations around verity indexing. According to Adobe Verity Server has the following document search limits (limits are for all collections registered to Verity Server): - 10,000 documents for ColdFusion Developer Edition - 125,000 documents for ColdFusion Standard Edition - 250,000 documents for ColdFusion Enterprise Edition We have now reached a stage where the server wide number of documents indexed exceed 125k. However, the largest verity collection consists of about 25k documents(and this is expected to grow). Only one collection is ever searched at a time. In my understanding, this means that I can still search an entire collection with no restrictions. Is this correct? Or does it mean that only documents that were indexed across all collection prior to reaching the limit are actually searchable? We are considering moving to CF9 standard as a solution to this and to use the Solr solution which has no restrictions. The coldfusionjedi highlights some differences between Verity and Solr. However, before we upgrade I am trying to gain a clearer understanding of this before we commit to an upgrade. Can someone provide me a clear explanation as to what this means and how it actually affects verity searching and indexing?

  Read the article

• Creating stored procedure having different WHERE clause on different search criteria without putting

  - by Muhammad Kashif Nadeem

  Is there any alternate way to create stored procedure without putting all query in one long string if criteria of WWHERE clause can be different. Suppose I have Orders table I want to create stored procedure on this table and there are three column on which I wnat to filter records. 1- CustomerId, 2- SupplierId, 3- ProductId. If user only give CustomerId in search criteria then query should be like following SELECT * FROM Orders WHERE Orders.CustomerId = @customerId And if user only give ProductId in search criteria then query should be like following SELECT * FROM Orders WHERE Orders.ProductId = @productId And if user only all three CustomerId, ProductId, and SupplierId is given then all three Ids will be used in WHERE to filter. There is also chance that user don't want to filter record then query should be like following SELCT * FROM Orders Whenever I have to create this kind of procedure I put all this in string and use IF conditions to check if arguments (@customeId or @supplierId etc) has values. I use following method to create procedure DECLARE @query VARCHAR(MAX) DECLARE @queryWhere VARCHAR(MAX) SET @query = @query + 'SELECT * FROM Orders ' IF (@originationNumber IS NOT NULL) BEGIN BEGIN SET @queryWhere =@queryWhere + ' Orders.CustomerId = ' + CONVERT(VARCHAR(100),@customerId) END END IF(@queryWhere <> '') BEGIN SET @query = @query+' WHERE ' + @queryWhere END EXEC (@query) Thanks.

  Read the article

• Java compiler error: "cannot find symbol" when trying to access local variable

  - by HH

  $ javac GetAllDirs.java GetAllDirs.java:16: cannot find symbol symbol : variable checkFile location: class GetAllDirs System.out.println(checkFile.getName()); ^ 1 error $ cat GetAllDirs.java import java.util.*; import java.io.*; public class GetAllDirs { public void getAllDirs(File file) { if(file.isDirectory()){ System.out.println(file.getName()); File checkFile = new File(file.getCanonicalPath()); }else if(file.isFile()){ System.out.println(file.getName()); File checkFile = new File(file.getParent()); }else{ // checkFile should get Initialized at least HERE! File checkFile = file; } System.out.println(file.getName()); // WHY ERROR HERE: checkfile not found System.out.println(checkFile.getName()); } public static void main(String[] args) { GetAllDirs dirs = new GetAllDirs(); File current = new File("."); dirs.getAllDirs(current); } }

  Read the article

• "Local transaction already has 1 non-XA Resource: cannot add more resources" error

  - by jthg

  After reading previous questions about this error, it seems like all of them conclude that you need to enable XA on all of the data sources. But: What if I don't want a distributed transaction? What would I do if I want to start transactions on two different databases at the same time, but commit the transaction on one database and roll back the transaction on the other? I'm wondering how my code actually initiated a distributed transaction. It looks to me like I'm starting completely separate transactions on each of the databases. Info about the application: The application is an EJB running on a Sun Java Application Server 9.1 I use something like the following spring context to set up the hibernate session factories: <bean id="dbADatasource" class="org.springframework.jndi.JndiObjectFactoryBean"> <property name="jndiName" value="jdbc/dbA"/> </bean> <bean id="dbASessionFactory" class="org.springframework.orm.hibernate3.LocalSessionFactoryBean"> <property name="dataSource" ref="dbADatasource" /> <property name="hibernateProperties"> [hibernate properties...] </property> <property name="mappingResources"> [mapping resources...] </property> </bean> <bean id="dbBDatasource" class="org.springframework.jndi.JndiObjectFactoryBean"> <property name="jndiName" value="jdbc/dbB"/> </bean> <bean id="dbBSessionFactory" class="org.springframework.orm.hibernate3.LocalSessionFactoryBean"> <property name="dataSource" ref="dbBDatasource" /> <property name="hibernateProperties"> [hibernate properties...] </property> <property name="mappingResources"> [mapping resources...] </property> </bean> Both of the JNDI resources are javax.sql.ConnectionPoolDatasoure's. They actually both point to the same connection pool, but we have two different JNDI resources because there's the possibility that the two groups of tables will move to different databases in the future. Then in code, I do: sessionA = dbASessionFactory.openSession(); sessionB = dbBSessionFactory.openSession(); sessionA.beginTransaction(); sessionB.beginTransaction(); The sessionB.beginTransaction() line produces the error in the title of this post - sometimes. I ran the app on two different sun application servers. On one runs it fine, the other throws the error. I don't see any difference in how the two servers are configured although they do connect to different, but equivalent databases. So the question is Why doesn't the above code start completely independent transactions? How can I force it to start independent transactions rather than a distributed transaction? What configuration could cause the difference in behavior between the two application servers? Thanks.

  Read the article

• Make sure <a href="local file"> is opened outside of browser

  - by Heinzi

  For an Intranet web application (document management), I want to show a list of files associated with a certain customer. The resulting HTML is like this: <a href="file:///server/share/dir/somefile.docx">somefile.docx</a> <a href="file:///server/share/dir/someotherfile.pdf">somefile.pdf</a> <a href="file:///server/share/dir/yetanotherfile.txt">yetanotherfile.txt</a> This works fine. Unfortunetly, when clicking on a text file (or image file), Internet Explorer (and I guess most other browsers as well) insist on showing it in the browser instead of opening the file with the associated application (e.g. Notepad). In our case, this is undesired behavior, since it does not allow the user to edit the file. Is there some workaround to this behavior (e.g. something like <a href="file:///..." open="external">)? I'm aware that this is a browser-specific thing, and an IE-only solution would be fine (it's an Intranet application after all).

  Read the article

• VB.NET WebBrowser control not navigating to a local document

  - by blerh

  I have this code set up to navigate to a certain .html document depending on what's selected from a ListBox: Private Sub FileList_SelectedIndexChanged(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles FileList.SelectedIndexChanged HelpWindow.Navigate(System.AppDomain.CurrentDomain.BaseDirectory & "help\" & fileArray(FileList.SelectedIndex, 1)) End Sub The problem is, when I first select something in the ListBox, it successfully navigates to that file and displays it. But when I select something a second time it doesn't change. All of the paths it's trying to navigate to are correct. I've checked this 1000 times. Anyone have any clues why this isn't working? Thank you.

  Read the article

• Content search through source code in finder

  - by gf

  I am using OSX 10.6 and want to have content searches in finder for the source code types i use. This suggests a (10.4 only?) solution, but although i have the developer tools installed i don't have /Library/Spotlight/SourceCode.mdimporter. Is there a different procedure for Snow Leopard or did i miss something?

  Read the article

< Previous Page | 422 423 424 425 426 427 428 429 430 431 432 433  | Next Page >