Search Results

Search found 12806 results on 513 pages for 'die 20'.

Page 433/513 | < Previous Page | 429 430 431 432 433 434 435 436 437 438 439 440  | Next Page >

  • Temporary files & folders on Windows

    - by GRIGORE-TURBODISEL
    Emulating multithreading by loading a DLL multiple times (it's designed for this). Since LoadLibrary() doesn't really allow it, the DLL copies itself into a temporary file, via GetTempPath() and GetTempFileName(). It's a small file and upon thread destruction it frees the library and deletes the temporary file. Problem now is that the number of threads is configurable (maniacs can pick 50, 100, more) which basically exposes the risk of running unstable, crash and not go through the usual "delete temporary files" routine. Is it okay if I just leave those temporary files to die there? Does the OS usually clean the up by itself? Or should I write an autocleanup routine? If yes, how can I go about saving another temporary file to hold a list with those files, and not hit UAC restrictions or otherwise? Any ideas?

    Read the article

  • How to combine a list of choices to determine which select statement

    - by Larry
    I have a mysql db and am using php 5.2 What I am trying to do is offer a list of options for a person to select (only 1). The chosen option will cause a select, update, or delete statement to be ran. The results of the statement do not need to be shown, although, showing the old and then the new would be nice (no problems with that part tho'.). Pseudo-Code: Assign $choice = 0 Check the value of $choice // This way, if it = 100, we do a break Select a Choice:<br> 1. Adjust Status Value (+60) // $choice = 1<br> 2. Show all Ships <br> // $choice = 2 3. Show Ships in Port <br> // $choice = 3 ... 0. $choice="100" // if the value =100, quit this part Use either case (switch) or if/else statements to run the users choice1 If the choice is 1, then run the "Select" statement with the variable of $sql1 -- "SELECT .... If the choice is 2, then run the "Select" statement with the variable of $sql2 --- SELECT * FROM Ships If the choice is 3, then run the "Select" statement with the variable of $sql3 <br> .... If the choice is 0, then we are done. I figured the (3) statements would be assigned in php as: $sql1="...". $sql2="SELECT * FROM Ships" $sql3="SELECT * FROM Ships WHERE nPort="1" My idea was to use the switch statement, but got lost on it. :( I would like the options to be available over and over again, until a variable ($choice) is selected. In which case, this particular page is done and goes back to the "Main Menu"? The coding and display, if I use it, I can do. Just not sure how to write the way to select which one I want. It is possible that I would run all of the queries, and other times, only one, so that is why I would like the choice. An area I get confused in is the proper forms to use such as -- ' ' " " and ...?? Not sure the # of options I will end up with, but it will be more than 5 but less than 20 / page. So if I get the system down for 2-3 choices, I can replicate it for as many as I may need. And, as always, if a better way exists, I am willing to try it. Thanks again... Larry

    Read the article

  • Submtting data using $.ajax and retrieving values from $_POST array

    - by Linda Keating
    I'm having trouble retrieving my form Data that has been submitted via ajax like this: $( "form" ).on( "submit", function( event ) { var formData = $(this).serializeArray(); console.log("fomData"); $.ajax({ url: window.location.origin+ "/selfservicemanager/localtmfsetup/local_tmf_setup.php", type: "POST", data: JSON.stringify(formData), success : function (){ alert("success"); } }); }); I can see the data being sent over the network like this: But when I try to retrieve the data on the server side the $_POST array is empty. <?php var_dump($_POST); die(); ?> array (size=0) empty Any ideas? I've tried to stringify the data being sent, and also tried to decode the $_POST array but it expects a string.....

    Read the article

  • How to measure a canvas that has auto height and width

    - by Wymmeroo
    Hi Folks, I'm a beginner in silverlight so i hope i can get an answer that brings me some more light in the measure process of silverlight. I found an interessting flap out control from silverlight slide control and now I try to use it in my project. So that the slide out is working proper, I have to place the user control on a canvas. The user control then uses for itself the height of its content. I just wanna change that behavior so that the height is set to the available space from the parent canvas. You see the uxBorder where the height is set. How can I measure the actual height and set it to the border? I tried it with Height={Binding ElementName=notificationCanvas, Path=ActualHeight} but this dependency property has no callback, so the actualHeight is never set. What I want to achieve is a usercontrol like the tweetboard per example on Jesse Liberty's blog Sorry for my English writing, I hope you understand my question. <Canvas x:Name="notificationCanvas" Background="Red"> <SlideEffectEx:SimpleSlideControl GripWidth="20" GripTitle="Task" GripHeight="100"> <Border x:Name="uxBorder" BorderThickness="2" CornerRadius="5" BorderBrush="DarkGray" Background="DarkGray" Padding="5" Width="300" Height="700" > <StackPanel> <TextBlock Text="Tasks"></TextBlock> <Button x:Name="btn1" Margin="5" Content="{Binding ElementName=MainBorder, Path=Height}"></Button> <Button x:Name="btn2" Margin="5" Content="Second Button"></Button> <Button x:Name="btn3" Margin="5" Content="Third Button"></Button> <Button x:Name="btn1_Copy" Margin="5" Content="First Button"/> <Button x:Name="btn1_Copy1" Margin="5" Content="First Button"/> <Button x:Name="btn1_Copy2" Margin="5" Content="First Button"/> <Button x:Name="btn1_Copy3" Margin="5" Content="First Button"/> <Button x:Name="btn1_Copy4" Margin="5" Content="First Button"/> <Button x:Name="btn1_Copy5" Margin="5" Content="First Button"/> <Button x:Name="btn1_Copy6" Margin="5" Content="First Button"/> </StackPanel> </Border> </SlideEffectEx:SimpleSlideControl>

