Search Results

Search found 52791 results on 2112 pages for 'page size'.

Page 435/2112 | < Previous Page | 431 432 433 434 435 436 437 438 439 440 441 442  | Next Page >

  • Best Practice for Images with Codeigniter : Generating Thumbs or Resizing on the Fly

    - by Steve K
    Hi all, I know there’s been a good deal written on thumbnail generation and the like with CI, but I wanted to explain what I’ve made and see what kind of best-practice advice I could find. Here’s my story… Currently, I have a site which allows users to upload collections of photos to projects they’ve created after first creating an account. Upon account creation, the site generates folders for the users in the following fashion for each of five pre-defined projects: /students/username/project_num/images/thumbs/ (This is to say that within a pre-created students folder, the username, project_num, images and thumbs folders are created recursively five times.) When a user uploads images to a project, I have a gallery controller which uploads the full images into the images folder for the project_num, and then creates a smaller thumbnail which maintains its ratio. So far so good. On the index page of the site, where these thumbnails and full images are displayed, I had a bit of a brain lapse, thinking I could simply output the full image while resizing it via css for a ‘medium-size’ image which would lead to the full-size image when clicked. (To be clear, the path is: Click on thumbnail— Load scaled full-size (medium-size) image via ajax into a display area above thumbs— Click on medium-sized image— Load full size image via lightbox, or something of that nature.) I have everything working to this point, except, as one might imagine, resizing the full-sized images with css doesn’t maintain aspect ratio for the thumbs, which means I need to find the best way to resize these. In thinking about it, I figured I had two options: I could resize the image on the fly when the user clicks a thumbnail to load the medium-sized image via ajax. (I have a method ‘get_image($url)’ in my gallery controller which simply loads a view with an image tag and the image source passed to it, etc.) I thought perhaps I could send it first to my gallery model, resize it there on the fly, and send it on to the view. The problem I’m having is that resizing it on the fly and echoing it out gives me the raw image data (I apologize, I don’t know that’s the right term). I’ve tried using data_uris to format the raw data into something echoable, but with no success. Is this method possible? The second option I considered was to generate a second medium-sized thumbnail when the user uploads the image with maintain_ratio set to true. This method is slightly less ideal, given that when providing a way for the user to delete their projects, I’ll need to scan for an additional set of images to delete. Not a huge deal, definitely, but something I figured could be avoided by generating the medium-sized image on the fly. I hope I’ve been clear in my explanations, if long-winded! I’m very curious to see what suggestions folks have about the best way to handle this. Much thanks for reading, and any suggestions are much-appreciated! Steve K.

    Read the article

  • Jquery flowplayer - tabs - content inside div tags not displaying

    - by Gublooo
    Hey guys, I'm looking for a simple example of JQuery tabs in which I am planning to show two different forms. I came across this example http://flowplayer.org/tools/demos/tabs/index.htm which is perfect for my needs. So I implemented the simple example. The code in question is: <div class="panes" <divFirst tab content. Tab contents are called "panes"</div <divSecond tab content</div <divThird tab content</div </div Now my content for the first tab is a form which has several of its own div tags - when I put that form with div tags as the content for the first tab - nothing appears. So I made a simple change and added another div tag to the content of the first tab as shown below and still nothing appears: <div class="panes" <div<divFirst tab content. Tab contents are called "panes"</div</div <divSecond tab content</div <divThird tab content</div </div Is there a simple way to fix this. This is the content that I want to display in my first tab - Thanks for your help <div id="formbox" class="formbox" <form id="shopping_form" method="post" <div id="3" style="width:520px;" <textarea id="message" name="message" rows="3" cols="50"</textarea </div <div id="store_row" style="width:220px;float:left;padding-bottom:10px;"<bStore</b <input type="text" id="store" name="store" class="required" size="20" / <input type="hidden" id="store_id"/ </div <div id="city_column" style="width:200px;float:left;padding-bottom:10px;"<bCity</b <input type="text" id="city" name="city" size="15"/ </div <div id="findbutton_column" style="vertical-align:top;width:80px;float:left;" <input class="find_address" id="findaddress" type="button" value="Find Store"/ </div <div id="googlerow" style="width:120px;float:left;padding-bottom:10px;" <bSelect Store</b<select id="google_stores" name="google_stores"</select <input type="hidden" id="google_address"/ </div <div id="google_message" style="float:left;padding-bottom:10px;display:none;"</div <div id="locationrow" style="float:left;padding-bottom:10px;display:none;" <bAddress/Country</b <input type="text" id="address" name="address" size="20" / <input type="text" id="country" name="country" size="20"/ </div <div style="width:520px;float:left;padding-bottom:10px;" <bPrice    <input type="text" id="price" name="price" size="20" / </div <div id="buttonrow" style="width:200px;float:right;display:none;" <input id="it" type="image" src="http://images.pe.com.s3.amazonaws.com/it.png" height="35px"/ </div </form </div

