Search Results

Search found 15698 results on 628 pages for 'keep alive'.

Page 449/628 | < Previous Page | 445 446 447 448 449 450 451 452 453 454 455 456  | Next Page >

• Process killing trouble

  - by Aditya Singh

  I am trying to program a server software which involves a lot of testing on java / scala platform. Whenever i compile and execute the code. It starts listening on port 80. Sometimes i need to terminate it by Ctrl+C when it hangs. In that case, ubuntu is not freeing the port. So in order to run the process, i have to restart the machine. I see this at ps aux root 1924 0.0 0.0 5796 1660 pts/0 T 05:44 0:00 sudo scala - root 1925 0.2 1.5 491448 40796 pts/0 Tl 05:44 0:03 java -Xmx256M -Xms16M So process 1924 and 1925. I did sudo kill on both these. But then they keep on persisting even after a long time. sudo nmap -T Aggressive -A -v 127.0.0.1 -p 1-65000 Scanning localhost (127.0.0.1) [65000 ports] Discovered open port 80/tcp on 127.0.0.1 It means its still there ! sudo netstat --tcp --udp --listening --program tcp6 0 0 [::]:www [::]:* LISTEN 1925/java tcp6 0 0 ip6-localhost:ipp [::]:* LISTEN 1185/cupsd This means its 1925 - java How to kill it.

  Read the article

• Need help tuning Mysql and linux server

  - by Newtonx

  We have multi-user application (like MailChimp,Constant Contact) . Each of our customers has it's own contact's list (from 5 to 100.000 contacts). Everything is stored in one BIG database (currently 25G). Since we released our product we have the following data history. 5 years of data history : - users/customers (200+) - contacts (40 million records) - campaigns - campaign_deliveries (73.843.764 records) - campaign_queue ( 8 millions currently ) As we get more users and table records increase our system/web app is getting slower and slower . Some queries takes too long to execute . SCHEMA Table contacts --------------------+------------------+------+-----+---------+----------------+ | Field | Type | Null | Key | Default | Extra | +---------------------+------------------+------+-----+---------+----------------+ | contact_id | int(10) unsigned | NO | PRI | NULL | auto_increment | | client_id | int(10) unsigned | YES | | NULL | | | name | varchar(60) | YES | | NULL | | | mail | varchar(60) | YES | MUL | NULL | | | verified | int(1) | YES | | 0 | | | owner | int(10) unsigned | NO | MUL | 0 | | | date_created | date | YES | MUL | NULL | | | geolocation | varchar(100) | YES | | NULL | | | ip | varchar(20) | YES | MUL | NULL | | +---------------------+------------------+------+-----+---------+----------------+ Table campaign_deliveries +---------------+------------------+------+-----+---------+----------------+ | Field | Type | Null | Key | Default | Extra | +---------------+------------------+------+-----+---------+----------------+ | id | int(11) | NO | PRI | NULL | auto_increment | | newsletter_id | int(10) unsigned | NO | MUL | 0 | | | contact_id | int(10) unsigned | NO | MUL | 0 | | | sent_date | date | YES | MUL | NULL | | | sent_time | time | YES | MUL | NULL | | | smtp_server | varchar(20) | YES | | NULL | | | owner | int(5) | YES | MUL | NULL | | | ip | varchar(20) | YES | MUL | NULL | | +---------------+------------------+------+-----+---------+----------------+ Table campaign_queue +---------------+------------------+------+-----+---------+----------------+ | Field | Type | Null | Key | Default | Extra | +---------------+------------------+------+-----+---------+----------------+ | queue_id | int(10) unsigned | NO | PRI | NULL | auto_increment | | newsletter_id | int(10) unsigned | NO | MUL | 0 | | | owner | int(10) unsigned | NO | MUL | 0 | | | date_to_send | date | YES | | NULL | | | contact_id | int(11) | NO | MUL | NULL | | | date_created | date | YES | | NULL | | +---------------+------------------+------+-----+---------+----------------+ Slow queries LOG -------------------------------------------- Query_time: 350 Lock_time: 1 Rows_sent: 1 Rows_examined: 971004 SELECT COUNT(*) as total FROM contacts WHERE (contacts.owner = 70 AND contacts.verified = 1); Query_time: 235 Lock_time: 1 Rows_sent: 1 Rows_examined: 4455209 SELECT COUNT(*) as total FROM contacts WHERE (contacts.owner = 2); How can we optimize it ? Queries should take no more than 30 secs to execute? Can we optimize it and keep all data in one BIG database or should we change app's structure and set one single database to each user ? Thanks

  Read the article

• Windows Server 2008R2 Virtual Lab Activation strategies?