    Read the article

  • Mysql select - improve performances

    - by realshadow
    Hey, I am working on an e-shop which sells products only via loans. I display 10 products per page in any category, each product has 3 different price tags - 3 different loan types. Everything went pretty well during testing time, query execution time was perfect, but today when transfered the changes to the production server, the site "collapsed" in about 2 minutes. The query that is used to select loan types sometimes hangs for ~10 seconds and it happens frequently and thus it cant keep up and its hella slow. The table that is used to store the data has approximately 2 milion records and each select looks like this: SELECT * FROM products_loans WHERE KOD IN("X17/Q30-10", "X17/12", "X17/5-24") AND 369.27 BETWEEN CENA_OD AND CENA_DO; 3 loan types and the price that needs to be in range between CENA_OD and CENA_DO, thus 3 rows are returned. But since I need to display 10 products per page, I need to run it trough a modified select using OR, since I didnt find any other solution to this. I have asked about it here, but got no answer. As mentioned in the referencing post, this has to be done separately since there is no column that could be used in a join (except of course price and code, but that ended very, very badly). Here is the show create table, kod and CENA_OD/CENA_DO very indexed via INDEX. CREATE TABLE `products_loans` ( `KOEF_ID` bigint(20) NOT NULL, `KOD` varchar(30) NOT NULL, `AKONTACIA` int(11) NOT NULL, `POCET_SPLATOK` int(11) NOT NULL, `koeficient` decimal(10,2) NOT NULL default '0.00', `CENA_OD` decimal(10,2) default NULL, `CENA_DO` decimal(10,2) default NULL, `PREDAJNA_CENA` decimal(10,2) default NULL, `AKONTACIA_SUMA` decimal(10,2) default NULL, `TYP_VYHODY` varchar(4) default NULL, `stage` smallint(6) NOT NULL default '1', PRIMARY KEY (`KOEF_ID`), KEY `CENA_OD` (`CENA_OD`), KEY `CENA_DO` (`CENA_DO`), KEY `KOD` (`KOD`), KEY `stage` (`stage`) ) ENGINE=InnoDB DEFAULT CHARSET=utf8 And also selecting all loan types and later filtering them trough php doesnt work good, since each type has over 50k records and the select takes too much time as well... Any ides about improving the speed are appreciated. Edit: Here is the explain +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ | id | select_type | table | type | possible_keys | key | key_len | ref | rows | Extra | +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ | 1 | SIMPLE | products_loans | range | CENA_OD,CENA_DO,KOD | KOD | 92 | NULL | 190158 | Using where | +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ I have tried the combined index and it improved the performance on the test server from 0.44 sec to 0.06 sec, I cant access the production server from home though, so I will have to try it tomorrow.

    Read the article

  • Foreign key pointing to different tables

    - by Álvaro G. Vicario
    I'm implementing a table per subclass design I discussed in a previous question. It's a product database where products can have very different attributes depending on their type, but attributes are fixed for each type and types are not manageable at all. I have a master table that holds common attributes: product_type ============ product_type_id INT product_type_name VARCHAR E.g.: 1 'Magazine' 2 'Web site' product ======= product_id INT product_name VARCHAR product_type_id INT -> Foreign key to product_type.product_type_id valid_since DATETIME valid_to DATETIME E.g. 1 'Foo Magazine' 1 '1998-12-01' NULL 2 'Bar Weekly Review' 1 '2005-01-01' NULL 3 'E-commerce App' 2 '2009-10-15' NULL 4 'CMS' 2 '2010-02-01' NULL ... and one subtable for each product type: item_magazine ============= item_magazine_id INT title VARCHAR product_id INT -> Foreign key to product.product_id issue_number INT pages INT copies INT close_date DATETIME release_date DATETIME E.g. 1 'Foo Magazine Regular Issue' 1 89 52 150000 '2010-06-25' '2010-06-31' 2 'Foo Magazine Summer Special' 1 90 60 175000 '2010-07-25' '2010-07-31' 3 'Bar Weekly Review Regular Issue' 2 12 16 20000 '2010-06-01' '2010-06-02' item_web_site ============= item_web_site_id INT name VARCHAR product_id INT -> Foreign key to product.product_id bandwidth INT hits INT date_from DATETIME date_to DATETIME E.g. 1 'The Carpet Store' 3 10 90000 '2010-06-01' NULL 2 'Penauts R Us' 3 20 180000 '2010-08-01' NULL 3 'Springfield Cattle Fair' 4 15 150000 '2010-05-01' '2010-10-31' Now I want to add some fees that relate to one specific item. Since there are very little subtypes, it's feasible to do this: fee === fee_id INT fee_description VARCHAR item_magazine_id INT -> Foreign key to item_magazine.item_magazine_id item_web_site_id INT -> Foreign key to item_web_site.item_web_site_id net_price DECIMAL E.g.: 1 'Front cover' 2 NULL 1999.99 2 'Half page' 2 NULL 500.00 3 'Square banner' NULL 3 790.50 4 'Animation' NULL 3 2000.00 I have tight foreign keys to handle cascaded editions and I presume I can add a constraint so only one of the IDs is NOT NULL. However, my intuition suggests that it would be cleaner to get rid of the item_WHATEVER_id columns and keep a separate table: fee_to_item =========== fee_id INT -> Foreign key to fee.fee_id product_id INT -> Foreign key to product.product_id item_id INT -> ??? But I can't figure out how to create foreign keys on item_id since the source table varies depending on product_id. Should I stick to my original idea?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • a query is inserted from PHPMYAdmin but not from PHP

    - by iyad al aqel
    i'm writing a php code to insert form values in a forum values $dbServer = mysql_connect("localhost" , "root", "") ; if(!$dbServer) die ("Unable to connect"); mysql_select_db("kfumWonder"); $name= $_POST['name'] ; $password= md5($_POST['password']); $email= $_POST['email'] ; $major= $_POST['major'] ; $dateOfBirth=$_POST['dateOfBirth'] ; $webSite = $_POST['website']; $joinDate= date("Y m d") ; $query = "INSERT INTO user (name, password, email, major, dob, website, join_date) Values ('$name', '$password', '$email', '$major', '$dateOfBirth', '$webSite' , '$joinDate')" ; //echo $query ; $result = mysql_query($query) ; if (! $result ) echo " no results " ; this works perfectly fine when i took the printed query and run it in PHPMyAdmin but when i run this code nothing happens , any ideas !?