    Read the article

  • JSON, Ajax login and signup form problem, critique

    - by user552828
    Here is my problem; indexdeneme2.php has two forms Sign up and Login form, and there is validation.js and login.js which are handling the AJAX and JSON response, there are validate.php and login.php which are my scripts for validating and login. When you sign up, it sends the data to validate.php perfectly and validate.php response with JSON perfectly, validate.js must show the error in #error div. validation.js works perfectly if it is working alone. I use same kind of script for login form. Login.php also works perfectly it responses with JSON and login.js shows the errors are appear in #errorlogin div. But this works when login.js works alone. When I try to work login.js and validate.js together, it is not working. validate.php and login.php works perfectly but login.js and validation.js are not working together. They can't handle the responses coming from php scripts. It is not showing the errors in #errorlogin and #error div. They intercept each other I guess. By the way if you can critique my login.php and validate.php I will be really appreciated. Thank you all. this is indexdeneme2.php <?php include('functions.php')?> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> <title>Untitled Document</title> <link rel="stylesheet" href="css/cssdeneme1.css" /> <script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.3.2/jquery.min.js"></script> <script type="text/javascript" src="validation.js"></script> <script type="text/javascript" src="login.js"></script> <script type="text/javascript"> var RecaptchaOptions = { theme : 'custom', custom_theme_widget: 'recaptcha_widget' }; </script> </head> <body onload="document.signup.reset()"> <div id="topbar"> <div class="wrapper"> </div> </div> <div id="middlebar"> <div class="wrapper"> <div id="middleleft"> <div id="mainformsecondcover"> <div id="mainform"> <div id="formhead"> <div id="signup">Sign Up</div> </div> <form method="post" action="validate.php" id="myform" name="signup"> <div id="form"> <table border="0" cellpadding="0" cellspacing="1"> <tbody> <tr> <td class="formlabel"> <label for="name">First Name:</label> </td> <td class="forminput"> <input type="text" name="name" id="name" /> </td> </tr> <tr> <td class="formlabel"> <label for="lastname">Last Name:</label> </td> <td class="forminput"> <input type="text" name="surname" id="lastname" /> </td> </tr> <tr> <td class="formlabel"> <label for="email">Email:</label> </td> <td class="forminput"> <input type="text" name="email" id="email" /> </td> </tr> <tr> <td class="formlabel"> <label for="remail">Re-Enter Email:</label> </td> <td class="forminput"> <input type="text" name="remail" id="remail" /> </td> </tr> <tr> <td class="formlabel"> <label for="password">Password:</label> </td> <td class="forminput"> <input type="password" name="password" id="password" maxlength="16" /> </td> </tr> <tr> <td class="formlabel"> <label for="gender">I am:</label> </td> <td class="forminput"> <select name="gender" id="gender"> <option value="0" selected="selected">-Select Sex-</option> <option value="1">Male</option> <option value="2">Female</option> </select> </td> </tr> <tr> <td class="formlabel"> <label>My Birthday:</label> </td> <td class="forminput"> <select size="1" name="day"> <option value="0" selected="selected">Day</option> <?php formDay(); ?> </select>&nbsp; <select size="1" name="month"> <option value="0" selected="selected">Month</option> <option value="1">January</option> <option value="2">February</option> <option value="3">March</option> <option value="4">April</option> <option value="5">May</option> <option value="6">June</option> <option value="7">July</option> <option value="8">August</option> <option value="9">September</option> <option value="10">October</option> <option value="11">November</option> <option value="12">December</option> </select>&nbsp; <select size="1" name="year"> <option value="0" selected="selected">Year</option> <?php formYear(); ?> </select> </td> </tr> <tr> <td class="formlabel"> <label for="recaptcha_response_field">Security Check:</label> </td> </tr> </tbody> </table> <?php require_once('captchalib.php'); ?> </div> <div id="formbottom"> <div id="error"> </div> <div id="formbottomright"> <input type="submit" id="formbutton" value="Sign Up" /> <img id="loading" src="css/images/ajax-loader.gif" height="35" width="35" alt="Processing.." style="float:right; display:block" /> </div> </div> </form> </div> </div> </div> <div id="middleright"> <div id="loginform"> <form name="login" action="login.php" method="post" id="login"> <label for="username">Email:</label> <input type="text" name="emaillogin" /> <label for="password">Password:</label> <input type="password" name="passwordlogin" maxlength="16" /> <input type="submit" value="Login" /> <img id="loading2" src="css/images/ajax-loader.gif" height="35" width="35" alt="Processing.." style="float:right; display:block" /> </form> </div> <div id="errorlogin"></div> </div> </div> </div> <div id="bottombar"> <div class="wrapper"></div> </div> </body> </html> validation.js $(document).ready(function(){ $('#myform').submit(function(e) { register(); e.preventDefault(); }); }); function register() { hideshow('loading',1); error(0); $.ajax({ type: "POST", url: "validate.php", data: $('#myform').serialize(), dataType: "json", success: function(msg){ if(parseInt(msg.status)==1) { window.location=msg.txt; } else if(parseInt(msg.status)==0) { error(1,msg.txt); Recaptcha.reload(); } hideshow('loading',0); } }); } function hideshow(el,act) { if(act) $('#'+el).css('visibility','visible'); else $('#'+el).css('visibility','hidden'); } function error(act,txt) { hideshow('error',act); if(txt) $('#error').html(txt); } login.js $(document).ready(function(){ $('#login').submit(function(e) { login(); e.preventDefault(); }); }); function login() { error(2); $.ajax({ type: "POST", url: "login.php", data: $('#login').serialize(), dataType: "json", success: function(msg){ if(parseInt(msg.status)==3) { window.location=msg.txt; } else if(parseInt(msg.status)==2) { error(3,msg.txt); } } }); } function error(act,txt) { hideshow('error',act); if(txt) $('#errorlogin').html(txt); } login.php <?php session_start(); require("connect.php"); $email = $_POST['emaillogin']; $password = $_POST['passwordlogin']; $email = mysql_real_escape_string($email); $password = mysql_real_escape_string($password); if(empty($email)) { die('{status:2,txt:"Enter your email address."}'); } if(!filter_var($email, FILTER_VALIDATE_EMAIL)) { die('{status:2,txt:"Invalid email or password"}'); } if(empty($password)) { die('{status:2,txt:"Enter your password."}'); } if(strlen($password)<6 || strlen($password)>16) { die('{status:2,txt:"Invalid email or password"}'); } $query = "SELECT password, salt FROM users WHERE Email = '$email';"; $result = mysql_query($query); if(mysql_num_rows($result) < 1) //no such user exists { die('{status:2,txt:"Invalid email or password"}'); } $userData = mysql_fetch_array($result, MYSQL_ASSOC); $hash = hash('sha256', $userData['salt'] . hash('sha256', $password) ); if($hash != $userData['password']) //incorrect password { die('{status:2,txt:"Invalid email or password"}'); } //////////////////////////////////////////////////////////////////////////////////// if('{status:3}') { session_regenerate_id (); //this is a security measure $getMemDetails = "SELECT * FROM users WHERE Email = '$email'"; $link = mysql_query($getMemDetails); $member = mysql_fetch_row($link); $_SESSION['valid'] = 1; $_SESSION['userid'] = $member[0]; $_SESSION['name'] = $member[1]; session_write_close(); mysql_close($con); echo '{status:3,txt:"success.php"}'; } validate.php <?php $name = $_POST['name']; $surname = $_POST['surname']; $email = $_POST['email']; $remail = $_POST['remail']; $gender = $_POST['gender']; $bdate = $_POST['year'].'-'.$_POST['month'].'-'.$_POST['day']; $bday = $_POST['day']; $bmon = $_POST['month']; $byear = $_POST['year']; $cdate = date("Y-n-j"); $password = $_POST['password']; $hash = hash('sha256', $password); $regdate = date("Y-m-d"); function createSalt() { $string = md5(uniqid(rand(), true)); return substr($string, 0, 3); } $salt = createSalt(); $hash = hash('sha256', $salt . $hash); if(empty($name) || empty($surname) || empty($email) || empty($remail) || empty($password) ) { die('{status:0,txt:"All the fields are required"}'); } if(!preg_match('/^[A-Za-z\s ]+$/', $name)) { die('{status:0,txt:"Please check your name"}'); } if(!preg_match('/^[A-Za-z\s ]+$/', $surname)) { die('{status:0,txt:"Please check your last name"}'); } if($bdate > $cdate) { die('{status:0,txt:"Please check your birthday"}'); } if(!(int)$gender) { die('{status:0,txt:"You have to select your sex"}'); } if(!(int)$bday || !(int)$bmon || !(int)$byear) { die('{status:0,txt:"You have to fill in your birthday"}'); } if(!$email == $remail) { die('{status:0,txt:"Emails doesn&sbquo;t match"}'); } if(!filter_var($email, FILTER_VALIDATE_EMAIL)) { die('{status:0,txt:"Enter a valid email"}'); } if(strlen($password)<6 || strlen($password)>16) { die('{status:0,txt:"Password must be between 6-16 characters"}'); } if (!$_POST["recaptcha_challenge_field"]===$_POST["recaptcha_response_field"]) { die('{status:0,txt:"You entered incorrect security code"}'); } if('{status:1}') { require("connect.php"); function getRealIpAddr() { if (!empty($_SERVER['HTTP_CLIENT_IP'])) { $ip=$_SERVER['HTTP_CLIENT_IP']; } elseif (!empty($_SERVER['HTTP_X_FORWARDED_FOR'])) { $ip=$_SERVER['HTTP_X_FORWARDED_FOR']; } else { $ip=$_SERVER['REMOTE_ADDR']; } return $ip; } $rip = getRealIpAddr(); $ipn = inet_pton($rip); $checkuser = mysql_query("SELECT Email FROM users WHERE Email = '$email'"); $username_exist = mysql_num_rows($checkuser); if ( $username_exist !== 0 ) { mysql_close($con); die('{status:0,txt:"This email Address is already registered!"}'); } else { $query = "INSERT INTO users (name, surname, date, Email, Gender, password, salt, RegistrationDate, IP) VALUES ('$name', '$surname', '$bdate', '$email', '$gender', '$hash', '$salt', '$cdate', '$ipn')"; $link = mysql_query($query); if(!$link) { die('Becerilemedi: ' . mysql_error()); } else { mysql_close($con); echo '{status:1,txt:"afterreg.php"}'; } } } ?> css of indexdeneme2.php * { padding:0; margin:0; } #topbar { width:100%; height:50px; } .wrapper { margin:0 auto; width:1000px; height:100%; } #middlebar { width:100%; height:650px; } #middleleft { width:55%; float:left; height:650px; } #middleright { width:45%; float:right; height:650px; } #mainformsecondcover { width:404px; padding:0px; margin:0px; border:4px solid #59B; border-radius: 14px; -moz-border-radius: 14px; -webkit-border-radius: 14px; } #mainform { width:400px; border:2px solid #CCC; border-radius: 11px; -moz-border-radius: 11px; -webkit-border-radius: 11px; } #formhead { margin:7px; } #signup { margin-top:13px; margin-left:13px; margin-bottom:3px; color:#333; font-size:18px; font-family:"Lucida Sans Unicode", "Lucida Grande", sans-serif; font-weight:bold } #form { margin:7px; } #form table { margin:0px; width:380px; } #form table tr{ height:28px; } #form table td{ height:18px; } .formlabel { cursor:pointer; display:table-cell; text-align:right; font-size:12px; color:#000; font-weight:normal; vertical-align:middle; font-family:"Lucida Sans Unicode", "Lucida Grande", sans-serif; letter-spacing:1px; width:120px; height:37px; padding-right:5px; } .formlabel label{ cursor:pointer } .forminput input { width:240px; font-size:13px; padding:4px; } #recaptcha_image { width:300px; height:57px; border:2px solid #CCC; } #recaptcha_widget { margin-left:35px; } #securityinfo { font-size: 11px; line-height: 16px; } #formbottom { width:360px; min-height:45px; } #error { float:left; width:200px; border:1px solid #F00; margin-left:20px; margin-top:7px; text-align:center; color:#F00; font-family:"Lucida Sans Unicode", "Lucida Grande", sans-serif; font-size:11px; line-height:16px; padding:2px; visibility:hidden; } #errorlogin { float:left; width:200px; border:1px solid #F00; margin-left:20px; margin-top:7px; text-align:center; color:#F00; font-family:"Lucida Sans Unicode", "Lucida Grande", sans-serif; font-size:11px; line-height:16px; padding:2px; visibility:hidden; } #formbottomright { float:right; height:45px; width:115px; margin-left:5px; } #loading { visibility:hidden; } #loading2 { visibility:hidden; } #formbutton { display:block; font-size:14px; color:#FFF; background: #0b85c6; /* Old browsers */ background: -moz-linear-gradient(top, #0b85c6 0%, #59b 100%); /* FF3.6+ */ background: -webkit-gradient(linear, left top, left bottom, color-stop(0%,#0b85c6), color-stop(100%,#59b)); /* Chrome,Safari4+ */ background: -webkit-linear-gradient(top, #0b85c6 0%,#59b 100%); /* Chrome10+,Safari5.1+ */ background: -o-linear-gradient(top, #0b85c6 0%,#59b 100%); /* Opera11.10+ */ background: -ms-linear-gradient(top, #0b85c6 0%,#59b 100%); /* IE10+ */ filter: progid:DXImageTransform.Microsoft.gradient( startColorstr='#0B85C6', endColorstr='#59B',GradientType=0 ); /* IE6-9 */ background: linear-gradient(top, #0b85c6 0%,#59b 100%); /* W3C */ font-family:"Lucida Sans Unicode", "Lucida Grande", sans-serif; height:26px; width:60px; margin:7px; text-align:center; padding-bottom:4px; padding-left:4px; padding-right:4px; float:left; margin-right:5px; } #bottombar { width:100%; height:50px; } {}