  - by William Hilsum

  I have a ESXi server that I use for testing, however, I am often needing to create additional Windows Server virtual machines. Typically, if I do not need a VM for more than 30 days, I simply do not activate. However, I have been doing a lot of HA/DRS testing recently and I have had a few servers up for more than this time. I have a MSDN account with Microsoft and have already received extra keys for Windows Server 2008 R2. I am doing nothing illegal and I am sure if I asked, they would issue more - but, I do not want to tempt fate! I have got 3 different "activated" windows snapshots I can get to at any time. If I try to clone these machines, I get the usual "did you copy or move them VM" message. If I choose copy, as far as I can see, it changes the BIOS ID and NIC MACs which is enough to disable activation. If I choose move, it keeps the activation fine (obviously, I know to change the NIC MAC - I believe I can leave the BIOS ID without problems). However, either of these options keeps the same SID code for the computer and user accounts. After the activation period has expired, as far as I can see, all that happens is optional updates do not work - it seems that the normal updates work fine. Based on this, as you can easily get in to Windows when not activated without any sort of workaround, I was wondering if it is ok just to leave a machine un activated? (However, I obviously would prefer if it was activated!) Alternatively, how dangerous is it run multiple machines on a non domain environment with the same SID? I am just interested to know if anyone can recommend a strategy for me? I have only found one solution that deals with bypassing activation - I am not interested in doing anything remotely dodgy... at a stretch, I am happy to rearm (I have never needed to keep a server past 100 days), but, I would rather have a proper strategy in place.

  Read the article

• Find Search Replace from landmark to landmark - including everything in between

  - by Erick Tronboll

  Appreciate some Jedi help... I have the following string: gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR repeating sporadically throughout my document and want to remove everything from: gi|37463 to the AAMGR sequence but, I want to keep the blocks where JQ250 appears: gi|374638936|gb|*JQ250*332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC and remove only the lines that have AEZ554 gi|374638939|gb|*AEZ554*52.1| myosin light chain 2, partial [Batrachoseps major] AAMGR ..................................... So, ideally the following block: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638935|gb|AEZ55450.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638937|gb|AEZ55451.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR Would be left as just: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC ................................many thanks as I help a struggling Grad Student

  Read the article

• Openfire on EC2 with Jingle

  - by Bjorn Roche

  I would like to run Openfire (or another XMPP server) on EC2. At the moment this is just for testing, so easy setup and configuration are important, as is low cost. At some point, however, if things go well, it will be important to scale this. Ideally, it would be nice to not have to switch software when the scaling happens, but if a switch needs to happen later it certainly can. My requirements are: basic XMPP services, including muc and pubsub. Logins controlled from an external API. Preferably, when a user attempts to connect, the XMPP server checks with the api to see if their username and password are correct, but I can also have the API keep the XMPP server up to date on new users, deleted users, pasword changes and so on. I see Openfire has a "user service" API. Not ideal, but it looks workable. Jingle, including relay and STUN. It's not at all clear to me if the Jingle Nodes plugin takes care of this. I'm a bit confused about what's required to set this up, and I'd rather know in advance than be confused along the way :). eg It seems like STUN servers require more than one IP address. Can Openfire do all this for me, including stun and media relay on a single machine? Is this hard to configure on EC2 with Openfire? What are the basic steps? Would this be easier with something else like, say Tigase? What about database? Should I use amazon's database service, or run a db on the same machine? Would the server be compatible with a service like http://www.siteuptime.com/ Thanks!

  Read the article

• Lightweight Linux distro that includes developer tools? (or, the most BSD-like Linux)