    Read the article

  • MySQL parameter resource error

    - by Derek
    Here is my error: Warning: mysql_query() expects parameter 2 to be resource, null given... This refers to line 23 of my code which is: $result = mysql_query($sql, $connection) My entire query code looks like this: $query = "SELECT * from users WHERE userid='".intval( $_SESSION['SESS_USERID'] )."'"; $result = mysql_query($query, $connection) or die ("Couldn't perform query $query <br />".mysql_error()); $row = mysql_fetch_array($result); I don't have a clue what has happpened here. All I wanted to do was to have the value of the users 'fullname' displayed in the header section of my web page. So I am outputting this code immediately after to try and achieve this: echo 'Hello '; echo $row['fullname']; Before this change, I had it working perfectly, where the session variable of fullname was echoed $_SESSION['SESS_NAME']. However, because my user can update their information (including their name), I wanted the name displayed in the header to be updated accordingly, and not displaying the session value.

    Read the article

  • Loading images to UIScrollview crashes

    - by Icky
    Hello All. I have a Navigationcontroller pushing a UIViewController with a scrollview inside. Within the scrollview I download a certain number of images around 20 (sometimes more) each sized around 150 KB. All these images are added to the scrollview so that their origin is x +imageSize and the following is sorted right to the one before. All in all I think its a lot of data (3-4 MB). On an I pod Touch this sometimes crashes, the IPhone can handle it once, if it has to load the data again (some other images) , it crashes too. I guess its a memory issue but within my code, I download the image, save it to a file on the phone as NSData, read it again from file and add it to a UIImageview which I release. So I have freed the memory I allocated, nevertheless it still crashes. Can anyone help me out? Since Im new to this, I dont know the best way to handle the Images in a scrollview. Besides I create the controller at start from nib, which means I dont have to release it, since I dont use alloc - right? Code: In my rootviewcontroller I do: -(void) showImages { [[self naviController] pushViewController:imagesViewController animated:YES]; [imagesViewController viewWillAppear:YES]; } Then in my Controller handling the scroll View, this is the method to load the images: - (void) loadOldImageData { for (int i = 0; i < 40 ; i++) { NSArray *paths = NSSearchPathForDirectoriesInDomains(NSDocumentDirectory, NSUserDomainMask, YES); NSString *documentsDirectory = [paths objectAtIndex:0]; NSString *filePath = [documentsDirectory stringByAppendingPathComponent:[NSString stringWithFormat:@"img%d.jpg", i]]; NSData *myImg = [NSData dataWithContentsOfFile:filePath]; UIImage *im = [UIImage imageWithData:myImg]; if([im isKindOfClass:[UIImage class]]) { NSLog(@"IM EXISTS"); UIImageView *imgView = [[UIImageView alloc] initWithImage:im]; CGRect frame = CGRectMake(i*320, 0, 320, 416); imgView.frame = frame; [myScrollView addSubview:imgView]; [imgView release]; //NSLog(@"Adding img %d", i); numberImages = i; NSLog(@"setting numberofimages to %d", numberImages); //NSLog(@"scroll subviews %d", [myScrollView.subviews count]); } } myScrollView.contentSize = CGSizeMake(320 * (numberImages + 1), 416); }

    Read the article

  • Curl Wrapper Class does not return any data even though it worked previously?