    Read the article

  • wrapping boost::ublas with swig

    - by leon
    I am trying to pass data around the numpy and boost::ublas layers. I have written an ultra thin wrapper because swig cannot parse ublas' header correctly. The code is shown below #include <boost/numeric/ublas/vector.hpp> #include <boost/numeric/ublas/matrix.hpp> #include <boost/lexical_cast.hpp> #include <algorithm> #include <sstream> #include <string> using std::copy; using namespace boost; typedef boost::numeric::ublas::matrix<double> dm; typedef boost::numeric::ublas::vector<double> dv; class dvector : public dv{ public: dvector(const int rhs):dv(rhs){;}; dvector(); dvector(const int size, double* ptr):dv(size){ copy(ptr, ptr+sizeof(double)*size, &(dv::data()[0])); } ~dvector(){} }; with the SWIG interface that looks something like %apply(int DIM1, double* INPLACE_ARRAY1) {(const int size, double* ptr)} class dvector{ public: dvector(const int rhs); dvector(); dvector(const int size, double* ptr); %newobject toString; char* toString(); ~dvector(); }; I have compiled them successfully via gcc 4.3 and vc++9.0. However when I simply run a = dvector(array([1.,2.,3.])) it gives me a segfault. This is the first time I use swigh with numpy and not have fully understanding between the data conversion and memory buffer passing. Does anyone see something obvious I have missed? I have tried to trace through with a debugger but it crashed within the assmeblys of python.exe. I have no clue if this is a swig problem or of my simple wrapper. Anything is appreciated.

    Read the article

  • iPhone scrollView won't scroll after keyboard is closed

    - by Rob
    I was trying to implement a way to have the UITextField move up when the keyboard opened so that the user could see what they were typing but after implementing the code - it locks my scroll. The view will scroll when the user first gets to that view but after inputting text and closing the keyboard it locks the view. I suspect that it is a problem somewhere in this code: - (void) viewWillAppear:(BOOL)animated { [super viewWillAppear:animated]; NSLog(@"Registering for keyboard events"); // Register for the events [[NSNotificationCenter defaultCenter] addObserver:self selector:@selector (keyboardDidShow:) name: UIKeyboardDidShowNotification object:nil]; [[NSNotificationCenter defaultCenter] addObserver:self selector:@selector (keyboardDidHide:) name: UIKeyboardDidHideNotification object:nil]; // Setup content size scrollView.contentSize = CGSizeMake(SCROLLVIEW_CONTENT_WIDTH, SCROLLVIEW_CONTENT_HEIGHT); //Initially the keyboard is hidden keyboardVisible = NO; } -(void) viewWillDisappear:(BOOL)animated { NSLog (@"Unregister for keyboard events"); [[NSNotificationCenter defaultCenter] removeObserver:self]; } //**-------------------------------** - (void) keyboardDidShow: (NSNotification *)notif { NSLog(@"Keyboard is visible"); // If keyboard is visible, return if (keyboardVisible) { NSLog(@"Keyboard is already visible. Ignore notification."); return; } // Get the size of the keyboard. NSDictionary* info = [notif userInfo]; NSValue* aValue = [info objectForKey:UIKeyboardBoundsUserInfoKey]; CGSize keyboardSize = [aValue CGRectValue].size; // Save the current location so we can restore // when keyboard is dismissed offset = scrollView.contentOffset; // Resize the scroll view to make room for the keyboard CGRect viewFrame = scrollView.frame; viewFrame.size.height -= keyboardSize.height; scrollView.frame = viewFrame; CGRect textFieldRect = [activeField frame]; textFieldRect.origin.y += 10; [scrollView scrollRectToVisible:textFieldRect animated:YES]; NSLog(@"ao fim"); // Keyboard is now visible keyboardVisible = YES; } -(void) keyboardDidHide: (NSNotification *)notif { // Is the keyboard already shown if (!keyboardVisible) { NSLog(@"Keyboard is already hidden. Ignore notification."); return; } // Reset the frame scroll view to its original value scrollView.frame = CGRectMake(0, 0, SCROLLVIEW_CONTENT_WIDTH, SCROLLVIEW_CONTENT_HEIGHT); // Reset the scrollview to previous location scrollView.contentOffset = offset; // Keyboard is no longer visible keyboardVisible = NO; } -(BOOL) textFieldShouldBeginEditing:(UITextField*)textField { activeField = textField; return YES; } I defined the size above the #imports as: #define SCROLLVIEW_CONTENT_HEIGHT 1000 #define SCROLLVIEW_CONTENT_WIDTH 320 Really not sure what the issue is.

    Read the article

  • JVM throws OutOfMemory during gc though there are plenty memory left...

    - by Shu L.
    I have my java application configured to use 5G memory. I got an OutOfMemory out of blue. I inspected the gc log and found plenty of memory left: young generation occupies 4% allocated space, tenure generation occupancy is 5% and perm generation is 43%. I am puzzled why JVM throws an OutOfMemory at the gc time. Does anyone know why this is happening? Your help is greatly appreciated. JVM memory and gc settings: -server -Xms5g -Xmx5g -Xss256k -XX:NewSize=2g -XX:MaxNewSize=2g -XX:+UseParallelOldGC -XX:+UseTLAB -XX:SurvivorRatio=8 -XX:TargetSurvivorRatio=90 -XX:+DisableExplicitGC gc.log 2009-09-19T03:34:59.741+0000: 92836.778: [GC Desired survivor size 152567808 bytes, new threshold 1 (max 15) [PSYoungGen: 1941492K-144057K(1947072K)] 3138022K-1340830K(5092800K), 0.1947640 secs] [Times: user=0.61 sys=0.01, real=0.19 secs] 2009-09-19T03:35:29.918+0000: 92866.954: [GC Desired survivor size 152109056 bytes, new threshold 1 (max 15) [PSYoungGen: 1941625K-144049K(1948608K)] 3138398K-1341080K(5094336K), 0.1942000 secs] [Times: user=0.61 sys=0.01, real=0.20 secs] 2009-09-19T03:35:56.883+0000: 92893.920: [GC Desired survivor size 156565504 bytes, new threshold 1 (max 15) [PSYoungGen: 1567994K-115427K(1915072K)] 2765026K-1312820K(5060800K), 0.1586320 secs] [Times: user=0.50 sys=0.01, real=0.16 secs] 2009-09-19T03:35:57.042+0000: 92894.079: [GC Desired survivor size 179961856 bytes, new threshold 1 (max 15) [PSYoungGen: 115427K-0K(1898560K)] 1312820K-1313987K(5044288K), 0.0775650 secs] [Times: user=0.42 sys=0.19, real=0.08 secs] 2009-09-19T03:35:57.120+0000: 92894.157: [Full GC [PSYoungGen: 0K-0K(1898560K)] [ParOldGen: 1313987K-159522K(3145728K)] 1313987K-159522K(5044288K) [PSPermGen: 20025K-19942K(40256K)], 0.56923 00 secs] [Times: user=2.18 sys=0.05, real=0.57 secs] 2009-09-19T03:35:57.690+0000: 92894.726: [GC Desired survivor size 197066752 bytes, new threshold 1 (max 15) [PSYoungGen: 0K-0K(1745728K)] 159522K-159522K(4891456K), 0.0072590 secs] [Times: user=0.01 sys=0.00, real=0.00 secs] 2009-09-19T03:35:57.698+0000: 92894.734: [Full GC [PSYoungGen: 0K-0K(1745728K)] [ParOldGen: 159522K-158627K(3145728K)] 159522K-158627K(4891456K) [PSPermGen: 19942K-19934K(45504K)], 0.3280480 secs] [Times: user=1.46 sys=0.00, real=0.33 secs] Heap PSYoungGen total 1745728K, used 87233K [0x00002aab73650000, 0x00002aabf3650000, 0x00002aabf3650000) eden space 1745664K, 4% used [0x00002aab73650000,0x00002aab78b80778,0x00002aabddf10000) from space 64K, 0% used [0x00002aabddf10000,0x00002aabddf10000,0x00002aabddf20000) to space 192448K, 0% used [0x00002aabe7a60000,0x00002aabe7a60000,0x00002aabf3650000) ParOldGen total 3145728K, used 158627K [0x00002aaab3650000, 0x00002aab73650000, 0x00002aab73650000) object space 3145728K, 5% used [0x00002aaab3650000,0x00002aaabd138d28,0x00002aab73650000) PSPermGen total 45504K, used 19965K [0x00002aaaae250000, 0x00002aaab0ec0000, 0x00002aaab3650000) object space 45504K, 43% used [0x00002aaaae250000,0x00002aaaaf5cf668,0x00002aaab0ec0000) I am on 64-bit Linux and JRE 1.6.0_10: $uname -a Linux x 2.6.24-etchnhalf.1-amd64 #1 SMP Tue Oct 14 03:11:45 UTC 2008 x86_64 GNU/Linux $java -version java version "1.6.0_10" Java(TM) SE Runtime Environment (build 1.6.0_10-b33) Java HotSpot(TM) 64-Bit Server VM (build 11.0-b15, mixed mode)

    Read the article

  • Is this way of storing typed objects in memory good?

