Search Results

Search found 95527 results on 3822 pages for 'the curious one'.

Page 450/3822 | < Previous Page | 446 447 448 449 450 451 452 453 454 455 456 457  | Next Page >

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • how to architect this to make it unit testable

    - by SOfanatic
    I'm currently working on a project where I'm receiving an object via web service (WSDL). The overall process is the following: Receive object - add/delete/update parts (or all) of it - and return the object with the changes made. The thing is that sometimes these changes are complicated and there is some logic involved, other databases, other web services, etc. so to facilitate this I'm creating a custom object that mimics the original one but has some enhanced functionality to make some things easier. So I'm trying to have this process: Receive original object - convert/copy it to custom object - add/delete/update - convert/copy it back to original object - return original object. Example: public class Row { public List<Field> Fields { get; set; } public string RowId { get; set; } public Row() { this.Fields = new List<Field>(); } } public class Field { public string Number { get; set; } public string Value { get; set; } } So for example, one of the "actions" to perform on this would be to find all Fields in a Row that match a Value equal to something, and update them with some other value. I have a CustomRow class that represents the Row class, how can I make this class unit testable? Do I have to create an interface ICustomRow to mock it in the unit test? If one of the actions is to sum all of the Values in the Fields that have a Number equal to 10, like this function, how can design the custom class to facilitate unit tests. Sample function: public int Sum(FieldNumber number) { return row.Fields.Where(x => x.FieldNumber.Equals(number)).Sum(x => x.FieldValue); } Am I approaching this the wrong way?

    Read the article

  • Matrices: Arrays or separate member variables?

    - by bjz
    I'm teaching myself 3D maths and in the process building my own rudimentary engine (of sorts). I was wondering what would be the best way to structure my matrix class. There are a few options: Separate member variables: struct Mat4 { float m11, m12, m13, m14, m21, m22, m23, m24, m31, m32, m33, m34, m41, m42, m43, m44; // methods } A multi-dimensional array: struct Mat4 { float[4][4] m; // methods } An array of vectors struct Mat4 { Vec4[4] m; // methods } I'm guessing there would be positives and negatives to each. From 3D Math Primer for Graphics and Game Development, 2nd Edition p.155: Matrices use 1-based indices, so the first row and column are numbered 1. For example, a12 (read “a one two,” not “a twelve”) is the element in the first row, second column. Notice that this is different from programming languages such as C++ and Java, which use 0-based array indices. A matrix does not have a column 0 or row 0. This difference in indexing can cause some confusion if matrices are stored using an actual array data type. For this reason, it’s common for classes that store small, fixed size matrices of the type used for geometric purposes to give each element its own named member variable, such as float a11, instead of using the language’s native array support with something like float elem[3][3]. So that's one vote for method one. Is this really the accepted way to do things? It seems rather unwieldy if the only benefit would be sticking with the conventional math notation.

    Read the article

  • java web application best practices

    - by Bruce
    Hi all I'm trying to figure out the optimum way to develop and release a fairly simple web application, and I'm running into several problems. I'll outline the decisions I've made, because somewhere I've clearly gone off the rails.. Hugely grateful for any help! I have what I think is a fairly simple web application. It contains a couple of jsps that reference a couple of java beans, and the usual static html, js, css and images. Decision 1) I wanted to have a clear and clean release procedure, such that I could develop on my local machine and then release reliably to a production machine. I therefore made the decision to package the application into a war file (including all the static resources), to minimize the separate bits and pieces I would need to release. So far so good? Decision 2) I wanted things on my local machine to be as similar as possible to the production environment. So in my html, for example, I may have a reference to a static file such as http://static.foo.com/file . To keep this code working seamlessly on dev and prod, I decided to put static.foo.com in my /etc/hosts when developing locally, so that all the urls work correctly without changing anything. Decision 3) I decided to use eclipse and maven to give me a best practice environment for administering and building my project. So I have a nice tight set up now, except that: Every time I want to change anything in development, like one line in an html file, I have to rebuild the entire project and then wait for tomcat to load the war before I can see if it's what I wanted. So my questions are: 1) Is there a way to connect up eclipse and tomcat so that I don't have to rebuild the war each time? ie tomcat is looking straight at my actual workspace to serve up the static files? 2)I think I'm maybe making things harder by using /etc/hosts to reflect production urls - is there a better way that doesn't involve manually changing over urls (relative urls are fine of course, but where you have many subdomains, say one for static files and one for dynamic, you have to write out the full path, surely?) 3) Is this really best practice?? How do people set things up so that they balance the requirement for an automated, all-encompassing build process on the one hand, and the speed and flexibility to be able to develop javascript and html and css quickly, as quickly as if one just pointed apache at the directory and developed live? What do people find works? Many thanks!

