Search Results

Search found 88594 results on 3544 pages for 'vc project file'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 426/3544 | < Previous Page | 422 423 424 425 426 427 428 429 430 431 432 433  | Next Page >

  • Is there a way to recover a file that I have deleted but is still open somewhere?

    - by George Edison
    This question is related to How to recover deleted files? but it is slightly different in nature. Suppose I have a file named ~/something open in a text editor. Further suppose that I open a terminal and run the following command while the file is still open in the text editor: rm ~/something This will delete the file. Now suppose that I changed my mind and wanted to get the file back. The file is still open in the text editor, so it hasn't been removed from the disk or filesystem yet. Is there any way to recover it?

    Read the article

  • Use matching value of a RegExp to name the output file.

    - by fx42
    I have this file "file.txt" which I want to split into many smaller ones. Each line of the file has an id field which looks like "id:1" for a line belonging to id 1. For each id in the file, I like to create a file named idid.txt and put all lines that belong to this id in that file. My brute force bash script solution reads as follows. count=1 while [ $count -lt 19945 ] do cat file.txt | grep "id:$count " >> ./sets/id$count.txt count='expr $count + 1' done Now this is very inefficient as I have do read through the file about 20.000 times. Is there a way to do the same operation with only one pass through the file? - What I'm probably asking for is a way to use the value that matches for a regular expression to name the associated output file.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Can I copy large files faster without using the file cache?

    - by Veazer
    After adding the preload package, my applications seem to speed up but if I copy a large file, the file cache grows by more than double the size of the file. By transferring a single 3-4 GB virtualbox image or video file to an external drive, this huge cache seems to remove all the preloaded applications from memory, leading to increased load times and general performance drops. Is there a way to copy large, multi-gigabyte files without caching them (i.e. bypassing the file cache)? Or a way to whitelist or blacklist specific folders from being cached?

    Read the article

  • A question about making a C# class persistent during a file load

    - by Adam
    Apologies for the indescriptive title, however it's the best I could think of for the moment. Basically, I've written a singleton class that loads files into a database. These files are typically large, and take hours to process. What I am looking for is to make a method where I can have this class running, and be able to call methods from within it, even if it's calling class is shut down. The singleton class is simple. It starts a thread that loads the file into the database, while having methods to report on the current status. In a nutshell it's al little like this: public sealed class BulkFileLoader { static BulkFileLoader instance = null; int currentCount = 0; BulkFileLoader() public static BulkFileLoader Instance { // Instanciate the instance class if necessary, and return it } public void Go() { // kick of 'ProcessFile' thread } public void GetCurrentCount() { return currentCount; } private void ProcessFile() { while (more rows in the import file) { // insert the row into the database currentCount++; } } } The idea is that you can get an instance of BulkFileLoader to execute, which will process a file to load, while at any time you can get realtime updates on the number of rows its done so far using the GetCurrentCount() method. This works fine, except the calling class needs to stay open the whole time for the processing to continue. As soon as I stop the calling class, the BulkFileLoader instance is removed, and it stops processing the file. What I am after is a solution where it will continue to run independently, regardless of what happens to the calling class. I then tried another approach. I created a simple console application that kicks off the BulkFileLoader, and then wrapped it around as a process. This fixes one problem, since now when I kick off the process, the file will continue to load even if I close the class that called the process. However, now the problem I have is that cannot get updates on the current count, since if I try and get the instance of BulkFileLoader (which, as mentioned before is a singleton), it creates a new instance, rather than returning the instance that is currently in the executing process. It would appear that singletons don't extend into the scope of other processes running on the machine. In the end, I want to be able to kick off the BulkFileLoader, and at any time be able to find out how many rows it's processed. However, that is even if I close the application I used to start it. Can anyone see a solution to my problem?

    Read the article

  • could not save the file /usr/... permission denied (13.04)

    - by plaguedoctor
    I am running Ubuntu 13.04 and am trying to create an .sh file for conky in /usr/bin using gedit. When trying to save I get the error dialogue: Could not save the file /usr/bin/conky-start.sh You do not have the permissions necessary to save the file. Please check that you typed the location correctly and try again." From searching, I think I have to run a command in terminal to allow permission, but I couldn't find out what that is. Edit: I'm trying to create the file conky-start.sh, not change or run it. Thus far, I've opened gedit, copied and pasted some required info from the net, and I'm trying to save-as /usr/bin/conky-start.sh Perhaps I need to create the file first in terminal, then edit it? How would I do that?