    - by Pindatjuh
    This is an "is this okay, or can it be done better" question. Topic: Storing typed objects in memory. Background information: I'm building a compiler for the x86-32 platform for my language. My goal includes typed objects. Idea: Every primitive is a semi-class (it can be used as if it was a normal class, but it's stored more compact). Every class is represented by primitives and some meta-data (containing class-properties, inheritance stuff, etc.). The meta-data is complex: it doesn't use fields but instead context-switches. For primitives, the meta-data is very small, compared to a "real" class, which is alot bigger. This enables another idea that "primitives are objects", in my language, which I found nessecairy. Example: If I have an array of 32 booleans, then the pure content of this array is exactly 4 byte (32 bits of booleans). The meta-data will contain flags that the type is an array of booleans, which contains 32 entries. The meta-data is very compacted, on bit-level: using a sort of "packing" mechanism, which is read by a FSM at runtime, when doing inspection of the type (like when passing the object to methods for checking, etc.) For instance (read from left to right, top to bottom, remember vertical possition when going to the right, and check nearest column header for meaning of switch): Primitive? Array? Type-Meta 1 Byte? || Size (1 byte) 1 1 [...] 1 [...] done 0 2 Bytes? || Size (2 bytes) 1 [...] done || Size (4 bytes) 0 [...] done Integer? 1 Byte? 2 Bytes? 0 1 0 1 done 1 done 0 done Boolean? Byte? 0 1 0 done 1 done More-Primitives 0 .... Class-Stuff (Huge) 0 ... (After reaching done the data is inserted. || = byte alignement. [...] is variable sized. ... is not described here, for simplicity. And let's call them cost-based-data-structures.) For an array of 32 booleans containing all true values, the memory for this type would be (read top-down): 1 Primitive 1 Array 1 ArrayType: Primitive 0 Not-Array 0 Not-Integer 1 Boolean 0 Not-Byte (thus bit) 1 Integer Size: 1 Byte 00100000 Array size 11111111 11111111 11111111 11111111 Data Thus, 8 bytes represent 32 booleans in an array: 11100101 00100000 11111111 11111111 11111111 11111111 Is this okay, or can it be done better?

    Read the article

  • BST insert operation. don't insert a node if a duplicate exists already

    - by jeev
    the following code reads an input array, and constructs a BST from it. if the current arr[i] is a duplicate, of a node in the tree, then arr[i] is discarded. count in the struct node refers to the number of times a number appears in the array. fi refers to the first index of the element found in the array. after the insertion, i am doing a post-order traversal of the tree and printing the data, count and index (in this order). the output i am getting when i run this code is: 0 0 7 0 0 6 thank you for your help. Jeev struct node{ int data; struct node *left; struct node *right; int fi; int count; }; struct node* binSearchTree(int arr[], int size); int setdata(struct node**node, int data, int index); void insert(int data, struct node **root, int index); void sortOnCount(struct node* root); void main(){ int arr[] = {2,5,2,8,5,6,8,8}; int size = sizeof(arr)/sizeof(arr[0]); struct node* temp = binSearchTree(arr, size); sortOnCount(temp); } struct node* binSearchTree(int arr[], int size){ struct node* root = (struct node*)malloc(sizeof(struct node)); if(!setdata(&root, arr[0], 0)) fprintf(stderr, "root couldn't be initialized"); int i = 1; for(;i<size;i++){ insert(arr[i], &root, i); } return root; } int setdata(struct node** nod, int data, int index){ if(*nod!=NULL){ (*nod)->fi = index; (*nod)->left = NULL; (*nod)->right = NULL; return 1; } return 0; } void insert(int data, struct node **root, int index){ struct node* new = (struct node*)malloc(sizeof(struct node)); setdata(&new, data, index); struct node** temp = root; while(1){ if(data<=(*temp)->data){ if((*temp)->left!=NULL) *temp=(*temp)->left; else{ (*temp)->left = new; break; } } else if(data>(*temp)->data){ if((*temp)->right!=NULL) *temp=(*temp)->right; else{ (*temp)->right = new; break; } } else{ (*temp)->count++; free(new); break; } } } void sortOnCount(struct node* root){ if(root!=NULL){ sortOnCount(root->left); sortOnCount(root->right); printf("%d %d %d\n", (root)->data, (root)->count, (root)->fi); } }

    Read the article

  • Winforms: calling entry form function from a different class

    - by samy
    I'm kinda new to programming and got a question on what is a good practice. I created a class that represents a ball and it has a function Jump() that use 2 timers and get the ball up and down. I know that in Winforms you got to call Invalidate() every time you want to repaint the screen, or part of it. I didn't find a good way to do that, so I reference the form in my class, and called Invalidate() inside my ball class every time I need to repaint to ball movement. (this works but I got a feeling that this is not a good practice) Here is the class I created: public class Ball { public Form1 parent;//----> here is the reference to the form public Rectangle ball; Size size; public Point p; Timer timerBallGoUp = new Timer(); Timer timerBallGDown = new Timer(); public int ballY; public Ball(Size _size, Point _p) { size = _size; p = _p; ball = new Rectangle(p, size); } public void Jump() { ballY = p.Y; timerBallGDown.Elapsed += ballGoDown; timerBallGDown.Interval = 50; timerBallGoUp.Elapsed += ballGoUp; timerBallGoUp.Interval = 50; timerBallGoUp.Start(); } private void ballGoUp(object obj,ElapsedEventArgs e) { p.Y++; ball.Location = new Point(ball.Location.X, p.Y); if (p.Y >= ballY + 50) { timerBallGoUp.Stop(); timerBallGDown.Start(); } parent.Invalidate(); // here i call parent.Invalidate() 1 } private void ballGoDown(object obj, ElapsedEventArgs e) { p.Y--; ball.Location = new Point(ball.Location.X, p.Y); if (p.Y <= ballY) { timerBallGDown.Stop(); timerBallGoUp.Start(); } parent.Invalidate(); // here i call parent.Invalidate() 2 } } I'm wondring if there is a better way to do that? (sorry for my english)

    Read the article

  • Printing gives unhandled exception. Access Denied

    - by Smoka
    Im newish to coding, currently on a Windows Forms App using CLI in VS10 Everything seems to work, my document shows fine in the Preview dialog but then crash's. Heres only the code that seems relevant private: System::Drawing::Printing::PrintDocument^ docPrint; private: System::Windows::Forms::PrintDialog^ dlgPrint; private: System::Windows::Forms::PrintPreviewDialog^ dlgPrintPreview; this->button2 = (gcnew System::Windows::Forms::Button()); this->docPrint = (gcnew System::Drawing::Printing::PrintDocument()); this->dlgPrint = (gcnew System::Windows::Forms::PrintDialog()); this->dlgPrintPreview = (gcnew System::Windows::Forms::PrintPreviewDialog()); this->button2->Location = System::Drawing::Point(152, 355); this->button2->Name = L"button2"; this->button2->Size = System::Drawing::Size(75, 23); this->button2->TabIndex = 53; this->button2->Text = L"Print"; this->button2->UseVisualStyleBackColor = true; this->button2->Click += gcnew System::EventHandler(this, &Form1::button2_Click_1); // // docPrint // this->docPrint->DocumentName = L"ResultsPage"; this->docPrint->PrintPage += gcnew System::Drawing::Printing::PrintPageEventHandler(this, &Form1::docPrint_PrintPage); // // dlgPrint // this->dlgPrint->Document = this->docPrint; this->dlgPrint->UseEXDialog = true; // // dlgPrintPreview // this->dlgPrintPreview->AutoScrollMargin = System::Drawing::Size(0, 0); this->dlgPrintPreview->AutoScrollMinSize = System::Drawing::Size(0, 0); this->dlgPrintPreview->ClientSize = System::Drawing::Size(400, 300); this->dlgPrintPreview->Document = this->docPrint; this->dlgPrintPreview->Enabled = true; this->dlgPrintPreview->Icon = (cli::safe_cast<System::Drawing::Icon^ >(resources->GetObject(L"dlgPrintPreview.Icon"))); this->dlgPrintPreview->Name = L"dlgPrintPreview"; this->dlgPrintPreview->Visible = false; this->dlgPrintPreview->Load += gcnew System::EventHandler(this, &Form1::dlgPrintPreview_Load); private: System::Void docPrint_PrintPage(System::Object^ sender, System::Drawing::Printing::PrintPageEventArgs^ e) { String ^ strDisplay = L"A Axis Rotations"; String ^ strDisplay2 = L"Centerline of Y" + CL_Y->Text + " + Z" + CL_Z->Text; String ^ strDisplay3 = L"Initial Position Y" + G54_Y->Text + " + Z" + G54_Z->Text; System::Drawing::Font ^ fntString = gcnew System::Drawing::Font(L"Times New Roman", 38, FontStyle::Bold); e->Graphics->DrawString(strDisplay, fntString, Brushes::Black, 200,20); e->Graphics->DrawString(strDisplay2, fntString, Brushes::Black, 80,150); e->Graphics->DrawString(strDisplay3, fntString, Brushes::Black, 80,220); e->Graphics->DrawString(Results->Text, fntString,Brushes::Black, 50,400); } private: System::Void button2_Click_1(System::Object^ sender, System::EventArgs^ e) { // docPrint->Print; dlgPrintPreview->ShowDialog(); } private: System::Void dlgPrintPreview_Load(System::Object^ sender, System::EventArgs^ e) { } Sorry if the formatting is ugly here.