    Read the article

  • BoundingSpheres move when they should not

    - by NDraskovic
    I have a XNA 4.0 project in which I load a file that contains type and coordinates of items I need to draw to the screen. Also I need to check if one particular type (the only movable one) is passing in front or trough other items. This is the code I use to load the configuration: if (ks.IsKeyDown(Microsoft.Xna.Framework.Input.Keys.L)) { this.GraphicsDevice.Clear(Color.CornflowerBlue); Otvaranje.ShowDialog(); try { using (StreamReader sr = new StreamReader(Otvaranje.FileName)) { String linija; while ((linija = sr.ReadLine()) != null) { red = linija.Split(','); model = red[0]; x = red[1]; y = red[2]; z = red[3]; elementi.Add(Convert.ToInt32(model)); podatci.Add(new Vector3(Convert.ToSingle(x), Convert.ToSingle(y), Convert.ToSingle(z))); sfere.Add(new BoundingSphere(new Vector3(Convert.ToSingle(x), Convert.ToSingle(y), Convert.ToSingle(z)), 1f)); } } } catch (Exception ex) { Window.Title = ex.ToString(); } } The "Otvaranje" is an OpenFileDialog object, "elementi" is a List (determines the type of item that would be drawn), podatci is a List (determines the location where the items will be drawn) and sfere is a List. Now I solved the picking algorithm (checking for ray and bounding sphere intersection) and it works fine, but the collision detection does not. I noticed, while using picking, that BoundingSphere's move even though the objects that they correspond to do not. The movable object is drawn to the world1 Matrix, and the static objects are drawn into the world2 Matrix (world1 and world2 have the same values, I just separated them so that the static elements would not move when the movable one does). The problem is that when I move the item I want, all boundingSpheres move accordingly. How can I move only the boundingSphere that corresponds to that particular item, and leave the rest where they are?

    Read the article

  • Sharing password-protected videos on social media

    - by PaulJ
    We are developing a site where users will be able to watch and download videos that they've recorded of themselves in a public event. The videos will be password protected, and will be available only to users who have paid for them at the event... ...But on the other hand, we also want users to share those videos on social media, since they will be an attractive publicity for our events. Having people log into our site with their password, download the video and then re-upload it to Youtube/Facebook will be too cumbersome, and I suspect that few users will be willing to do that. So the obvious alternative is to have one of those convenient "share" buttons, but the problem with that approach will be that: The video will be physically hosted (and linked to) in our site. What happens if those videos go viral and our bandwidth cost explodes? The video is password protected. The solution I've thought of for this is: Upload the user's video to our (password-protected site) and to Youtube at the same time, as an unlisted video. The user can access our site with his password and download his video (to watch on his TV or whatever). If the users hits the "share" button, we show him the Youtube link... and we turn the video into a listed one. This seems in line with the ideas in Using YouTube as a CDN, and there didn't seem to be any objections in that question. I'm posting this just to confirm that my idea doesn't violate any Youtube TOS, and also to see if it is a good one or there might be better alternatives.

    Read the article

  • Leadership Tip&ndash;Vent Up!

    - by D'Arcy Lussier
    Leadership is difficult, for many reasons. One of those reasons is that we not only need to keep ourselves motivated when difficult or challenging times come, but we also need to motivate our teams and keep them focussed on the tasks at hand regardless of the mortars being rained down around them. Inexperienced (and experienced) leaders can fall into the “me-too” mentality – that is, the leader sees themselves as part of the team member instead of the leader of the team. Once a leader changes the teams view that he/she is a peer and not the leader, dynamics can change on the team. One of the biggest dangers is that the leader starts sharing frustrations, fears, concerns, etc. with the team that they’re supposed to be leading on to victory. This can destroy a team’s morale and productivity. One simple thing you can do to counter this is remember this rule when it comes to venting: Vent Up! Don’t vent sideways or down, vent up. Vent to the people above you – they’re the ones that tend to have the power to actually change things anyway. You as a leader stay healthy by getting your frustrations and concerns off your chest, your team is still insulated from it, and your superiors are aware of issues that need to be addressed or can coach you through the obstacles. D

    Read the article

  • How do I update with a newly-created detached entity using NHibernate?