    Read the article

  • How to Call a extension method from library in asp.net mvc project inside the razor view ?

    - by Anirudha
    Originally posted on: http://geekswithblogs.net/anirugu/archive/2014/06/12/how-to-call-a-extension-method-from-library-in-asp.net.aspxIf you want to call a extension method from a c# library when you are working on views then here in this post I am showing you how you can do it.   just go to views and open the web.config file. (do all these step in VWD or VS 13 whatever you use for work) inside the tag of  system.web.webPages.razor you will find the tag  namespaces which contain too many namespace which shown in intellisense when you work in Views inside your Visual studio.   now  add line like this   <add namespace="MyCustomDll" /> MyCustomDll is a namespace that came from library that I want to use in my views. Now whenever  I am working in views I can see the extension method in views.   Cheers

    Read the article

  • Universal syntax file format?

    - by Isaiah
    Hey as a project to improve my programing skills I've begun programing a nice code editor in python to teach myself project management, version control, and gui programming. I was wanting to utilize syntax files made for other programs so I could have a large collection already. I was wondering if there was any kind of universal syntax file format much in the same sense as .odt files. I heard of one once in a forum, it had a website, but I can't remember it now. If not I may just try to use gedit syntax files or geany. thanks

    Read the article

  • Save file in a different location in iPhone App

    - by zp26
    Hi, I have a problem. My proget create a xml file. In the iPhone this file was store in the NSDocumentDirectory. I wanna save this file in another directory like Desktop(where there are the apps) or another visible folder. Thanks. This is my code: -(void)saveInXML:(NSString*)name:(float)x:(float)y:(float)z{ //NSDocumentDirectory put the file in the app directory NSArray *paths = NSSearchPathForDirectoriesInDomains(NSDocumentDirectory, NSUserDomainMask, YES); NSString *documentsDirectoryPath = [paths objectAtIndex:0]; NSString *filePath = [documentsDirectoryPath stringByAppendingPathComponent:@"filePosizioni.xml"]; NSFileHandle *myHandle; NSFileManager *fileManager = [NSFileManager defaultManager]; NSString *titoloXML = [NSString stringWithFormat:@"File Xml delle posizioni del iPhone"]; NSString *inizioTag = [NSString stringWithFormat:@"\n\n\n<posizione>"]; NSString *tagName = [NSString stringWithFormat:@"\n <name>%@</name>", name]; NSString *tagX = [NSString stringWithFormat:@"\n <x>%f</x>", x]; NSString *tagY = [NSString stringWithFormat:@"\n <y>%f</y>", y]; NSString *tagZ = [NSString stringWithFormat:@"\n <z>%f</z>", z]; NSString *fineTag= [NSString stringWithFormat:@"\n</posizione>"]; NSData* dataTitoloXML = [titoloXML dataUsingEncoding: NSASCIIStringEncoding]; NSData* dataInizioTag = [inizioTag dataUsingEncoding: NSASCIIStringEncoding]; NSData* dataName = [tagName dataUsingEncoding: NSASCIIStringEncoding]; NSData* dataX = [tagX dataUsingEncoding: NSASCIIStringEncoding]; NSData* dataY = [tagY dataUsingEncoding: NSASCIIStringEncoding]; NSData* dataZ = [tagZ dataUsingEncoding: NSASCIIStringEncoding]; NSData* dataFineTag = [fineTag dataUsingEncoding: NSASCIIStringEncoding]; if(![fileManager fileExistsAtPath:filePath]) [fileManager createFileAtPath:filePath contents:dataTitoloXML attributes:nil]; myHandle = [NSFileHandle fileHandleForUpdatingAtPath:filePath]; [myHandle seekToEndOfFile]; [myHandle writeData:dataInizioTag]; NSLog(@"writeok"); [myHandle seekToEndOfFile]; [myHandle writeData:dataName]; NSLog(@"writeok"); [myHandle seekToEndOfFile]; [myHandle writeData:dataX]; NSLog(@"writeok"); [myHandle seekToEndOfFile]; [myHandle writeData:dataY]; NSLog(@"writeok"); [myHandle seekToEndOfFile]; [myHandle writeData:dataZ]; NSLog(@"writeok"); [myHandle seekToEndOfFile]; [myHandle writeData:dataFineTag]; NSLog(@"writeok"); [myHandle seekToEndOfFile]; NSLog(@"zp26 %@",filePath); }

    Read the article

  • How can I make a web browser view my .h file as text?