    Read the article

  • OpenGL Vertex Buffer Object code giving bad output.

    - by Matthew Mitchell
    Hello. My Vertex Buffer Object code is supposed to render textures nicely but instead the textures are being rendered oddly with some triangle shapes. What happens - http://godofgod.co.uk/my_files/wrong.png What is supposed to happen - http://godofgod.co.uk/my_files/right.png This function creates the VBO and sets the vertex and texture coordinate data: extern "C" GLuint create_box_vbo(GLdouble size[2]){ GLuint vbo; glGenBuffers(1,&vbo); glBindBuffer(GL_ARRAY_BUFFER, vbo); GLsizeiptr data_size = 8*sizeof(GLdouble); GLdouble vertices[] = {0,0, 0,size[1], size[0],0, size[0],size[1]}; glBufferData(GL_ARRAY_BUFFER, data_size, vertices, GL_STATIC_DRAW); data_size = 8*sizeof(GLint); GLint textcoords[] = {0,0, 0,1, 1,0, 1,1}; glBufferData(GL_ARRAY_BUFFER, data_size, textcoords, GL_STATIC_DRAW); return vbo; } Here is some relavant code from another function which is supposed to draw the textures with the VBO. glTexParameteri(GL_TEXTURE_2D,GL_TEXTURE_WRAP_S,GL_CLAMP_TO_EDGE); glTexParameteri(GL_TEXTURE_2D,GL_TEXTURE_WRAP_T,GL_CLAMP_TO_EDGE); glMatrixMode(GL_MODELVIEW); glLoadIdentity(); glColor4d(1,1,1,a/255); glBindTexture(GL_TEXTURE_2D, texture); glTranslated(offset[0],offset[1],0); glBindBuffer(GL_ARRAY_BUFFER, vbo); glVertexPointer(2, GL_DOUBLE, 0, 0); glEnableClientState(GL_VERTEX_ARRAY); glTexCoordPointer (2, GL_INT, 0, 0); glEnableClientState(GL_TEXTURE_COORD_ARRAY); glDrawArrays(GL_TRIANGLES, 0, 3); glDrawArrays(GL_TRIANGLES, 1, 3); glDisableClientState(GL_TEXTURE_COORD_ARRAY); glDisableClientState(GL_VERTEX_ARRAY); glBindBuffer(GL_ARRAY_BUFFER, 0); I would have hoped for the code to use the first three coordinates (top-left,bottom-left,top-right) and the last three (bottom-left,top-right,bottom-right) to draw the triangles with the texture data correctly in the most efficient way. I don't see why triangles should make it more efficient but apparently that's the way to go. It, of-course, fails for some reason. I am asking what is broken but also am I going about it in the right way generally? Thank you.

    Read the article

  • php array code with regular expressions

    - by user551068
    there are few mistakes which it is showing as Warning: preg_match() [function.preg-match]: Delimiter must not be alphanumeric or backslash in array 4,9,10,11,12... can anyone resolve them <?PHP $hosts = array( array("ronmexico.kainalopallo.com/","beforename=$F_firstname%20$F_lastname&gender=$F_gender","Your Ron Mexico Name is ","/the ultimate disguise, is <u><b>([^<]+)<\/b><\/u>/s"), array("www.fjordstone.com/cgi-bin/png.pl","gender=$F_gender&submit=Name%20Me","Your Pagan name is ","/COLOR=#000000 SIZE=6> *([^<]*)<\/FONT>/"), array("rumandmonkey.com/widgets/toys/mormon/index.php","gender=$F_gender&firstname=$F_firstname&surname=$F_lastname","Your Mormon Name is ","/<p>My Mormon name is <b>([^<]+)<\/b>!<br \/>/s"), array("cyborg.namedecoder.com/index.php","acronym=$F_firstname&design=edox&design_click-edox.x=0&design_click-edox.y=0&design_click-edox=edo","","Your Cyborg Name is ","/<p>([^<]+)<\/p>/"), array("rumandmonkey.com/widgets/toys/namegen/10/","nametype=$brit&page=2&id=10&submit=God%20save%20the%20Queen!&name=$F_firstname%20$F_lastname","Your Very British Name is ","/My very British name is \&lt\;b\&gt;([^&]+)\&lt;\/b\&gt;\.\&lt;br/"), array("blazonry.com/name_generator/usname.php","realname=$F_firstname+$F_lastname&gender=$F_gender","Your U.S. Name is ","/also be known as <font size=\'\+1\'><b>([^<]+)<\/b>/s"), array("www.spacepirate.org/rogues.php","realname=$F_firstname%20$F_lastname&formentered=Yes&submit=Arrrgh","Your Space Pirate name is ","/Your pirate name is <font size=\'\+1\'><b>([^<]+)<\/b><\/font>/s"), array("rumandmonkey.com/widgets/toys/ghetto/","firstname=$F_firstname&lastname=$F_lastname","Your Ghetto Name is ","/<p align=\"center\" style=\"font-size: 36px\">\s*<br \/>\s*([^<]*)<br \/>/"), array("www.emmadavies.net/vampire/default.aspx","mf=$emgender&firstname=$F_firstname&lastname=$F_lastname&submit=Find+My+Vampire+Name","","Your Vampire Name is ","/<i class=\"vampirecontrol vampire name\">([^<]*)<\/i>/"), array("www.emmadavies.net/fairy/default.aspx","mf=$emgender&firstname=$F_firstname&lastname=$F_lastname&submit=Seek+Fairy","","Your Fairy Name is ","/<i class=\'ng fairy name\'>([^<]*)<\/i>/"), array("www.irielion.com/israel/reggaename.html","phase=3&oldname=$F_firstname%20$F_lastname&gndr=$reggender","","Your Rasta Name is ","/Yes I, your irie new name is ([^\n]*)\n/"), array("www.ninjaburger.com/fun/games/ninjaname/ninjaname.php","realname=$F_firstname+$F_lastname","Your Ninja Burger Name is ","/<BR>Ninja Burger ninja name will be<BR><BR><FONT SIZE=\'\+1\'>([^<]*)<\/FONT>/"), array("gangstaname.com/pirate_name.php","sex=$F_gender&name=$F_firstname+$F_lastname","Your Pirate Name is ","/<p><strong>We\'ll now call ye:<\/strong><\/p> *<h2 class=\"newName\">([^<]*)<\/h2>/"), array("www.xach.com/nerd-name/","name=$F_firstname+$F_lastname&gender=$F_gender","Your Nerd Name is ","/<p><div align=center class=\"nerdname\">([^<]*)<\/div>/"), array("rumandmonkey.com/widgets/toys/namegen/5941/","page=2&id=5941&nametype=$dj&name=$F_firstname+$F_lastname","Your DJ Name is ","/My disk spinnin nu name is &lt\;b&gt\;([^<]*)&lt\;\/b&gt\;\./"), array("pizza.sandwich.net/poke/pokecgi.cgi","name=$F_firstname%20$F_lastname&color=black&submit=%20send%20","Your Pokename is ","/Your Pok&eacute;name is: <h1>([^<]*)<\/h1>/") ); return $hosts; ?>

    Read the article

  • using php and java script in a form

    - by Gal Miller
    I am a little bit lost. What I want to achieve is: my own custom button change onMouseOver etc' keep it's size post the information to a php server side code What I'm missing is: The post - I couldn't figure out how to combine js & php The Button size - my code sets a size for the original button but after the rollover it changes The code: <html> <head> </head> <body> <script> function form_on_click(frm) { document.buttonMore.src='bottom_more_click.JPG'; frm.submit(); } </script> <div style="position: absolute; left: 120px; top: 90px; background-image: url(myBackgroundPicture.jpg); background-repeat:no-repeat; width: 800px; height: 280px; padding: 15px;"> <form method="post" action="<?php echo $_SERVER['PHP_SELF']; ?>"> <input type="text" name="whatever" size= "55" height="100" lang="en" dir="ltr" style="margin-top: 188px; margin-left: 95px; height: 20px; background-color: transparent; border:none; color: #FFFFFF; font-family: Verdana; font-weight: none; font-size: 18px;"> <a onmouseover="document.buttonMore.src='bottom_more_hover.JPG'" onmouseout="document.buttonMore.src='bottom_more_reg.JPG'" onmousedown= "form_on_click(this.form) this.form.submit()" onmouseup="document.buttonMore.src='bottom_more_hover.JPG'"> <img src="bottom_more_reg.jpg" name="buttonMore" height="30" width="173" border="0" alt="MORE!" style="margin-bottom:-10px; margin-left: 15px; height: 30px; width: 100px;"> </a> </form> </div> </body>