    - by Scott Faisal
    We changed servers and installed all necessary software and just cannot seem to pin point what is going on. A simple CURL request does not return anything. Command Line CURL commands work just fine. We are using a wrapper for CURL utilizing streams. Do PHP streams require any out of the ordinary configuration? We are using the latest Lamp stack. This is the var_dump: object(cURL_Response)#180 (14) { ["cURL:private"]= resource(288) of type (curl) ["data_stream:private"]= object(elTempStream)#178 (1) { ["fp"]= resource(290) of type (stream) } ["request_header:private"]= NULL ["response_header:private"]= object(cURL_Headers)#179 (1) { ["headers:private"]= string(0) "" } ["response_headers:private"]= array(1) { [0]= object(cURL_Headers)#179 (1) { ["headers:private"]= string(0) "" } } ["error:private"]= string(0) "" ["errno:private"]= int(0) ["info:private"]= array(21) { ["url"]= string(21) "http://www.yahoo.com/" ["content_type"]= string(23) "text/html;charset=utf-8" ["http_code"]= int(200) ["header_size"]= int(1195) ["request_size"]= int(1153) ["filetime"]= int(-1) ["ssl_verify_result"]= int(0) ["redirect_count"]= int(1) ["total_time"]= float(0.486924) ["namelookup_time"]= float(0.003692) ["connect_time"]= float(0.005709) ["pretransfer_time"]= float(0.005714) ["size_upload"]= float(0) ["size_download"]= float(28509) ["speed_download"]= float(58549) ["speed_upload"]= float(0) ["download_content_length"]= float(211) ["upload_content_length"]= float(0) ["starttransfer_time"]= float(0.149365) ["redirect_time"]= float(0.312743) ["request_header"]= string(973) "GET / HTTP/1.0 User-Agent: cURL_ClientBase (PHP v/5.2.6-1+lenny4) Host: www.yahoo.com Accept: / Accept-Encoding: gzip, deflate, compress Referer: http://yahoo.com Cookie: B=e5iber15t7u05&b=3&s=ie; fpc_s=d=GGX6WCTIR29HWsjgLxFejKc_YJWxRqm3jYdEd6lu7W5ophpuAHBm6JGtNvhv97anG4VtaIMHQBPg3JAMOZGq59Lz_tRn_TFXgUT8T_at5HdCktVJLycy&v=2; fpt=d=nt1OT7HPe9wVIkHbMkpzQOgbP3.mQ3o1SPX7k5ztrFrWeeSWK5IgQooRY.8KtTeRMiaSEZ0kv3sO1MWtEsAzjVlRCDAZBoxqOs17v6PaZbPRqmDc92ivoMia.CqjufRs4_guOO4AyhRZ7_ml8rzxFrYeexpR2jLN0oPMyEWT0nbEf6Sdf._Bkh0HMfmI7KBnEx5uZBEEmV.wTfGRLG7zSd9sA4itOFv.r6AjP39CnogSn7NTJnqg_kEcKoiCM.lR5w_MqMc8IgWMBgSAZZgGEZpfmvxlQGnUzPwNh2pSpTe2wxFS3v1zPopDgoo2VsO3uzeyA3A_j7Hlk1P8T08DHbfr6ApDMUcr7d0QIt4pGYIxVV45XzfgpT7mgUdMei6VZrD9ozVQF0oqxrs1Ufri.XzPdB3NdQ--&v=1; fpc=d=sRPCfUfBTW96.RGiQn4hSkfi3p7WnPCAqYl5YoHecI7zjg7gH7PolscoPcq1Esm8dR.Rg1.AbQCpo2WBPXn1St96PpcjeCC.pj2.Upb3mKSRQkYPIVP1vQcL9nL7J8s9Z0VIXjiBFgSUcxyzDeUdP4us2YbVO3PbaVIwaIEfFsX3WI7YgiTbkrTGtwnFgoSYq6l8tnw-&v=2" } ["info_flagged:private"]= array(20) { [1048577]= string(21) "http://www.yahoo.com/" [2097154]= int(200) [2097166]= int(-1) [3145731]= float(0.486924) [3145732]= float(0.003692) [3145733]= float(0.005709) [3145734]= float(0.005714) [3145745]= float(0.149365) [3145747]= float(0.312743) [3145735]= float(0) [3145736]= float(28509) [3145737]= float(58549) [3145738]= float(0) [2097163]= int(1195) [2]= string(973) "GET / HTTP/1.0 User-Agent: cURL_ClientBase (PHP v/5.2.6-1+lenny4) Host: www.yahoo.com Accept: / Accept-Encoding: gzip, deflate, compress Referer: http://yahoo.com Cookie: B=e5iber15t7u05&b=3&s=ie; fpc_s=d=GGX6WCTIR29HWsjgLxFejKc_YJWxRqm3jYdEd6lu7W5ophpuAHBm6JGtNvhv97anG4VtaIMHQBPg3JAMOZGq59Lz_tRn_TFXgUT8T_at5HdCktVJLycy&v=2; fpt=d=nt1OT7HPe9wVIkHbMkpzQOgbP3.mQ3o1SPX7k5ztrFrWeeSWK5IgQooRY.8KtTeRMiaSEZ0kv3sO1MWtEsAzjVlRCDAZBoxqOs17v6PaZbPRqmDc92ivoMia.CqjufRs4_guOO4AyhRZ7_ml8rzxFrYeexpR2jLN0oPMyEWT0nbEf6Sdf._Bkh0HMfmI7KBnEx5uZBEEmV.wTfGRLG7zSd9sA4itOFv.r6AjP39CnogSn7NTJnqg_kEcKoiCM.lR5w_MqMc8IgWMBgSAZZgGEZpfmvxlQGnUzPwNh2pSpTe2wxFS3v1zPopDgoo2VsO3uzeyA3A_j7Hlk1P8T08DHbfr6ApDMUcr7d0QIt4pGYIxVV45XzfgpT7mgUdMei6VZrD9ozVQF0oqxrs1Ufri.XzPdB3NdQ--&v=1; fpc=d=sRPCfUfBTW96.RGiQn4hSkfi3p7WnPCAqYl5YoHecI7zjg7gH7PolscoPcq1Esm8dR.Rg1.AbQCpo2WBPXn1St96PpcjeCC.pj2.Upb3mKSRQkYPIVP1vQcL9nL7J8s9Z0VIXjiBFgSUcxyzDeUdP4us2YbVO3PbaVIwaIEfFsX3WI7YgiTbkrTGtwnFgoSYq6l8tnw-&v=2" [2097164]= int(1153) [2097165]= int(0) [3145743]= float(211) [3145744]= float(0) [1048594]= string(23) "text/html;charset=utf-8" } ["request_url:private"]= string(16) "http://yahoo.com" ["response_url:private"]= string(21) "http://www.yahoo.com/" ["status_code:private"]= int(200) ["cookies:private"]= array(0) { } ["request_headers"]= string(973) "GET / HTTP/1.0 User-Agent: cURL_ClientBase (PHP v/5.2.6-1+lenny4) Host: www.yahoo.com Accept: / Accept-Encoding: gzip, deflate, compress Referer: http://yahoo.com Cookie: B=e5iber15t7u05&b=3&s=ie; fpc_s=d=GGX6WCTIR29HWsjgLxFejKc_YJWxRqm3jYdEd6lu7W5ophpuAHBm6JGtNvhv97anG4VtaIMHQBPg3JAMOZGq59Lz_tRn_TFXgUT8T_at5HdCktVJLycy&v=2; fpt=d=nt1OT7HPe9wVIkHbMkpzQOgbP3.mQ3o1SPX7k5ztrFrWeeSWK5IgQooRY.8KtTeRMiaSEZ0kv3sO1MWtEsAzjVlRCDAZBoxqOs17v6PaZbPRqmDc92ivoMia.CqjufRs4_guOO4AyhRZ7_ml8rzxFrYeexpR2jLN0oPMyEWT0nbEf6Sdf._Bkh0HMfmI7KBnEx5uZBEEmV.wTfGRLG7zSd9sA4itOFv.r6AjP39CnogSn7NTJnqg_kEcKoiCM.lR5w_MqMc8IgWMBgSAZZgGEZpfmvxlQGnUzPwNh2pSpTe2wxFS3v1zPopDgoo2VsO3uzeyA3A_j7Hlk1P8T08DHbfr6ApDMUcr7d0QIt4pGYIxVV45XzfgpT7mgUdMei6VZrD9ozVQF0oqxrs1Ufri.XzPdB3NdQ--&v=1; fpc=d=sRPCfUfBTW96.RGiQn4hSkfi3p7WnPCAqYl5YoHecI7zjg7gH7PolscoPcq1Esm8dR.Rg1.AbQCpo2WBPXn1St96PpcjeCC.pj2.Upb3mKSRQkYPIVP1vQcL9nL7J8s9Z0VIXjiBFgSUcxyzDeUdP4us2YbVO3PbaVIwaIEfFsX3WI7YgiTbkrTGtwnFgoSYq6l8tnw-&v=2" }

    Read the article

  • TcpListener Socket still active after program exits.