    - by Daniel T.
    Explanation: Let's say I have an object graph that's nested several levels deep and each entity has a bi-directional relationship with each other. A -> B -> C -> D -> E Or in other words, A has a collection of B and B has a reference back to A, and B has a collection of C and C has a reference back to B, etc... Now let's say I want to edit some data for an instance ofC. In Winforms, I would use something like this: var instanceOfC; using (var session = SessionFactory.OpenSession()) { // get the instance of C with Id = 3 instanceOfC = session.Linq<C>().Where(x => x.Id == 3); } SendToUIAndLetUserUpdateData(instanceOfC); using (var session = SessionFactory.OpenSession()) { // re-attach the detached entity and update it session.Update(instanceOfC); } In plain English, we grab a persistent instance out of the database, detach it, give it to the UI layer for editing, then re-attach it and save it back to the database. Problem: This works fine for Winform applications because we're using the same entity all throughout, the only difference being that it goes from persistent to detached to persistent again. The problem occurs when I'm using a web service and a browser, sending over JSON data. In this case, the data that comes back is no longer a detached entity, but rather a transient one that just happens to have the same ID as the persistent one. If I use this entity to update, it will wipe out the relationship to B and D unless I sent the entire object graph over to the UI and got it back in one piece. Question: My question is, how do I serialize detached entities over the web, receive them back, and save them, while preserving any relationships that I didn't explicitly change? I know about ISession.SaveOrUpdateCopy and ISession.Merge() (they seem to do the same thing?), but this will still wipe out the relationships if I don't explicitly set them. I could copy the fields from the transient entity to the persistent entity one by one, but this doesn't work too well when it comes to relationships and I'd have to handle version comparisons manually.

    Read the article

  • why doesn't my computer resume after sleeping overnight?

    - by bamdad
    i'm having a weird, weird bug that's been haunting me since 11.10. if i listen to music or watch a video and my computer automatically goes to sleep at night, it won't properly resume in the morning. otherwise, suspend and resume works just fine. what happens is that the wi-fi and bluetooth indicator (that turns from white to orange when suspending) stays orange, the display doesn't turn on, and the only option i have is to hard reset the machine. here's what i've tried so far: installing (and uninstalling and reinstalling) laptop-mode-tools switching the proprietary wireless driver (broadcom-wl) to the open source one (brcmsmac & bcma) and back unloading (and blacklisting) all bluetooth modules (rfcomm, btusb, bnep, bluetooth) and stopping (# stop bluetooth) and disabling (# echo 'manual' /etc/init/bluetooth.override) the bluetooth service creating a custom pm sleep action as suggested here: http://ubuntuforums.org/showthread.php?p=11926504 not watching youtube / any stuff that uses flash before going to sleep (i have flashblock, and i checked $ ps aux | grep flash) because i suspected flash to be the culprit trying out different versions of fglrx (the one from the repos, then installing the latest one from amd's site via generated .deb files, then back to the official ones) none of these worked. i remember back in the days of 10.04, there was a gconf key called network sleep: i thought about disabling that, since re-enabling the wireless card seems to be the problem (according to the indicator led), but the option appears to be missing from gnome 3 (unity-2d, whatever). does anyone have any ideas? thanks, bamdad

    Read the article

  • Assigning a script to a keystroke to toggle touchpad

    - by sodiumnitrate
    Since my default sony vaio shortcuts don't completely work in Ubuntu 12.04, I'd like to assign a script to Fn + F1, which toggles the touchpad on and off, so that the cursor would stop moving while I'm typing. Since I use a mouse and rarely need to use the touchpad, I don't want to use "disable touchpad while writing", which doesn't really seem to work anyway. I figured that using a script with the following command (this works, but I have to open up a terminal each time): xinput set-prop 12 "Device Enabled" 0 I have two problems at this point. One is that I don't know how to write this script so that it will toggle it off if it is on, and on if it is off. I know I should use an if statement but I don't know what value I should be checking to see if it is on or off. The second one is that I am having problems creating a new shortcut. I use System Settings - Keyboard - Shortcuts. I tried to add, to custom shortcuts, a new one by clicking the '+' sign. I named it Toggle Touchpad, and added the path to the executable script with the line above, by typing /home/irem/.toggletouchpad I have made it an executable with chmod. The problem is that when I click apply, and then click back on it to define the keystroke, it re-opens the dialogue. I cannot define new keys. (It says disabled on the right column of the entry). I have also tried xbindkeys, which almost constantly crashes. I'd prefer the system settings, if I can set the shortcut. I'd appreciate if anyone can help. Thanks.

    Read the article

  • Is it a good programming practice to have a class with several .h files?