    Read the article

  • Using fft2 with reshaping for an RGB filter

    - by Mahmoud Aladdin
    I want to apply a filter on an image, for example, blurring filter [[1/9.0, 1/9.0, 1/9.0], [1/9.0, 1/9.0, 1/9.0], [1/9.0, 1/9.0, 1/9.0]]. Also, I'd like to use the approach that convolution in Spatial domain is equivalent to multiplication in Frequency domain. So, my algorithm will be like. Load Image. Create Filter. convert both Filter & Image to Frequency domains. multiply both. reconvert the output to Spatial Domain and that should be the required output. The following is the basic code I use, the image is loaded and displayed as cv.cvmat object. Image is a class of my creation, it has a member image which is an object of scipy.matrix and toFrequencyDomain(size = None) uses spf.fftshift(spf.fft2(self.image, size)) where spf is scipy.fftpack and dotMultiply(img) uses scipy.multiply(self.image, image) f = Image.fromMatrix([[1/9.0, 1/9.0, 1/9.0], [1/9.0, 1/9.0, 1/9.0], [1/9.0, 1/9.0, 1/9.0]]) lena = Image.fromFile("Test/images/lena.jpg") print lena.image.shape lenaf = lena.toFrequencyDomain(lena.image.shape) ff = f.toFrequencyDomain(lena.image.shape) lenafm = lenaf.dotMultiplyImage(ff) lenaff = lenafm.toTimeDomain() lena.display() lenaff.display() So, the previous code works pretty well, if I told OpenCV to load the image via GRAY_SCALE. However, if I let the image to be loaded in color ... lena.image.shape will be (512, 512, 3) .. so, it gives me an error when using scipy.fttpack.ftt2 saying "When given, Shape and Axes should be of same length". What I tried next was converted my filter to 3-D .. as [[[1/9.0, 1/9.0, 1/9.0], [1/9.0, 1/9.0, 1/9.0], [1/9.0, 1/9.0, 1/9.0]], [[1/9.0, 1/9.0, 1/9.0], [1/9.0, 1/9.0, 1/9.0], [1/9.0, 1/9.0, 1/9.0]], [[1/9.0, 1/9.0, 1/9.0], [1/9.0, 1/9.0, 1/9.0], [1/9.0, 1/9.0, 1/9.0]]] And, not knowing what the axes argument do, I added it with random numbers as (-2, -1, -1), (-1, -1, -2), .. etc. until it gave me the correct filter output shape for the dotMultiply to work. But, of course it wasn't the correct value. Things were totally worse. My final trial, was using fft2 function on each of the components 2-D matrices, and then re-making the 3-D one, using the following code. # Spiltting the 3-D matrix to three 2-D matrices. for i, row in enumerate(self.image): r.append(list()) g.append(list()) b.append(list()) for pixel in row: r[i].append(pixel[0]) g[i].append(pixel[1]) b[i].append(pixel[2]) rfft = spf.fftshift(spf.fft2(r, size)) gfft = spf.fftshift(spf.fft2(g, size)) bfft = spf.fftshift(spf.fft2(b, size)) newImage.image = sp.asarray([[[rfft[i][j], gfft[i][j], bfft[i][j]] for j in xrange(len(rfft[i]))] for i in xrange(len(rfft))] ) return newImage Any help on what I made wrong, or how can I achieve that for both GreyScale and Coloured pictures.

    Read the article

  • Go - Using a container/heap to implement a priority queue

    - by Seth Hoenig
    In the big picture, I'm trying to implement Dijkstra's algorithm using a priority queue. According to members of golang-nuts, the idiomatic way to do this in Go is to use the heap interface with a custom underlying data structure. So I have created Node.go and PQueue.go like so: //Node.go package pqueue type Node struct { row int col int myVal int sumVal int } func (n *Node) Init(r, c, mv, sv int) { n.row = r n.col = c n.myVal = mv n.sumVal = sv } func (n *Node) Equals(o *Node) bool { return n.row == o.row && n.col == o.col } And PQueue.go: // PQueue.go package pqueue import "container/vector" import "container/heap" type PQueue struct { data vector.Vector size int } func (pq *PQueue) Init() { heap.Init(pq) } func (pq *PQueue) IsEmpty() bool { return pq.size == 0 } func (pq *PQueue) Push(i interface{}) { heap.Push(pq, i) pq.size++ } func (pq *PQueue) Pop() interface{} { pq.size-- return heap.Pop(pq) } func (pq *PQueue) Len() int { return pq.size } func (pq *PQueue) Less(i, j int) bool { I := pq.data.At(i).(Node) J := pq.data.At(j).(Node) return (I.sumVal + I.myVal) < (J.sumVal + J.myVal) } func (pq *PQueue) Swap(i, j int) { temp := pq.data.At(i).(Node) pq.data.Set(i, pq.data.At(j).(Node)) pq.data.Set(j, temp) } And main.go: (the action is in SolveMatrix) // Euler 81 package main import "fmt" import "io/ioutil" import "strings" import "strconv" import "./pqueue" const MATSIZE = 5 const MATNAME = "matrix_small.txt" func main() { var matrix [MATSIZE][MATSIZE]int contents, err := ioutil.ReadFile(MATNAME) if err != nil { panic("FILE IO ERROR!") } inFileStr := string(contents) byrows := strings.Split(inFileStr, "\n", -1) for row := 0; row < MATSIZE; row++ { byrows[row] = (byrows[row])[0 : len(byrows[row])-1] bycols := strings.Split(byrows[row], ",", -1) for col := 0; col < MATSIZE; col++ { matrix[row][col], _ = strconv.Atoi(bycols[col]) } } PrintMatrix(matrix) sum, len := SolveMatrix(matrix) fmt.Printf("len: %d, sum: %d\n", len, sum) } func PrintMatrix(mat [MATSIZE][MATSIZE]int) { for r := 0; r < MATSIZE; r++ { for c := 0; c < MATSIZE; c++ { fmt.Printf("%d ", mat[r][c]) } fmt.Print("\n") } } func SolveMatrix(mat [MATSIZE][MATSIZE]int) (int, int) { var PQ pqueue.PQueue var firstNode pqueue.Node var endNode pqueue.Node msm1 := MATSIZE - 1 firstNode.Init(0, 0, mat[0][0], 0) endNode.Init(msm1, msm1, mat[msm1][msm1], 0) if PQ.IsEmpty() { // make compiler stfu about unused variable fmt.Print("empty") } PQ.Push(firstNode) // problem return 0, 0 } The problem is, upon compiling i get the error message: [~/Code/Euler/81] $ make 6g -o pqueue.6 Node.go PQueue.go 6g main.go main.go:58: implicit assignment of unexported field 'row' of pqueue.Node in function argument make: *** [all] Error 1 And commenting out the line PQ.Push(firstNode) does satisfy the compiler. But I don't understand why I'm getting the error message in the first place. Push doesn't modify the argument in any way.

    Read the article

  • Can this way of storing typed objects be improved?

    - by Pindatjuh
    This is an "can it be improved"-question. Topic: Storing typed objects in memory. Background information: I'm building a compiler for the x86-32 Windows platform for my language. My goal includes typed objects. Idea: Every primitive is a semi-class (it can be used as if it was a normal class, but it's stored more compact). Every class is represented by primitives and some meta-data (containing class-properties, inheritance stuff, etc.). The meta-data is complex: it doesn't use fields but instead context-switches. For primitives, the meta-data is very small, compared to a "real" class, which is alot bigger. This enables another idea that "primitives are objects", in my language, which I found nessecairy. Example: If I have an array of 32 booleans, then the pure content of this array is exactly 4 byte (32 bits of booleans). The meta-data will contain flags that the type is an array of booleans, which contains 32 entries. The meta-data is very compacted, on bit-level: using a sort of "packing" mechanism, which is read by a FSM at runtime, when doing inspection of the type (like when passing the object to methods for checking, etc.) For instance (read from left to right, top to bottom, remember vertical position when going to the right, and check nearest column header for meaning of switch): Primitive? Array? Type-Meta 1 Byte? || Size (1 byte) 1 1 [...] 1 [...] done 0 2 Bytes? || Size (2 bytes) 1 [...] done || Size (4 bytes) 0 [...] done Integer? 1 Byte? 2 Bytes? 0 1 0 1 done 1 done 0 done Boolean? Byte? 0 1 0 done 1 done More-Primitives 0 .... Class-Stuff (Huge) 0 ... (After reaching done the data is inserted. || = byte alignment. [...] is variable sized. ... is not described here, for simplicity. And let's call them cost-based-data-structures.) For an array of 32 booleans containing all true values, the memory for this type would be (read top-down): 1 Primitive 1 Array 1 ArrayType: Primitive 0 Not-Array 0 Not-Integer 1 Boolean 0 Not-Byte (thus bit) 1 Integer Size: 1 Byte 00100000 Array size 01010101 01010101 01010101 01010101 Data (user defined) Thus, 8 bytes represent 32 booleans in an array: 11100101 00100000 01010101 01010101 01010101 01010101 How can I improve this? (Both performance- and memory-consumption wise)