    - by drewbenn
    I want to post a .h file from a project I'm working on. I set a simple href link to it, like: <p>Click here to download the <a href=project_strings.h>strings file</a>. When I click on it, though, my web browser (Iceweasel 12) gives me a prompt to download the file, instead of just displaying it: Is there any magic I can add to the web page, or as a header to the file (that will still allow it to be included by a .c compiled with gcc), to get the .h file to be displayed in the web browser?

    Read the article

  • Project hosting on Google Code. Files are cahced?

    - by Frexuz
    I do not really understand how Google Code handles file versioning. I am building a jQuery plugin that anyone can access. Like so: <script type="text/javascript" src="http://jquery-old-browser-warning.googlecode.com/files/jquery.browser-warning.js"></script> This script accesses other files on the same project (via ajax). The problem is, that when I upload a new file, it just seems like there aren't any changed to it. Google recommends that new files should have new names. But then I would have to change the filenames that the script loads. But then I would have to change the script file as well, and that would break everybodys implementation (with the script-tag above) Is there a way to force a file to change when uploading with the same filename? PS: If I go directly to the project page's file list. Then I do get the file with the updated content. But as I said, not when getting it through ajax.

    Read the article

  • DLL configuration file in asp.net site

    - by Tominator
    Hi, I've made a .net 2.0 librabry project, that results in a dll. I've made an app.config file in my project, with settings used in the dll, with the intention that they can be changed later. I'm attempting to use the dll in an asp.net web application now, so I made the reference to my other project's output, and I see that the dll is copied over to the site's bin folder, and everything works. However, the configuration file is not copied. When I manually copy the app.config and rename it to myDll.config, it has no influence. The contents of the config file is approximately this: <?xml version="1.0" encoding="utf-8" ?> <configuration> <configSections> <sectionGroup name="applicationSettings" type="System.Configuration.ApplicationSettingsGroup, System, Version=2.0.0.0, Culture=neutral, PublicKeyToken=b77a5c561934e089" > <section name="myDLL.My.MySettings" type="System.Configuration.ClientSettingsSection, System, Version=2.0.0.0, Culture=neutral, PublicKeyToken=b77a5c561934e089" requirePermission="false" /> </sectionGroup> </configSections> <applicationSettings> <myDLL.My.MySettings> <setting name="myDLL_webservice_Service" serializeAs="String"> <value>https://myhost/Service.asmx</value> </setting> <setting name="ID" serializeAs="String"> <value>6</value> </setting> </myDLL.My.MySettings> </applicationSettings> </configuration> And I use its settings in the dll with this (vb.net code): Private _id As Long = My.Settings.ID How can I put my config information somewhere so it can be used? In the web.config of the site application? That has only the appSettings section, and it uses the syntax. It doesn't appear to work though. In a custom file format that I create and use? Not that pretty..

    Read the article

  • sharpziplib - can you add a file without it copying the entire zip first?

    - by schmoopy
    Im trying to add an existing file to a .zip file using sharpziplib - problem is, the zip file is 1GB in size. When i try to add 1 small file (400k) sharpziplib creates a copy/temp of the orig zip file before adding the new file - this poses a problem when the amount of free disk space is less than 2x the zip file you are trying to update. for example: 1GB zip myfile.zip 1GB zip myfile.zip.tmp.293 ZipFile zf = new ZipFile(path); zf.BeginUpdate(); zf.Add(file); // Adding a 400k file here causes a 1GB temp file to be created zf.EndUpdate(); zf.Close(); Is there a more efficient way to do this? Thanks :-)