    - by lnical
    I'm trying to stop a TCP Listener as my program is exiting. I do not care about any data that is currently active on the socket or any of the active client sockets. The socket clean up code is essentially: try { myServer.Server.Shutdown(SocketShutdown.Both) } catch (Exception ex) { LogException(ex) } myServer.Server.Close(0) myServer.Stop() myServer is a TCPListener On some occasions, Shutdown will thrown an exception System.Net.Sockets.SocketException: A request to send or receive data was disallowed because the socket is not connected and (when sending on a datagram socket using a sendto call) no address was supplied at System.Net.Sockets.Socket.Shutdown(SocketShutdown how) When this happens, the socket is never released. Even after the application exits netstat shows the socket is still in the listening state. I have not been able to create definitive reproduction scenerio, it happens at seemingly random times. Client Sockets are cleaned up independently. Do you have any suggestions to help me make this socket die?

    Read the article

  • PHP: Remove Simple Session with Get-Method

    - by elmaso
    Hello, I want to Remove the Sessions from this php code, actually if someone searches i get this url search.php?searchquery=test but if I reload the page, the results are cleaned. how can I remove the Sessions to get the Results still, if someone reloads the page? this are the codes: search.php <?php session_start(); ?> <form method="get" action="querygoogle.php"> <label for="searchquery"><span class="caption">Search this site</span> <input type="text" size="20" maxlength="255" title="Enter your keywords and click the search button" name="searchquery" /></label> <input type="submit" value="Search" /> </form> <?php if(!empty($_SESSION['googleresults'])) { echo $_SESSION['googleresults']; unset($_SESSION['googleresults']); } ?> querygoogle.php <?php session_start(); $url = 'http://www.example.com'; $handle = fopen($url, 'rb'); $body = ''; while (!feof($handle)) { $body .= fread($handle, 8192); } fclose($handle); $json = json_decode($body); foreach($json->responseData->results as $searchresult) { if($searchresult->GsearchResultClass == 'GwebSearch') { $formattedresults .= ' <div class="searchresult"> <h3><a href="' . $searchresult->unescapedUrl . '">' . $searchresult->titleNoFormatting . '</a></h3> <p class="resultdesc">' . $searchresult->content . '</p> <p class="resulturl">' . $searchresult->visibleUrl . '</p> </div>'; } } $_SESSION['googleresults'] = $formattedresults; header("Location: search.php?searchquery=" . $_GET['searchquery']); exit; ?> thank you for your help!!

    Read the article

  • Converting C source to C++

    - by Barry Kelly
    How would you go about converting a reasonably large (300K), fairly mature C codebase to C++? The kind of C I have in mind is split into files roughly corresponding to modules (i.e. less granular than a typical OO class-based decomposition), using internal linkage in lieu private functions and data, and external linkage for public functions and data. Global variables are used extensively for communication between the modules. There is a very extensive integration test suite available, but no unit (i.e. module) level tests. I have in mind a general strategy: Compile everything in C++'s C subset and get that working. Convert modules into huge classes, so that all the cross-references are scoped by a class name, but leaving all functions and data as static members, and get that working. Convert huge classes into instances with appropriate constructors and initialized cross-references; replace static member accesses with indirect accesses as appropriate; and get that working. Now, approach the project as an ill-factored OO application, and write unit tests where dependencies are tractable, and decompose into separate classes where they are not; the goal here would be to move from one working program to another at each transformation. Obviously, this would be quite a bit of work. Are there any case studies / war stories out there on this kind of translation? Alternative strategies? Other useful advice? Note 1: the program is a compiler, and probably millions of other programs rely on its behaviour not changing, so wholesale rewriting is pretty much not an option. Note 2: the source is nearly 20 years old, and has perhaps 30% code churn (lines modified + added / previous total lines) per year. It is heavily maintained and extended, in other words. Thus, one of the goals would be to increase mantainability. [For the sake of the question, assume that translation into C++ is mandatory, and that leaving it in C is not an option. The point of adding this condition is to weed out the "leave it in C" answers.]