    Read the article

  • Basic shared memory program in C

    - by nicopuri
    Hi, I want to make a basic chat application in C using Shared memory. I am working in Linux. The application consist in writing the client and the server can read, and if the server write the client can read the message. I tried to do this, but I can't achieve the communication between client and server. The code is the following: Server.c int main(int argc, char **argv) { char *msg; static char buf[SIZE]; int n; msg = getmem(); memset(msg, 0, SIZE); initmutex(); while ( true ) { if( (n = read(0, buf, sizeof buf)) 0 ) { enter(); sprintf(msg, "%.*s", n, buf); printf("Servidor escribe: %s", msg); leave(); }else{ enter(); if ( strcmp(buf, msg) ) { printf("Servidor lee: %s", msg); strcpy(buf, msg); } leave(); sleep(1); } } return 0; } Client.c int main(int argc, char **argv) { char *msg; static char buf[SIZE-1]; int n; msg = getmem(); initmutex(); while(true) { if ( (n = read(0, buf, sizeof buf)) 0 ) { enter(); sprintf(msg, "%.*s", n, buf); printf("Cliente escribe: %s", msg); leave(); }else{ enter(); if ( strcmp(buf, msg) ) { printf("Cliente lee: %s", msg); strcpy(buf, msg); } leave(); sleep(1); } } printf("Cliente termina\n"); return 0; } The shared memory module is the folowing: #include "common.h" void fatal(char *s) { perror(s); exit(1); } char * getmem(void) { int fd; char *mem; if ( (fd = shm_open("/message", O_RDWR|O_CREAT, 0666)) == -1 ) fatal("sh_open"); ftruncate(fd, SIZE); if ( !(mem = mmap(NULL, SIZE, PROT_READ|PROT_WRITE, MAP_SHARED, fd, 0)) ) fatal("mmap"); close(fd); return mem; } static sem_t *sd; void initmutex(void) { if ( !(sd = sem_open("/mutex", O_RDWR|O_CREAT, 0666, 1)) ) fatal("sem_open"); } void enter(void) { sem_wait(sd); } void leave(void) { sem_post(sd); }

    Read the article

  • Reason why UIImageView gives me a 'distorted' image sometimes

    - by Cedric Vandendriessche
    I have a custom UIView with a UILabel and a UIImageView subview. (tried using UIImageView subclass aswell). I assign an image to it and add the view to the screen. I wrote a function which adds the amount of LetterBoxes to the screen as there are letters in the word: - (void)drawBoxesForWord:(NSString *)word { if(boxesContainer == nil) { /* Create a container for the LetterBoxes (animation purposes) */ boxesContainer = [[UIView alloc] initWithFrame:CGRectMake(0, 205, 320, 50)]; [self.view addSubview:boxesContainer]; } /* Calculate width of letterboxes */ NSInteger numberOfCharacters = [word length]; CGFloat totalWidth = numberOfCharacters * 28 + (numberOfCharacters - 1) * 3; CGFloat leftCap = (320 - totalWidth) / 2; [letters removeAllObjects]; /* Draw the boxes to the screen */ for (int i = 0; i < numberOfCharacters; i++) { LetterBox *letter = [[LetterBox alloc] initWithFrame:CGRectMake(leftCap + i * 31 , 0, 28, 40)]; [letters addObject:letter]; [boxesContainer addSubview:letter]; [letter release]; }} This gives me the image below: http://www.imgdumper.nl/uploads2/4ba3b2c72bb99/4ba3b2c72abfd-Goed.png But sometimes it gives me this: imgdumper.nl/uploads2/4ba3b2d888226/4ba3b2d88728a-Fout.png I add them to the same boxesContainer but they first remove themselves from the superview, so it's not like you see them double or something. What I find weird is that they are all good or all bad.. This is the init function for my LetterBox: if (self == [super initWithFrame:aRect]) { /* Create the box image with same frame */ boxImage = [[UIImageView alloc] initWithFrame:CGRectMake(0, 0, self.bounds.size.width, self.bounds.size.height)]; boxImage.contentMode = UIViewContentModeScaleAspectFit; boxImage.image = [UIImage imageNamed:@"SpaceOpen.png"]; [self addSubview:boxImage]; /* Create the label with same frame */ letterLabel = [[UILabel alloc] initWithFrame:CGRectMake(0, 0, self.bounds.size.width, self.bounds.size.height)]; letterLabel.backgroundColor = [UIColor clearColor]; letterLabel.font = [UIFont fontWithName:@"ArialRoundedMTBold" size:26]; letterLabel.textColor = [UIColor blackColor]; letterLabel.textAlignment = UITextAlignmentCenter; [self addSubview:letterLabel]; } return self;} Does anyone have an idea why this could be? I'd rather have them display correctly every time :)

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Combining FileStream and MemoryStream to avoid disk accesses/paging while receiving gigabytes of data?

    - by w128
    I'm receiving a file as a stream of byte[] data packets (total size isn't known in advance) that I need to store somewhere before processing it immediately after it's been received (I can't do the processing on the fly). Total received file size can vary from as small as 10 KB to over 4 GB. One option for storing the received data is to use a MemoryStream, i.e. a sequence of MemoryStream.Write(bufferReceived, 0, count) calls to store the received packets. This is very simple, but obviously will result in out of memory exception for large files. An alternative option is to use a FileStream, i.e. FileStream.Write(bufferReceived, 0, count). This way, no out of memory exceptions will occur, but what I'm unsure about is bad performance due to disk writes (which I don't want to occur as long as plenty of memory is still available) - I'd like to avoid disk access as much as possible, but I don't know of a way to control this. I did some testing and most of the time, there seems to be little performance difference between say 10 000 consecutive calls of MemoryStream.Write() vs FileStream.Write(), but a lot seems to depend on buffer size and the total amount of data in question (i.e the number of writes). Obviously, MemoryStream size reallocation is also a factor. Does it make sense to use a combination of MemoryStream and FileStream, i.e. write to memory stream by default, but once the total amount of data received is over e.g. 500 MB, write it to FileStream; then, read in chunks from both streams for processing the received data (first process 500 MB from the MemoryStream, dispose it, then read from FileStream)? Another solution is to use a custom memory stream implementation that doesn't require continuous address space for internal array allocation (i.e. a linked list of memory streams); this way, at least on 64-bit environments, out of memory exceptions should no longer be an issue. Con: extra work, more room for mistakes. So how do FileStream vs MemoryStream read/writes behave in terms of disk access and memory caching, i.e. data size/performance balance. I would expect that as long as enough RAM is available, FileStream would internally read/write from memory (cache) anyway, and virtual memory would take care of the rest. But I don't know how often FileStream will explicitly access a disk when being written to. Any help would be appreciated.

    Read the article

  • Issue accessing class variable from thread.

    - by James
    Hello, The code below is meant to take an arraylist of product objects as an input, spun thread for each product(and add the product to the arraylist 'products'), check product image(product.imageURL) availability, remove the products without images(remove the product from the arraylist 'products'), and return an arraylist of products with image available. package com.catgen.thread; import java.util.ArrayList; import java.util.Iterator; import java.util.List; import com.catgen.Product; import com.catgen.Utils; public class ProductFilterThread extends Thread{ private Product product; private List<Product> products = new ArrayList<Product>(); public ProductFilterThread(){ } public ProductFilterThread(Product product){ this.product = product; } public synchronized void addProduct(Product product){ System.out.println("Before add: "+getProducts().size()); getProducts().add(product); System.out.println("After add: "+getProducts().size()); } public synchronized void removeProduct(Product product){ System.out.println("Before rem: "+getProducts().size()); getProducts().remove(product); System.out.println("After rem: "+getProducts().size()); } public synchronized List<Product> getProducts(){ return this.products; } public synchronized void setProducts(List<Product> products){ this.products = products; } public void run(){ boolean imageExists = Utils.fileExists(this.product.ImageURL); if(!imageExists){ System.out.println(this.product.ImageURL); removeProduct(this.product); } } public List<Product> getProductsWithImageOnly(List<Product> products){ ProductFilterThread pft = null; try{ List<ProductFilterThread> threads = new ArrayList<ProductFilterThread>(); for(Product product: products){ pft = new ProductFilterThread(product); addProduct(product); pft.start(); threads.add(pft); } Iterator<ProductFilterThread> threadsIter = threads.iterator(); while(threadsIter.hasNext()){ ProductFilterThread thread = threadsIter.next(); thread.join(); } }catch(Exception e){ e.printStackTrace(); } System.out.println("Total returned products = "+getProducts().size()); return getProducts(); } } Calling statement: displayProducts = new ProductFilterThread().getProductsWithImageOnly(displayProducts); Here, when addProduct(product) is called from within getProductsWithImageOnly(), getProducts() returns the list of products, but that's not the case(no products are returned) when the method removeProduct() is called by a thread, because of which the products without images are never removed. As a result, all the products are returned by the module whether or not the contained products have images. What can be the problem here? Thanks in advance. James.