    Read the article

  • Creating and Saving an Excel File

    - by Kris
    I have the following code that creates a new Excel file in my C# code behind. When I attempt to save the file I would like the user to select the location of the save. In Method #1, I can save the file my using the workbook SaveCopyAs without prompting the user for a location. This saves one file to the C:\Temp directory. Method #2 will save the file in my Users\Documents folder, then prompt the user to select the location and save a second copy. How can I eliminate the first copy from saving in the Users\Documents folder? Excel.Application oXL; Excel._Workbook oWB; Excel._Worksheet oSheet; Excel.Range oRng; try { //Start Excel and get Application object. oXL = new Excel.Application(); oXL.Visible = false; //Get a new workbook. oWB = (Excel._Workbook)(oXL.Workbooks.Add(Missing.Value)); oSheet = (Excel._Worksheet)oWB.ActiveSheet; // ***** oSheet.Cells[2, 6] = "Ship To:"; oSheet.get_Range("F2", "F2").Font.Bold = true; oSheet.Cells[2, 7] = sShipToName; oSheet.Cells[3, 7] = sAddress; oSheet.Cells[4, 7] = sCityStateZip; oSheet.Cells[5, 7] = sContactName; oSheet.Cells[6, 7] = sContactPhone; oSheet.Cells[9, 1] = "Shipment No:"; oSheet.get_Range("A9", "A9").Font.Bold = true; oSheet.Cells[9, 2] = sJobNumber; oSheet.Cells[9, 6] = "Courier:"; oSheet.get_Range("F9", "F9").Font.Bold = true; oSheet.Cells[9, 7] = sCarrierName; oSheet.Cells[11, 1] = "Requested Delivery Date:"; oSheet.get_Range("A11", "A11").Font.Bold = true; oSheet.Cells[11, 2] = sRequestDeliveryDate; oSheet.Cells[11, 6] = "Courier Acct No:"; oSheet.get_Range("F11", "F11").Font.Bold = true; oSheet.Cells[11, 7] = sCarrierAcctNum; // ***** Method #1 //oWB.SaveCopyAs(@"C:\Temp\" + sJobNumber +".xls"); Method #2 oXL.SaveWorkspace(sJobNumber + ".xls"); } catch (Exception theException) { String errorMessage; errorMessage = "Error: "; errorMessage = String.Concat(errorMessage, theException.Message); errorMessage = String.Concat(errorMessage, " Line: "); errorMessage = String.Concat(errorMessage, theException.Source); }

    Read the article

  • Project hosting on Google Code. Files are cached?

    - by Frexuz
    I do not really understand how Google Code handles file versioning. I am building a jQuery plugin that anyone can access. Like so: <script type="text/javascript" src="http://jquery-old-browser-warning.googlecode.com/files/jquery.browser-warning.js"></script> This script accesses other files on the same project (via ajax). The problem is, that when I upload a new file, it just seems like there aren't any changed to it. Google recommends that new files should have new names. But then I would have to change the filenames that the script loads. But then I would have to change the script file as well, and that would break everybodys implementation (with the script-tag above) Is there a way to force a file to change when uploading with the same filename? PS: If I go directly to the project page's file list. Then I do get the file with the updated content. But as I said, not when getting it through ajax.

    Read the article

  • JAR file folder for eclipse projects

    - by Daff
    I'm trying to create a centralized folder (in some kind of a "meta project" in my eclipse workspace) for commonly used JAR files for referenced projects in this workspace. It should work similar to the WEB-INF/lib folder for web projects but also apply to non web projects, and automatically scan and add all jar files in this folder. I tried to create a user library with these jar files and reference them in the project but I still have to add every new jar manually to the user library (and don't know if it is referenced relative of absoulute) and Tomcat (WTP) doesn't seem to take these files (Run As - Run on Server) into its classpath (and I don't want to duplicate the jars and put them into WEB-INF/lib). Any ideas?

    Read the article

  • How can I delete a file in Sinatra after it has been sent via send_file?

    - by John Reilly
    I have a simple sinatra application that needs to generate a file (via an external process), send that file to the browser, and finally, delete the file from the filesystem. Something along these lines: class MyApp < Sinatra::Base get '/generate-file' do # calls out to an external process, # and returns the path to the generated file file_path = generate_the_file() # send the file to the browser send_file(file_path) # remove the generated file, so we don't # completely fill up the filesystem. File.delete(file_path) # File.delete is never called. end end It seems, however, that the send_file call completes the request, and any code after it does not get run. Is there some way to ensure that the generated file is cleaned up after it has been successfully sent to the browser? Or will I need to resort to a cron job running a cleanup script on some interval?