    Read the article

  • Programatically created UITableViewCell subclass only working on highlight

    - by squarefrog
    I've created a subclass of UITableViewCell but I'm struggling to get it to work properly. If I use UITableViewStyleDefault then the class only works when highlighted. If I use UITableViewStyleValue1 then it mostly works but I'm unable to change label fonts much. I tried researching but it seems everyone is doing this via a .xib file, but not programatically. Implementation file #import "ASCustomCellWithCount.h" @implementation ASCustomCellWithCount @synthesize primaryLabel,secondaryLabel,contentCountImage,contentCount; - (id)initWithStyle:(UITableViewCellStyle)style reuseIdentifier:(NSString *)reuseIdentifier { self = [super initWithStyle:style reuseIdentifier:reuseIdentifier]; if (self) { // Initialization code contentCountImage = [[UIImageView alloc] initWithImage:[UIImage imageNamed: @"tableCount.png"] ]; primaryLabel = [[UILabel alloc] init]; primaryLabel.textAlignment = UITextAlignmentLeft; primaryLabel.textColor = [UIColor blackColor]; primaryLabel.font = [UIFont systemFontOfSize: 20]; primaryLabel.backgroundColor = [UIColor clearColor]; secondaryLabel = [[UILabel alloc] init]; secondaryLabel.textAlignment = UITextAlignmentLeft; secondaryLabel.textColor = [UIColor blackColor]; secondaryLabel.font = [UIFont systemFontOfSize: 8]; secondaryLabel.backgroundColor = [UIColor clearColor]; contentCount = [[UILabel alloc] init]; contentCount.textAlignment = UITextAlignmentCenter; contentCount.font = [UIFont boldSystemFontOfSize: 15]; contentCount.textColor = [UIColor whiteColor]; contentCount.shadowColor = [UIColor blackColor]; contentCount.shadowOffset = CGSizeMake(1, 1); contentCount.backgroundColor = [UIColor clearColor]; [self.contentView addSubview: contentCountImage]; [self.contentView addSubview: primaryLabel]; [self.contentView addSubview: secondaryLabel]; [self.contentView addSubview: contentCount]; } return self; } - (void)layoutSubviews { [super layoutSubviews]; CGRect contentRect = self.contentView.bounds; // CGFloat boundsX = contentRect.origin.x; primaryLabel.frame = CGRectMake(0 ,0, 200, 25); secondaryLabel.frame = CGRectMake(0, 30, 100, 15); contentCount.frame = CGRectMake(contentRect.size.width - 48, contentRect.size.height / 2 - 13, 36, 24); contentCountImage.frame = CGRectMake(contentRect.size.width - 48, contentRect.size.height / 2 - 12, 36, 24); } - (void)setSelected:(BOOL)selected animated:(BOOL)animated { [super setSelected:selected animated:animated]; // Configure the view for the selected state } - (void)dealloc { [primaryLabel release]; [secondaryLabel release]; [contentCountImage release]; [contentCount release]; } @end And then to create the cell I use - (UITableViewCell *)tableView:(UITableView *)tableView cellForRowAtIndexPath:(NSIndexPath *)indexPath { static NSString *CellIdentifier = @"Cell"; ASCustomCellWithCount *cell = [tableView dequeueReusableCellWithIdentifier:CellIdentifier]; if (cell == nil) { cell = [[[ASCustomCellWithCount alloc] initWithStyle: UITableViewCellStyleDefault reuseIdentifier:CellIdentifier] autorelease]; } cell.textLabel.text = [NSString stringWithFormat:@"%@", [tempArray objectAtIndex: indexPath.row]]; cell.contentCount.text = @"49"; return cell; }

    Read the article

  • Which MS technologies would be suited for a data intensive application?

    - by steve.tse
    I'm a junior VB.net developer with little application design knowledge. I've been reading a lot of material online regarding different design patterns, frameworks, and methodologies. It's become a bit confusing for me. Right now I'm trying to decide on what language would be best suited to convert an existing VB6 application (with SQL server backend.) I need to update the UI and add more user functionality and reporting capabilities. Initially I was thinking of using WPF and attempting the MVVM model for this big project. Reports would be generated from SSRS. A peer suggested using ASP.net and I don't have enough experience to determine what would be better. The senior programmers here are stuck on using VB6 and don't have any input on what to use. They are encouraging me to use the latest technologies. This application would be for ~20 users in a central location. Ideally I would stick to a Microsoft .net language. Current interface is similar to a datagrid table where the user would click in to see the detail of each record. They would need to have multiple records open at any given time. I look forward to all the advice I can get. EDIT 2010/04/22 2:47 PM EST What is your audience? Internal clients within an intranet How complex are the interactions you expect to implement? not very... displaying data from SQL server to UI. Allow user updates to said data. Typically just one user modifying a record. Do you require near real-time data updates? no How often do you expect to update the application after the first release? twice/year Do you expect a well-defined set of client platforms? Yes, windows xp environment, potentially upgrading to Win7. Currently in IE.6 moving to IE7 or 8 within a couple of months. Do users need access from anywhere? No, just from their PC.

    Read the article

  • div popup inside td

    - by sims
    I have a table with a bunch of cells. (No way! Amazing! :P) Some of the cells have a small div that when you put your mouse over, it gets bigger so you can read all the text. This works well and all. However, since html elements that come later in the document have a higher z-index, when the div gets bigger it is underneath the other divs in the other cells. Some html code: <table> <tr> <td> limited info <div style="position: relative;"> <div style="position: absolute; top: 0; left: 0; width: 1em; height: 1em;" onmouseover="tooltipshow(this)" onmouseout="tooltiphide(this)"> informative long text is here </div> </div> </td> <td> some short info <div style="position: relative;"> <div style="position: absolute; top: 0; left: 0; width: 1em; height: 1em;" onmouseover="tooltipshow(this)" onmouseout="tooltiphide(this)"> longer explanation about what is really going on that covers the div up there ^^^. darn! </div> </div> </td> </tr> </table> Some js code: function tooltipshow(obj) { obj.style.width = '30em'; obj.style.zIndex = '100'; } function tooltiphide(obj) { obj.style.width = '1em'; obj.style.zIndex = '20'; } It doesn't matter if I set z-index dynamically to something higher onmouseover. It's like z-index has no affect. I think it has something to do with the table. I've tested this in FF3. When I'm feeling particularly macho, I'll test it in IE.

    Read the article

  • How can I change the TreeView Icon into a folder icon?

    - by KDP
    I'm trying to change the icon of my TreeView in a folder icon. Also when it collapses it needs to have an opened folder icon. My treeview has databound items in it and the code is: <TreeView x:Name="TreeViewCategories" Grid.Row="0" Grid.Column="1" Height="610" HorizontalAlignment="Left" Margin="29,111,0,0" VerticalAlignment="Top" Width="315" BorderThickness="0" Background="Transparent" > <TreeView.ItemTemplate> <HierarchicalDataTemplate ItemsSource="{Binding Items}"> <TextBlock FontSize="20" Text="{Binding Name}" PreviewMouseDown="TextBlock_PreviewMouseDown"/> </HierarchicalDataTemplate> </TreeView.ItemTemplate> </TreeView> Also this is how I fill the treeview with items from XML (It's a snipped out of alot of code: private void LoadHospitalXML() { try { FileStream fs = new FileStream("ConfigOrgHospital.xml", FileMode.Open, FileAccess.Read); var xml = XmlReader.Create(fs); rootElement = ConvertHospitalData(xml); this.TreeViewCategories.ItemsSource = null; List<HospitalWrapper> li = new List<HospitalWrapper>(); var hosp = rootElement.Items.FirstOrDefault(); if (hosp != null) { foreach (var i in hosp.Hospital) { li.AddIfNotNull(CreateHospList(i)); } } this.TreeViewCategories.ItemsSource = li; } catch (Exception e) { MessageBox.Show(e.Message); } } private HospitalWrapper CreateHospList(object obj) { var newItem = new HospitalWrapper(); newItem.Context = obj; //Hospital Names// if (obj is HospitalDataHospitalsHospital) { var hosp = (HospitalDataHospitalsHospital)obj; //newItem.Title = "Hospitals"; newItem.Name = hosp.DefaultName; var tmp = new HospitalWrapper(); tmp.Name = "Sites"; tmp.IsTitle = true; if (hosp.Sites != null) foreach (var i in hosp.Sites) { tmp.Items.AddIfNotNull(CreateHospList(i)); } newItem.Items.Add(tmp); tmp = new HospitalWrapper(); tmp.Name = "Specialties"; tmp.IsTitle = true; if (hosp.Deps != null) foreach (var j in hosp.Deps) { tmp.Items.AddIfNotNull(CreateHospList(j)); } newItem.Items.Add(tmp); } }