  - by RevAaron

  I cut my teeth on Minix and Slackware 1.1, but I've been in the OS X Wilderness for the last few years. I'm trying to standardize on a Linux distribution for personal and work-related use on less powerful laptops and under virtualization. So far, NetBSD and OpenBSD are the best fit for my purposes- but after plenty of frustration I've come to the conclusion that I need to stick with Linux to get the hardware and software support that comes with it. What I like about NetBSD/OpenBSD that I'd like to keep: X, but no default KDE, GNOME or XFCE! A sensible /etc and dot file setup- startx calls xinit, xinit looks for ~/.xinitrc; nothing more complicated than that is needed. Command line tools and file-based configuration: I shouldn't need a GUI to connect to a WAP. Decent selection of binary packages; building from source is OK, but nothing source-only like Gentoo. pkg_add (BSD) and apt-get both have treated me well in the past. Modest RAM and HDD requirements: boot + X + awesome+ two xterms takes up 80 MB on OpenBSD and 240 MB on Debian 5 and Crunchbang In my experience, most "lightweight" and Live CDs focus on a nice desktop environment crammed into a CD or USB stick; once you add build-essentials you end up with something just about as bloated as Ubuntu or Debian full install. Crunchbang is a great example. Thanks in advance for all suggestions!

  Read the article

• Long Gigabit Ethernet Run

  - by Timothy R. Butler

  I am trying to get an Gig-E network between two buildings that are approximately 260 ft. away. While some TRENDnet switches failed to be able to connect to each other over Cat 6 at that distance, two Netgear 5-port Gig-E switches do so just fine. However, it still fails after I put in place APC PNET1GB ethernet surge protectors at each end before the line connects to the respective switches. So I find myself wondering if I simply need to find a better surge protector that doesn't degrade the signal as much (if so, what kind would you recommend?) or if I should give up on copper and use fiber between the buildings. If I opt to go the latter route, I could really use some pointers. It looks like LC connectors are the most common, but I keep running into some others as well. A media converter on each end seems like the simplest solution, but perhaps a Gig-E switch with an SFP port would make more sense? Given a very limited budget, sticking with my existing copper seems best, but if it is bound to be a headache, a 100 meter fiber cable is something I think I can swing cost wise.

  Read the article

• How can I erase the traces of Folder Redirection from the Default Domain Policy

  - by bruor

  I've taken over from an IT outsourcer and have found a struggle now that we're starting a migration to windows 7. Someone decided that they would setup Folder redirection in the Default Domain Policy. I've since configured redirection in another policy at an OU level. No matter what I do, the windows 7 systems pick up the Default Domain Policy folder redirection settings only. I keep getting entries in the event log showing that the previously redirected folders "need to be redirected" with a status of 0x80000004. From what I can tell this just means that it's redirecting them locally. Is there a way I can wipe that section of the GPO clean so it's no longer there? I'm hesitant to try to reset the default domain policy to complete defaults. ***UPDATE 6-26 I found that the following condition occurred and was causing the grief here. I've already implemented the new policies for clients, and for some reason, XP was working great, 7 was refusing to process. The DDP was enforced. Because of this, and the fact that the folder redirection policies were set to redirect back to the local profile upon removal, it was forcing clients to pick up it's "redirect to local" settings. Requirements for to recreate the issue. -Create a new test OU and policy. -Create some folder redirection settings, set them to redirect to local upon removal -Remove settings on that GPO -Refresh your view of the GPO and check the settings. -You'll notice that the settings show "not configured" entries for folder redirection. -Enforce this GPO -Create another sub-OU -Create a GPO linked to this sub-ou and configure some folder redirection settings. -Watch as the enforced GPOs "not configured" setting overrides the policy you just defined. I've had to relink the DDP to all OU's that have "block inheritance" enabled, and disable the "enforced" option on the DDP as a workaround. I'd love to re-enable enforcement of the DDP, but until I can erase the traces of folder redirection settings from the DDP, I think I'm stuck.

  Read the article

• maillog "No route to host" error

  - by Sherwood Hu

  I have a CentOS server. It has sendmail installed but not used for a mail server. I forwarded the root email to another email address. However, I keep getting errors in maillog: Dec 6 08:49:16 server1 sm-msp-queue[16191]: qB6601et005433: to=root, ctladdr=root (0/0), delay=08:49:15, xdelay=00:00:00, mailer=relay, pri=883224, relay=[127.0.0.1], dsn=4.0.0, stat=Deferred: [127.0.0.1]: No route to host Dec 6 08:49:16 server1 sendmail[16190]: qB39nDfQ014062: to=<[email protected]>, delay=3+05:00:02, xdelay=00:00:00, mailer=esmtp, pri=6965048, relay=subdomain.example.com., dsn=4.0.0, stat=Deferred: subdomain.example.com.: No route to host Dec 6 08:49:16 server1 sendmail[16190]: qB39nDfR014062: to=<[email protected]>, delay=3+05:00:02, xdelay=00:00:00, mailer=esmtp, pri=7004959, relay=subdomain.example.com., dsn=4.0.0, stat=Deferred: subdomain.example.com.: No route to host In the forwarded email address, I received notification "it can't deliver email to [email protected]. subdoamin.example.com does have a MX record, and I do not want to add one. Is there any configuration that I can change to prevent this error? I want all emails to the root to be forwarded to the forward address.