    Read the article

  • synchronized in java - Proper use

    - by ZoharYosef
    I'm building a simple program to use in multi processes (Threads). My question is more to understand - when I have to use a reserved word synchronized? Do I need to use this word in any method that affects the bone variables? I know I can put it on any method that is not static, but I want to understand more. thank you! here is the code: public class Container { // *** data members *** public static final int INIT_SIZE=10; // the first (init) size of the set. public static final int RESCALE=10; // the re-scale factor of this set. private int _sp=0; public Object[] _data; /************ Constructors ************/ public Container(){ _sp=0; _data = new Object[INIT_SIZE]; } public Container(Container other) { // copy constructor this(); for(int i=0;i<other.size();i++) this.add(other.at(i)); } /** return true is this collection is empty, else return false. */ public synchronized boolean isEmpty() {return _sp==0;} /** add an Object to this set */ public synchronized void add (Object p){ if (_sp==_data.length) rescale(RESCALE); _data[_sp] = p; // shellow copy semantic. _sp++; } /** returns the actual amount of Objects contained in this collection */ public synchronized int size() {return _sp;} /** returns true if this container contains an element which is equals to ob */ public synchronized boolean isMember(Object ob) { return get(ob)!=-1; } /** return the index of the first object which equals ob, if none returns -1 */ public synchronized int get(Object ob) { int ans=-1; for(int i=0;i<size();i=i+1) if(at(i).equals(ob)) return i; return ans; } /** returns the element located at the ind place in this container (null if out of range) */ public synchronized Object at(int p){ if (p>=0 && p<size()) return _data[p]; else return null; }

    Read the article

  • Reason why UIImage gives me a 'distorted' image sometimes

    - by Cedric Vandendriessche
    I have a custom UIView with a UILabel and a UIImageView subview. (tried using UIImageView subclass aswell). I assign an image to it and add the view to the screen. I wrote a function which adds the amount of LetterBoxes to the screen (my custom class): - (void)drawBoxesForWord:(NSString *)word { if(boxesContainer == nil) { /* Create a container for the LetterBoxes (animation purposes) */ boxesContainer = [[UIView alloc] initWithFrame:CGRectMake(0, 205, 320, 50)]; [self.view addSubview:boxesContainer]; } /* Calculate width of letterboxes */ NSInteger numberOfCharacters = [word length]; CGFloat totalWidth = numberOfCharacters * 28 + (numberOfCharacters - 1) * 3; CGFloat leftCap = (320 - totalWidth) / 2; [letters removeAllObjects]; /* Draw the boxes to the screen */ for (int i = 0; i < numberOfCharacters; i++) { LetterBox *letter = [[LetterBox alloc] initWithFrame:CGRectMake(leftCap + i * 31 , 0, 28, 40)]; [letters addObject:letter]; [boxesContainer addSubview:letter]; [letter release]; }} This gives me the image below: http://www.imgdumper.nl/uploads2/4ba3b2c72bb99/4ba3b2c72abfd-Goed.png But sometimes it gives me this: imgdumper.nl/uploads2/4ba3b2d888226/4ba3b2d88728a-Fout.png I add them to the same boxesContainer but they first remove themselves from the superview, so it's not like you see them double or something. What I find weird is that they are all good or all bad.. This is the init function for my LetterBox: if (self == [super initWithFrame:aRect]) { /* Create the box image with same frame */ boxImage = [[UIImageView alloc] initWithFrame:CGRectMake(0, 0, self.bounds.size.width, self.bounds.size.height)]; boxImage.contentMode = UIViewContentModeScaleAspectFit; boxImage.image = [UIImage imageNamed:@"SpaceOpen.png"]; [self addSubview:boxImage]; /* Create the label with same frame */ letterLabel = [[UILabel alloc] initWithFrame:CGRectMake(0, 0, self.bounds.size.width, self.bounds.size.height)]; letterLabel.backgroundColor = [UIColor clearColor]; letterLabel.font = [UIFont fontWithName:@"ArialRoundedMTBold" size:26]; letterLabel.textColor = [UIColor blackColor]; letterLabel.textAlignment = UITextAlignmentCenter; [self addSubview:letterLabel]; } return self;} Does anyone have an idea why this could be? I'd rather have them display correctly every time :)

    Read the article

  • curl problems in c++ class

    - by Danilo
    I read a few articles on c++ / curl here on stackoverflow and assembled the following. The main goal is to handle the whole request in an instance of a class -- and maybe later in a secondary thread. My problem is: "content_" seems to stay empty though its the same addr and HttpFetch.h: class HttpFetch { private: CURL *curl; static size_t handle(char * data, size_t size, size_t nmemb, void * p); size_t handle_impl(char * data, size_t size, size_t nmemb); public: std::string content_; static std::string url_; HttpFetch(std::string url); void start(); std::string data(); }; HttpFetch.cpp: HttpFetch::HttpFetch(std::string url) { curl_global_init(CURL_GLOBAL_ALL); //pretty obvious curl = curl_easy_init(); content_.append("Test"); std::cout << &content_ << "\n"; curl_easy_setopt(curl, CURLOPT_URL, &url); curl_easy_setopt(curl, CURLOPT_WRITEDATA, &content_); curl_easy_setopt(curl, CURLOPT_WRITEFUNCTION, &HttpFetch::handle); //curl_easy_setopt(curl, CURLOPT_VERBOSE, 1L); //tell curl to output its progress curl_easy_setopt(curl, CURLOPT_FOLLOWLOCATION, 1L); //std::cout << &content_ << "\n"; } void HttpFetch::start() { curl_easy_perform(curl); curl_easy_cleanup(curl); } size_t HttpFetch::handle(char * data, size_t size, size_t nmemb, void * p) { std::string *stuff = reinterpret_cast<std::string*>(p); stuff->append(data, size * nmemb); std::cout << stuff << "\n"; // has content from data in it! return size * nmemb; } main.cpp: #include "HttpFetch.h" int main(int argc, const char * argv[]) { HttpFetch call = *new HttpFetch("http://www.example.com"); call.start(); ::std::cout << call.content_ << "\n" } Thanks in advance

    Read the article

  • CUDA memory transfer issue

    - by Vaibhav Sundriyal
    I am trying to execute a code which first transfers data from CPU to GPU memory and vice-versa. In spite of increasing the volume of data, the data transfer time remains the same as if no data transfer is actually taking place. I am posting the code. #include <stdio.h> /* Core input/output operations */ #include <stdlib.h> /* Conversions, random numbers, memory allocation, etc. */ #include <math.h> /* Common mathematical functions */ #include <time.h> /* Converting between various date/time formats */ #include <cuda.h> /* CUDA related stuff */ #include <sys/time.h> __global__ void device_volume(float *x_d,float *y_d) { int index = blockIdx.x * blockDim.x + threadIdx.x; } int main(void) { float *x_h,*y_h,*x_d,*y_d,*z_h,*z_d; long long size=9999999; long long nbytes=size*sizeof(float); timeval t1,t2; double et; x_h=(float*)malloc(nbytes); y_h=(float*)malloc(nbytes); z_h=(float*)malloc(nbytes); cudaMalloc((void **)&x_d,size*sizeof(float)); cudaMalloc((void **)&y_d,size*sizeof(float)); cudaMalloc((void **)&z_d,size*sizeof(float)); gettimeofday(&t1,NULL); cudaMemcpy(x_d, x_h, nbytes, cudaMemcpyHostToDevice); cudaMemcpy(y_d, y_h, nbytes, cudaMemcpyHostToDevice); cudaMemcpy(z_d, z_h, nbytes, cudaMemcpyHostToDevice); gettimeofday(&t2,NULL); et = (t2.tv_sec - t1.tv_sec) * 1000.0; // sec to ms et += (t2.tv_usec - t1.tv_usec) / 1000.0; // us to ms printf("\n %ld\t\t%f\t\t",nbytes,et); et=0.0; //printf("%f %d\n",seconds,CLOCKS_PER_SEC); // launch a kernel with a single thread to greet from the device //device_volume<<<1,1>>>(x_d,y_d); gettimeofday(&t1,NULL); cudaMemcpy(x_h, x_d, nbytes, cudaMemcpyDeviceToHost); cudaMemcpy(y_h, y_d, nbytes, cudaMemcpyDeviceToHost); cudaMemcpy(z_h, z_d, nbytes, cudaMemcpyDeviceToHost); gettimeofday(&t2,NULL); et = (t2.tv_sec - t1.tv_sec) * 1000.0; // sec to ms et += (t2.tv_usec - t1.tv_usec) / 1000.0; // us to ms printf("%f\n",et); cudaFree(x_d); cudaFree(y_d); cudaFree(z_d); return 0; } Can anybody help me with this issue? Thanks

    Read the article

< Previous Page | 431 432 433 434 435 436 437 438 439 440 441 442  | Next Page >