    Read the article

  • Project Euler #18 - how to brute force all possible paths in tree-like structure using Python?

    - by euler user
    Am trying to learn Python the Atlantic way and am stuck on Project Euler #18. All of the stuff I can find on the web (and there's a LOT more googling that happened beyond that) is some variation on 'well you COULD brute force it, but here's a more elegant solution'... I get it, I totally do. There are really neat solutions out there, and I look forward to the day where the phrase 'acyclic graph' conjures up something more than a hazy, 1 megapixel resolution in my head. But I need to walk before I run here, see the state, and toy around with the brute force answer. So, question: how do I generate (enumerate?) all valid paths for the triangle in Project Euler #18 and store them in an appropriate python data structure? (A list of lists is my initial inclination?). I don't want the answer - I want to know how to brute force all the paths and store them into a data structure. Here's what I've got. I'm definitely looping over the data set wrong. The desired behavior would be to go 'depth first(?)' rather than just looping over each row ineffectually.. I read ch. 3 of Norvig's book but couldn't translate the psuedo-code. Tried reading over the AIMA python library for ch. 3 but it makes too many leaps. triangle = [ [75], [95, 64], [17, 47, 82], [18, 35, 87, 10], [20, 4, 82, 47, 65], [19, 1, 23, 75, 3, 34], [88, 2, 77, 73, 7, 63, 67], [99, 65, 4, 28, 6, 16, 70, 92], [41, 41, 26, 56, 83, 40, 80, 70, 33], [41, 48, 72, 33, 47, 32, 37, 16, 94, 29], [53, 71, 44, 65, 25, 43, 91, 52, 97, 51, 14], [70, 11, 33, 28, 77, 73, 17, 78, 39, 68, 17, 57], [91, 71, 52, 38, 17, 14, 91, 43, 58, 50, 27, 29, 48], [63, 66, 4, 68, 89, 53, 67, 30, 73, 16, 69, 87, 40, 31], [04, 62, 98, 27, 23, 9, 70, 98, 73, 93, 38, 53, 60, 4, 23], ] def expand_node(r, c): return [[r+1,c+0],[r+1,c+1]] all_paths = [] my_path = [] for i in xrange(0, len(triangle)): for j in xrange(0, len(triangle[i])): print 'row ', i, ' and col ', j, ' value is ', triangle[i][j] ??my_path = somehow chain these together??? if my_path not in all_paths all_paths.append(my_path) Answers that avoid external libraries (like itertools) preferred.

    Read the article

  • C strange array behaviour

    - by LukeN
    After learning that both strncmp is not what it seems to be and strlcpy not being available on my operating system (Linux), I figured I could try and write it myself. I found a quote from Ulrich Drepper, the libc maintainer, who posted an alternative to strlcpy using mempcpy. I don't have mempcpy either, but it's behaviour was easy to replicate. First of, this is the testcase I have #include <stdio.h> #include <string.h> #define BSIZE 10 void insp(const char* s, int n) { int i; for (i = 0; i < n; i++) printf("%c ", s[i]); printf("\n"); for (i = 0; i < n; i++) printf("%02X ", s[i]); printf("\n"); return; } int copy_string(char *dest, const char *src, int n) { int r = strlen(memcpy(dest, src, n-1)); dest[r] = 0; return r; } int main() { char b[BSIZE]; memset(b, 0, BSIZE); printf("Buffer size is %d", BSIZE); insp(b, BSIZE); printf("\nFirst copy:\n"); copy_string(b, "First", BSIZE); insp(b, BSIZE); printf("b = '%s'\n", b); printf("\nSecond copy:\n"); copy_string(b, "Second", BSIZE); insp(b, BSIZE); printf("b = '%s'\n", b); return 0; } And this is its result: Buffer size is 10 00 00 00 00 00 00 00 00 00 00 First copy: F i r s t b = 46 69 72 73 74 00 62 20 3D 00 b = 'First' Second copy: S e c o n d 53 65 63 6F 6E 64 00 00 01 00 b = 'Second' You can see in the internal representation (the lines insp() created) that there's some noise mixed in, like the printf() format string in the inspection after the first copy, and a foreign 0x01 in the second copy. The strings are copied intact and it correctly handles too long source strings (let's ignore the possible issue with passing 0 as length to copy_string for now, I'll fix that later). But why are there foreign array contents (from the format string) inside my destination? It's as if the destination was actually RESIZED to match the new length.

    Read the article

  • How to change the JSON output format and how to support chinese character?