  Read the article

• Server Names Inside Private Network

  - by thyandrecardoso

  Our office has a private network, where any requests on a (pre-determined) public IP are forwarded to a private IP inside said network. On that private IP, we've got a server running several services, including HTTP servers, and SCM systems. We only control our private network, having no control on the public IP configuration. We bought a domain name, and pointed it to that public IP, so people can access our services from the outside. But, when inside the office, people can't use that DNS name, because the server and any other hosts inside the network share the same public IP! For desktops, inside the office network, dealing with names is really easy: one entry on the hosts file and we're done. However, for laptops, that keep going in and out, and need to access services inside the office, the naming is really annoying. I don't know the "standard" process for dealing with these kind of situations. I've considered installing BIND in the office, and make people configure their wireless and wired connections to use that DNS server. What is the correct approach in this situation? If using BIND (or any other DNS server) is the answer, how should I configure it so that people inside the office can use it to get our custom names, and get forwarded to the ISP DNS when trying to reach the internet?

  Read the article

• How can a Linux Administrator improve their shell scripting and automation skills?

  - by ewwhite

  In my organization, I work with a group of NOC staff, budding junior engineers and a handful of senior engineers; all with a focus on Linux. One interesting step in the way the company grows talent is that there's a path from the NOC to the senior engineering ranks. Viewing the talent pool as a relative newcomer, I see that there's a split in the skill sets that tends to grow over time... There are engineers who know one or several particular technologies well and are constantly immersed... e.g. MySQL, firewalls, SAN storage, load balancers... There are others who are generalists and can navigate multiple technologies. All learn enough Linux (commands, processes) to do what they need and use on a daily basis. A differentiating factor between some of the staff is how well they embrace scripting, automation and configuration management methodologies. For instance, we have two engineers who do the bulk of Amazon AWS CloudFormation work, and another who handles most of the Puppet infrastructure. Perhaps a quarter of the engineers are adept at BASH shell scripting. Looking at this in the context of the incredibly high demand for DevOps skills in the job market, I'm curious how other organizations foster the development of these skills and grow their internal talent. Scripting doesn't seem like a particularly-teachable concept. How does a sysadmin improve their shell scripting? Is there still a place for engineers who do not/cannot keep up in the DevOps paradigm? Are we simply to assume that some people will be left behind as these technologies evolve? Is that okay?

  Read the article

• Accessing SSH_AUTH_SOCK from another non-root user

  - by Danny F

  The Scenario: I am running ssh-agent on my local PC, and all my servers/clients are setup to forward SSH agent auth. I can hop between all my machines using the ssh-agent on my local PC. That works. I need to be able to SSH to a machine as myself (user1), change to another user named user2 (sudo -i -u user2), and then ssh to another box using the ssh-agent I have running on my local PC. Lets say I want to do something like ssh user3@machine2 (assuming that user3 has my public SSH key in their authorized_keys file). I have sudo configured to keep the SSH_AUTH_SOCK environment variable. All users involved (user[1-3]), are non privileged users (not root). The Problem: When I change to another user, even though the SSH_AUTH_SOCK variable is set correctly, (lets say its set to: /tmp/ssh-HbKVFL7799/agent.13799) user2 does not have access to the socket that was created by user1 - Which of course makes sense, otherwise user2 could hijack user1's private key and hop around as that user. This scenario works just fine if instead of getting a shell via sudo for user2, I get a shell via sudo for root. Because naturally root has access to all the files on the machine. The question: Preferably using sudo, how can I change from user1 to user2, but still have access to user1's SSH_AUTH_SOCK?