    Read the article

  • How can I do individual file encryption on Dropbox?

    - by Scaine
    I'd like to set a single directory inside Dropbox in which files are encrypted on a file-by-file basis. At the moment, I use a 2Mb Truecrypt container inside my Dropbox which I then have to mount manually, access/change the files within, then unmount manually. At that point, the entire 2Mb uploads to Dropbox. This is a pain for a number of reasons : Dropbox sync will only occur when the Truecrypt container is unmounted, because Dropbox only syncs files that aren't locked and mounting a container locks it. A single byte change to one file inside that container results in the whole 2Mb being uploaded again. It doesn't scale - I was originally using a 10Mb container, but obviously the bigger the container, the longer it takes to sync when it's unmounted. I was wondering if I can somehow use LUKS to implement file-by-file encryption to get round the "container" issues.

    Read the article

  • No response in Eclipse: File ->Import->Existing Projects into Workspace

    - by Hula
    I'm trying to import one of the GWT samples into Eclipse by following the instructions below. But when I browse to the directory containing the "Hello" sample and uncheck "Copy projects into workspace", the Finish button is grayed out, preventing me from completing the import. Any ideas why? -- Option A: Import your project into Eclipse (recommended) -- If you use Eclipse, you can simply import the generated project into Eclipse. We've tested against Eclipse 3.3 and 3.4. Later versions will likely also work, earlier versions may not. In Eclipse, go to the File menu and choose: File - Import... - Existing Projects into Workspace Browse to the directory containing this file, select "Hello". Be sure to uncheck "Copy projects into workspace" if it is checked. Click Finish.

    Read the article

  • A question about making a C# class persistant during a file load

    - by Adam
    Apologies for the indescriptive title, however it's the best I could think of for the moment. Basically, I've written a singleton class that loads files into a database. These files are typically large, and take hours to process. What I am looking for is to make a method where I can have this class running, and be able to call methods from within it, even if it's calling class is shut down. The singleton class is simple. It starts a thread that loads the file into the database, while having methods to report on the current status. In a nutshell it's al little like this: public sealed class BulkFileLoader { static BulkFileLoader instance = null; int currentCount = 0; BulkFileLoader() public static BulkFileLoader Instance { // Instanciate the instance class if necessary, and return it } public void Go() { // kick of 'ProcessFile' thread } public void GetCurrentCount() { return currentCount; } private void ProcessFile() { while (more rows in the import file) { // insert the row into the database currentCount++; } } } The idea is that you can get an instance of BulkFileLoader to execute, which will process a file to load, while at any time you can get realtime updates on the number of rows its done so far using the GetCurrentCount() method. This works fine, except the calling class needs to stay open the whole time for the processing to continue. As soon as I stop the calling class, the BulkFileLoader instance is removed, and it stops processing the file. What I am after is a solution where it will continue to run independently, regardless of what happens to the calling class. I then tried another approach. I created a simple console application that kicks off the BulkFileLoader, and then wrapped it around as a process. This fixes one problem, since now when I kick off the process, the file will continue to load even if I close the class that called the process. However, now the problem I have is that cannot get updates on the current count, since if I try and get the instance of BulkFileLoader (which, as mentioned before is a singleton), it creates a new instance, rather than returning the instance that is currently in the executing process. It would appear that singletons don't extend into the scope of other processes running on the machine. In the end, I want to be able to kick off the BulkFileLoader, and at any time be able to find out how many rows it's processed. However, that is even if I close the application I used to start it. Can anyone see a solution to my problem?

    Read the article

  • java - reduce external jar file size

    - by joe_shmoe
    Hi all, still learning, so be patient :) I've developed a module for a Java project. The module depends on external library (fastutil). the problem is, the fastutil.jar file is a couple of times heavier than the whole project itself (14 MB). I only use a tiny subset of the classes from the library. the module is now finished, and no-one is likely to extend it in future. is there a way I could extract only the relevant class to some fastutil_small.jar so that others don't have to download all this extra weight? there's probably a simple answer to this, but as I said, I still consider myself a noob. Thanks a lot

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 422 423 424 425 426 427 428 429 430 431 432 433  | Next Page >