    - by sky
    Currently I using the following code to get my JSON output from MySQL. <?php $session = mysql_connect('localhost','name','pass'); mysql_select_db('dbname', $session); $result= mysql_query('SELECT message FROM posts', $session); $somethings = array(); while ($row = mysql_fetch_assoc($result)) { $somethings[] = $row; } ?> <script type="text/javascript"> var somethings= <?php echo json_encode($somethings); ?>; </script> And the output is: <script type="text/javascript"> var somethings= [{"message":"Welcome to Yo~ :)"},{"message":"Try iPhone post!"},{"message":"????"}]; </script> Here is the question, how can I change my output into format like : <script type="text/javascript"> userAge = new Array('21','36','20'), userMid = new Array('liuple','anhu','jacksen'); </script> Which I'll be using later with following code : var html = ' <table class="map-overlay"> <tr> <td class="user">' + '<a class="username" href="/' + **userMid[index]** + '" target="_blank"><img alt="" src="' + getAvatar(signImgList[index], '72x72') + '"></a><br> <a class="username" href="/' + **userMid[index]** + '" target="_blank">' + userNameList[index] + '</a><br> <span class="info">' + **userSex[index]** + ' ' + **userAge[index]** + '?<br> ' + cityList[index] + '</span>' + '</td> <td class="content">' + picString + somethings[index] + '<br> <span class="time">' + timeList[index] + picTips + '</span></td> </tr> </table> '; Thanks for helping and reading!

    Read the article

  • Fast response on first Socket I/O request but slow every other time when communicating with remote serial port

    - by GreenGodot
    I'm using sockets to pass Serial commands to a remote device. And the response to that request is sent back and printed out. However, I am having a problem in that the first time it is instant but the rest of the time it can take up to 20 seconds to receive a reply. I think the problem is with my attempt at threading but I am not entirely sure. new Thread() { @Override public void run() { System.out.println("opened"); try { isSocketRetrieving.setText("Opening Socket"); socket = new Socket(getAddress(), getRemotePort())); DataOutput = new DataOutputStream(socket .getOutputStream()); inFromServer = new BufferedReader( new InputStreamReader(socket .getInputStream())); String line = ""; isSocketRetrieving.setText("Reading Stream......"); while ((line = inFromServer.readLine()) != null) { System.out.println(line); if (line.contains(getHandshakeRequest())) { DataOutput.write((getHandshakeResponse()toString() + "\r").getBytes()); DataOutput.flush(); DataOutput .write((getCommand().toString() + "\r").getBytes()); DataOutput.flush(); int pause = (line.length()*8*1000)/getBaud(); sleep(pause); } else if (line.contains(readingObject .getExpected())) { System.out.println(line); textArea.append("value = " + line + "\n"); textAreaScroll.revalidate(); System.out.println("Got Value"); break; } } System.out.println("Ended"); try { inFromServer.close(); DataOutput.close(); socket.close(); isSocketRetrieving.setText("Socket is inactive..."); rs232Table.addMouseListener(listener); interrupt(); join(); } catch (IOException e) { e.printStackTrace(); } catch (InterruptedException e) { System.out.println("Thread exited"); } } catch (NumberFormatException e1) { e1.printStackTrace(); } catch (UnknownHostException e1) { e1.printStackTrace(); } catch (IOException e1) { e1.printStackTrace(); } catch (InterruptedException e) { // TODO Auto-generated catch block e.printStackTrace(); } } }.start();

    Read the article

  • Calculate minimum moves to solve a puzzle

    - by Luke
    I'm in the process of creating a game where the user will be presented with 2 sets of colored tiles. In order to ensure that the puzzle is solvable, I start with one set, copy it to a second set, then swap tiles from one set to another. Currently, (and this is where my issue lies) the number of swaps is determined by the level the user is playing - 1 swap for level 1, 2 swaps for level 2, etc. This same number of swaps is used as a goal in the game. The user must complete the puzzle by swapping a tile from one set to the other to make the 2 sets match (by color). The order of the tiles in the (user) solved puzzle doesn't matter as long as the 2 sets match. The problem I have is that as the number of swaps I used to generate the puzzle approaches the number of tiles in each set, the puzzle becomes easier to solve. Basically, you can just drag from one set in whatever order you need for the second set and solve the puzzle with plenty of moves left. What I am looking to do is after I finish building the puzzle, calculate the minimum number of moves required to solve the puzzle. Again, this is almost always less than the number of swaps used to create the puzzle, especially as the number of swaps approaches the number of tiles in each set. My goal is to calculate the best case scenario and then give the user a "fudge factor" (i.e. 1.2 times the minimum number of moves). Solving the puzzle in under this number of moves will result in passing the level. A little background as to how I currently have the game configured: Levels 1 to 10: 9 tiles in each set. 5 different color tiles. Levels 11 to 20: 12 tiles in each set. 7 different color tiles. Levels 21 to 25: 15 tiles in each set. 10 different color tiles. Swapping within a set is not allowed. For each level, there will be at least 2 tiles of a given color (one for each set in the solved puzzle). Is there any type of algorithm anyone could recommend to calculate the minimum number of moves to solve a given puzzle?

    Read the article

  • Have threads run indefinitely in a java application

    - by TP
    I am trying to program a game in which I have a Table class and each person sitting at the table is a separate thread. The game involves the people passing tokens around and then stopping when the party chime sounds. how do i program the run() method so that once I start the person threads, they do not die and are alive until the end of the game One solution that I tried was having a while (true) {} loop in the run() method but that increases my CPU utilization to around 60-70 percent. Is there a better method?

    Read the article

  • php database session handling problem in IE8!

    - by psyb0rg
    I've got an html page from where Im making this call periodically: function logon(id) { $.get("data.php", { action: 'online', userID: id}, function(data){ $("#msg").html(data); }); } What this does is it calls this SQL script in data.php: $sql = "update user_sessions set expires=(expires + 2) where userID = $userID"; mysql_query($sql, $conn) or die(mysql_error()); echo $sql; I can see by the echo that the sql syntax and values are correct, but THE CHANGES TO THE expires FIELD ARE NOT DONE, ONLY IN IE8!! It works fine in other ff, safari, chrome, ie6 and 7. There is nothing browser specific about making this sql call, but the user_sessions table is used to store PHP's sessions. Im only increasing the session expiry time when the call is made. What in IE8's session handling is preventing the session time from changing? Is there any caching or cookie problem that needs to be changed?

    Read the article

< Previous Page | 429 430 431 432 433 434 435 436 437 438 439 440  | Next Page >