  Read the article

• How to speed up a HP M9517C

  - by Jen

  I bought a system with 8GB RAM, 1TB HD, Quad-Core AMD Phenom 9550, Nvidia Geforce 9300GE, 64-bit Windows Vista Machine. Bought it primarily because it was cheap and came with 25.5 inch screen. Problem: It's slow - if you can believe it. My Dell laptop 1525 is faster and more stable! I tried installing and dual-booting Linux Mint and ran into video and audio troubles. I need fast and stable and I'm going for awesome. Anyone have some suggestions on making this thing smoking hot? Vista is fine, but slows over time - suspect virus/spyware/etc.. But I need to use Photoshop, Fireworks, Dreamweaver, Illustrator. I've tried the alternatives and I just don't like them. When you've got deadlines looming you want to work with what you know. Also use Skype (and I had audio problems with it in Linux), gotomeeting, gotowebinar. Don't need MS Office. Tried VMWare, Virtualbox and again - I keep getting audio/video problems. I'd love someone's input on THEIR setup and how they got there. I'm sure I need to upgrade my video card, but what should I go to?

  Read the article

• How to wire 20 computers and 20 phones and 1 server into LAN?

  - by John Smith

  I have currently 3 switches Two Netgear JFS524 with 24 slots, One Belkin with 16 slots. Server DSL Internet Router. Main question is how to connect switches together, two Netgear's are next to each other, yet one is about 100 feet away and holds about 5 computer and 5 phones. If i connect them with only 1 wire will that limit bandwidth? e.g. all 23 computers will be limited to speed of one CAT5e cable? If i connect switches with 2 cables will this give speed boost? What's the ideal scenario should i just move the third switch next to other two? Will the speed of computer connected to white switch be same as computer connected to top switch? Will moving white switch right next top switch and having 16 wires comming 100 feet instead of 1 wire comming 100 feet make it faster? EDIT 1: I actually have NETGEAR ProSafe GS105 Gigabit switch its only has 4 ports in it though, you think i can have use of it in current setup? Like connect all 3 switches and server into it and keep internet router and phone server on one of the slower switches EDIT 2: Everyone mention gigabit switches, but will they do any difference with 10/100 network cards? I then have to use gigabit cards in every computer too? I could in server perhaps, but users will be 10/100

  Read the article

• WT-NMP - PHP-CGI randomly stops running with no error log

  - by alexfontaine

  We have recently installed WT-NMP and are currently running Php-Cgi with php 5.4.24. We are running fairly simple php scripts and when testing everything is running fine. Over the weekend we wanted to keep the server running test it over a longer period of time. The server and scripts ran fine all day on Friday, but sometime late on Saturday, the php-cgi stopped running. There are no errors in the error log (C:\WT-NMP\log). In the configuration (php.ini) I have the following options set: error_reporting = E_ALL display_errors = On display_startup_errors = On log_errors = On html_errors = On error_log = "c:/wt-nmp/log/php_error.log" We also have the standard nginx.conf error logs: access_log "c:/wt-nmp/log/nginx_access.log"; error_log "c:/wt-nmp/log/nginx_error.log" warn; So, since the log directory is empty, I am assuming that the running php scripts and general nginx operations are not causing the php-cgi to stop. So my questions are: What else could cause the php-cgi to stop running? Are there any other options for logging that we could turn on that could help us track this down? Are there other log locations that we should be looking at? Thanks!

  Read the article

• Samba server NETBIOS name not resolving, WINS support not working

  - by Eric

  When I try to connect to my CentOS 6.2 x86_64 server's samba shares using address \\REPO (NETBIOS name of REPO), it times out and shows an error; if I do so directly via IP, it works fine. Furthermore, my server does not work correctly as a WINS server despite my samba settings being correct for it (see below for details). If I stop the iptables service, things work properly. I'm using this page as a reference for which ports to use: http://www.samba.org/samba/docs/server_security.html Specifically: UDP/137 - used by nmbd UDP/138 - used by nmbd TCP/139 - used by smbd TCP/445 - used by smbd I really really really want to keep the secure iptables design I have below but just fix this particular problem. SMB.CONF [global] netbios name = REPO workgroup = AWESOME security = user encrypt passwords = yes # Use the native linux password database #passdb backend = tdbsam # Be a WINS server wins support = yes # Make this server a master browser local master = yes preferred master = yes os level = 65 # Disable print support load printers = no printing = bsd printcap name = /dev/null disable spoolss = yes # Restrict who can access the shares hosts allow = 127.0.0. 10.1.1. [public] path = /mnt/repo/public create mode = 0640 directory mode = 0750 writable = yes valid users = mangs repoman IPTABLES CONFIGURE SCRIPT # Remove all existing rules iptables -F # Set default chain policies iptables -P INPUT DROP iptables -P FORWARD DROP iptables -P OUTPUT DROP # Allow incoming SSH iptables -A INPUT -i eth0 -p tcp --dport 22222 -m state --state NEW,ESTABLISHED -j ACCEPT iptables -A OUTPUT -o eth0 -p tcp --sport 22222 -m state --state ESTABLISHED -j ACCEPT # Allow incoming HTTP #iptables -A INPUT -i eth0 -p tcp --dport 80 -m state --state NEW,ESTABLISHED -j ACCEPT #iptables -A OUTPUT -o eth0 -p tcp --sport 80 -m state --state ESTABLISHED -j ACCEPT # Allow incoming Samba iptables -A INPUT -i eth0 -p udp --dport 137 -m state --state NEW,ESTABLISHED -j ACCEPT iptables -A OUTPUT -o eth0 -p udp --sport 137 -m state --state ESTABLISHED -j ACCEPT iptables -A INPUT -i eth0 -p udp --dport 138 -m state --state NEW,ESTABLISHED -j ACCEPT iptables -A OUTPUT -o eth0 -p udp --sport 138 -m state --state ESTABLISHED -j ACCEPT iptables -A INPUT -i eth0 -p tcp --dport 139 -m state --state NEW,ESTABLISHED -j ACCEPT iptables -A OUTPUT -o eth0 -p tcp --sport 139 -m state --state ESTABLISHED -j ACCEPT iptables -A INPUT -i eth0 -p tcp --dport 445 -m state --state NEW,ESTABLISHED -j ACCEPT iptables -A OUTPUT -o eth0 -p tcp --sport 445 -m state --state ESTABLISHED -j ACCEPT # Make these rules permanent service iptables save service iptables restart**strong text**

  Read the article

• Migrating Windows 2003 File Server Cluster to Windows 2008 R2 Standalone?

  - by Tatas

  We have a situation where we have an aging Windows 2003 File Server Cluster that we'd like to move to a standalone Windows Server 2008 R2 VM that resides in our Hyper-V R2 installation. We see no need to keep the Clustering as Hyper-V is now providing our Failover/Redundancy. Usually, in a standalone file server migration we migrate the data, preserving NTFS permissions and then export the sharing permissions from the registry and import them on the new server. This does not appear possible in this instance, as the 2003 cluster stores the sharing permissions quite differently. My question is, how would one perform this type of migration? Is it even possible? My current lead is the File Server Migration Toolkit, however I can find no information on the net about migrating from cluster to standalone, only the opposite. Please help. UPDATE: We ended up getting the data copied over (permissions intact), but had to recreate the shares manually by hand. It was a bit of a pain but it did in the end work out.

  Read the article

• Syncronization between folders MAC OS Lion

  - by Andre Carvalho

  I have an iMac at home and I use a Macbook pro for work. I also have a time capsule at home containing my main folder with my main files. I use it as a NAS besides the Time Machine backup tool. I have several personal files I need to be accessing both at home and at work. My wife, who works at home, uses sometimes the same .XLS files and .DOC files I might have used during my day at work, away from home. My question is: Is there a software, or tool that a I can use to sync my iMac and my MB Pro folders? Remembering that: There might be a chance that my wife and I have changed the same files during the day, so the files would have to be merged so none of the information added by either me or my wife would be lost. The software/tool that would be installed on the MB Pro would need to mount the Time Capsule volume so it could locate the main folder on it. It has to be done automatically when my MB is at home ( with a schedule option ); I have tested some softwares like synctwofolders and Chronosync but none fulfilled all my needs. The first couldn't mount the Time Capsule Volume and didn't have the many schedule options. I really liked Chronosync, but it doesn't merge the files. When it detects a conflict ( for instance: my wife changed a .DOC file on the iMAC and I changed the same file on the MB it asks you to choose which version you want to keep instead of allowing you simply to merge them ). I don't have much experience with automator or scripts but maybe you can give me a hand with that.

  Read the article

• haproxy: Is there a way to group acls for greater efficiency?

  - by user41356

  I have some logic in a frontend that routes to different backends based on both the host and the url. Logically it looks like this: if hdr(host) ends with 'a.domain.com': if url starts with '/dir1/': use backend domain.com/dir1/ elif url starts with '/dir2/': use backend domain.com/dir2/ # ... else if ladder repeats on different dirs elif hdr(host) ends with 'b.domain.com': # another else if ladder exactly the same as above # ... # ... else if ladder repeats like this on different domains Is there a way to group acls to avoid having to repeatedly check the domain acl? Obviously there needs to be a use backend statement for each possibility, but I don't want to have to check the domain over and over because it's very inefficient. In other words, I want to avoid this: use backend domain.com/url1/ if acl-domain.com and acl-url1 use backend domain.com/url2/ if acl-domain.com and acl-url2 use backend domain.com/url3/ if acl-domain.com and acl-url3 # tons more possibilities below because it has to keep checking acl-domain.com. This is particularly an issue because I have specific rules for subdomains such as a.domain.com and b.domain.com, but I want to fall back on the most common case of *.domain.com. That means every single rule that uses a specific subdomain must be checked prior to *.domain.com which makes it even more inefficient for the common case.

  Read the article

• Changing Domain Name DNS to Redirect web traffic to one server, and leave mail to original server

  - by David S

  Hi there, Ok, quite the idiot with DNS.. apart from the basics. I have a domain name hosted with a domain registrar. It seems to have full DNS control (i.e. ability to view/edit A Records, Mail etc..) We have recently setup a server at Rackspace which hosts the new website The original/existing server (where the old website still is and Mail) is on another shared hosting companies server I went to the domain name registrar, and checked out the DNS management as follows: click here to view the DNS screenshot So obviously the A Record is pointing to the actual server where the website/mail is I figure, and the CNAME is pointing (alias?) to the website url. So my question is this: If I want the web traffic portion to go to the Rackspace/new server, but keep the mail going to where it is now, what do I have to change? Also, should I even change this info at the domain registrar? the rackspace server account has full DNS which seems to suggest I can point to their nameservers and then re-direct the MX (Mail) traffic to where the mail server is? Sorry if that was a bit confusing.. obviously in need of DNS training ;) Any help very appreciated. David.

  Read the article

• Better way to design a database

  - by cMinor

  I have a conceptual problem and I would like to get your ideas on how I'll be able to do what I am aiming. My goal is to create a database with information of persons who work at a place depending on their profession and skills,and keep control of salary and projects (how much would cost summing all the hours of work) I have 3 categories which can have subcategories: Outsourcing Technician welder turner assistant Administrative supervisor manager So each person has its information and the projects they are working on, also one person may do several jobs... I was thinking about having 5 tables (EMPLOYEE, SKILLS, PROYECTS, SALARY, PROFESSION) but I guess there is a better way of doing this. create table Employee ( PRIMARY KEY [Person_ID] int(10), [Name] varchar(30), [sex] varchar(10), [address] varchar(10), [profession] varchar(10), [Skills_ID] int(10), [Proyect_ID] int(10), [Salary_ID] int(10), [Salary] float ) create table Skills ( PRIMARY KEY [Skills_ID] int(10), FOREIGN KEY [Skills_name] varchar(10) REFERENCES Employee(Person_ID), [Skills_pay] float(10), [Comments] varchar(50) ) create table Proyects ( PRIMARY KEY [Proyect_ID] int(10), FOREIGN KEY [Skills_name] varchar(10) REFERENCES Employee(Person_ID) [Proyect_name] varchar(10), [working_Hours] float(10), [Comments] varchar(50) ) create table Salary ( PRIMARY KEY [Salary_ID] int(10), FOREIGN KEY [Skills_name] varchar(10) REFERENCES Employee(Person_ID) [Proyect_name] varchar(10), [working_Hours] float(10), [Comments] varchar(50) ) So to get the total amount of the cost of a project I would just sum the working hours of each employee envolved and sum some extra costs in an aggregate query. Is there a way to do this in a more efficient way? What to add or delete of this small model? I guess I am missing something in the salary - maybe I need another table for that?

  Read the article

• Why won't 2GB of ram across 3 of 4 slots work on my motherboard (max 2GB)?

  - by Andrew

  My desktop is an old home-built machine circa 200[5-6] running Ubuntu 11.10 (but this is not relevant because I'm reading available ram from BIOS loading screen), with an ASUS P5GPL motherboard, not X or X-SE - it has four slots. I'm mainly a laptop person, but keep this around for running a server from if needed, backing up to, seeding Ubuntu to people from, etc… It has four (DDR) ram slots, two black and two blue, in the order black-blue-black-blue (I will call them D, C, B, and A, respectively) with some space in the middle. The blue ones are the closest to the processor. I used to have two 512MB chips in the two blue slots. I just got a 1GB chip and plugged it into one of the black slots; my system didn't recognize it. I messed around and discovered that it will not recognize chips in many positions, and I couldn't get it to recognize all three of these chips at the same time. In particular, if I put the 512MB chips in A and B it would only use 1, but AC, AD, BD, and CD worked. I didn't try BC, I believe. Only some of these continue to work when I switch the 1GB chip into one of these positions. Can I have some advice as to how to position these chips to get all 2GB used? How about if I get another 1GB chip - where should I put the two? And what about the RAM maximum Crucial says? Can I go above 2GB, if I get another 1GB chip? Right now, I have a 512MB chip in A and the 1GB chip in C. EDIT: I read some other posts and tried dmidecode in Ubuntu to clarify the max memory question, that wasn't a major part anyways. It says my max memory module size is 1024M (OK) and my max memory size is 4096M (doesn't agree with Crucial OR the Asus web site, maybe it will only work while in Linux and BIOS won't OK it?).

  Read the article

• How to auto-cc a system email account any time a user creates an appointment

  - by Ferdy

  I will not bother explaining my full architecture or reasons for wanting this in order to keep this question short: Is it possible to auto-cc a certain email account any time a Exchange user creates an appointment or meeting in his own calendar? Is it possible using rules? Our Exchange 2007 server is outsourced, I cannot change the configuration or install plugins server-side Preferably, it still should work server-side, because users may use the Outlook client but also Outlook Web Access Is there any other way, perhaps using group policies? My conclusion so far is that the only viable way to accomplish this is to build an Outlook add-on. The problem there is that it will need to be managed for thousands of desktop users and that the add-on will not work when using another client (OWA, mobile). An alternative architecture could be to pull the information from the user's calendar on a scheduled basis. Given that we are talking about a lot of users, scalability is a major issue, this has also been confirmed by Microsoft. Can you confirm that my thinking is correct or do you have any other solutions?

  Read the article

• Moving domain and keeping IMAP email - Linux Evolution, Mac Mail

  - by Douglas Squirrel

  This question is about keeping email during a server move, where the clients are Linux (me) and Mac (my wife) using IMAP. I receive email at [email protected] using a webmail service that my hosting company (1and1) provides. I read it via IMAP in evolution, so I should have copies of all the emails on my local machine. I have just moved mydomain.com from one type of account to another, and the hosting company don't move my existing email on the server when I do this - I assume they move my account to a different mailserver, and don't choose to provide a migration path for the email to move too (yes, this is annoying). Before migrating, I backed up Evolution (File - Backup settings) and did a spot-check in the evolution-backup.tar.gz file to be sure that my mail was in there. After migrating, I restored (File - Restore settings) and had hoped that I would see all my mail again. Unfortunately, Evolution just shows me new mail sent to the account, not the old mail. Is there a way to get the old mail back in the mailserver, or at least displaying in Evolution, as it was before the move? If not, can I read it in some convenient way, e.g. in Evolution offline or in a text file (then I can pick the mails I really want to keep and resend them to myself)? Also, I am about to do a similar move for my wife's domain, [email protected]. She reads her mail on a Mac using IMAP to Apple Mail. Is there anything I can do to make the move smooth for her? (I have backed up [her user]/Library/Mail already, but not sure what to do once the move is done.)

  Read the article

• RHEL 5.3 Kickstart - How specify location of individual package in Workstation folder?

  - by Ed

  I keep getting "package does not exist" errors during the install. I made a kickstart ISO to create an unattended install of a RHEL 5.3 build machine for C++ software releases. It pulls the kickstart config file from our internal web server. This is handy; it makes it easy to test and modify without having to make a new ISO. And I plan to check it in to version control if I can get it working. Anyway, the rpm packages are located in two folders on the disk; Client and Workstation. The packages install fine for the ones that are physically located under the Client folder. It cannot find those under the Workstation folder such as as doxygen and subversion complaining that packages do not exist. Is there a way to specify the individual package location? # ----------------------------------------------------------------------------- # P A C K A G E S # ----------------------------------------------------------------------------- %packages @gnome-desktop @core @base @base-x @printing @development-tools emacs kexec-tools fipscheck xorg-x11-server-Xnest xorg-x11-server-Xvfb #Packages Located in Workstation Folder *** Install can not find any of these ?? bison doxygen gcc-c++ subversion zlib-devel freetype-devel libxml2-devel Thanks in advance, -Ed

  Read the article

< Previous Page | 445 446 447 448 449 450 451 452 453 454 455 456  | Next Page >