    - by Jim Thio
    I suppose the class have several different interfaces. Some it shows to some class, some it shows to other classes. Are there any good reason for that? One thing I can think of is with one .h per class, interface would either be public or private. What about if I want some interface to be available to some friends' class and some interface to be truly public? Sample: @interface listNewController:BadgerStandardViewViewController <UITableViewDelegate,UITableViewDataSource,UITextFieldDelegate,NSFetchedResultsControllerDelegate,UIScrollViewDelegate,UIGestureRecognizerDelegate> { } @property (nonatomic) IBOutlet NSFetchedResultsController *FetchController; @property (nonatomic) IBOutlet UITextField *searchBar1; @property (nonatomic) IBOutlet UITableView *tableViewA; + (listNewController *) singleton; //For Easier Access -(void)collapseAll; -(void)TitleViewClicked:(TitleView *) theTitleView; -(NSUInteger) countOfEachSection:(NSInteger)section; @end Many of those public properties and function are only ever called by just one other classes. I wonder why I need to make them available to many classes. It's in Objective-c by the way

    Read the article

  • Performance impact of Zones.

    - by nospam(at)example.com (Joerg Moellenkamp)
    I was really astonished when i saw this question. Because this question was a old acquaintance from years ago, that i didn't heard for a long time. However there was it again. The question: "What's the overhead of Zones?". Sun was and Oracle is not saying "zero". We saying saying minimal. However during all the performance analysis gigs on customer systems i made since the introduction of Zones i failed to measure any overhead caused by zones. What i saw however, was additional load intoduced by processes that wouldn't be there when you would use only one zone Like additional monitoring daemons, like additional daemons having a controlling or supervising job for the application that resulted in slighly longer runtimes of processes, because such additional daemons wanted some cycles on the CPU as well. So i ask when someone wants to tell me that he measured a slight slowdown, if he or she has really measured the impact of the virtualization layer or of a side effect described above. It seems to be a little bit hard to believe, that a virtualisation technology has no overhead, however keep in mind that there is no hypervisor and just one kernel running that looks and behaves like many operating system instances to apps and users. While this imposes some limits to the technology (because there is just one kernel running you can't have zones with different kernels versions running ... obvious even to the cursory observer), but that is key to it's lightweightness and thus to the low overhead. Continue reading "Performance impact of Zones."

    Read the article

  • How to plan/manage multi-platform (mobile) products?

    - by PhD
    Say I've to develop an app that runs on iOS, Android and Windows 8 Mobile. Now all three platforms are technically in different program languages. The only 'reuse' that I can see is that of the boxes-and-lines drawings (UML :) charts and nothing else. So how do companies/programmers manage the variation of the same product across different platforms especially since the implementation languages differ? It's 'easier' in the desktop world IMO given the plethora of languages and cross-platform libraries to make your life easier. Not so in the mobile world. More so, product line management principles don't seem to be all that applicable - what is same and variant doesn't really matter - the application is the same (conceptually) and the implementation is variant. Some difficulties that come to mind: Bug Fixing: Applications maybe designed in a similar manner but the bug identification and fixing would be radically different. A bug on iOS may/may-not be existent for that on Android. Or a bug fix approach on one platform may not be the same on another (unless it's a semantic bug like a!=b instead of a==b which would require the same 'approach' to fixing in essence Enhancements: Making a change on one platform would be radically different than on another Code-Design Divergence: They way the code is written/organized, the class structures etc., could be very different given the different implementation environments - leading to further reuse of the (above) UML models. There are of course many others - just keeping the development in sync and making sure all applications are up to the same version with the same set of features etc. Seems the effort is 3x that of a single application. So how exactly does one manage this nightmarish situation? Some thoughts: Split application to client/server to minimize the effect to client side only (not always doable) Use frameworks like Unity-3D that could take care of the cross-platform problem (mostly applicable to games and probably not to other applications etc.) Any other ways of managing a platform line? What are some proven approaches to managing/taming the effects?

    Read the article

  • What is the simplest way to render video into memory (for drawing to a texture) in .NET?

    - by sebf
    In my project I would like to be able to play back video on surfaces in the world. I intend to do this by having the video frames rendered to a block of memory, then use this to update a texture each frame. Everything is in place - except for the part that actually gets the video. I have looked on Google and found that the video library world is very expansive (and geared towards video processing), and am having trouble finding a suitable one. FFMpeg is very comprehensive, but is an entire suite and would take a good amount of work to integrate. So far the most promising library I've found is the one based on the VLC player libraries - by virtue of it using the same resources as VLC Player it is known to be very capable; it also renders to blocks of memory, but the API (at least of the one on Codeplex) is more of a port of the C++ API rather than a managed wrapper. The 'solution' can be any wrapper/API/library, but with characteristics that make it suitable for use in a rendering engine, namely: Renders the video frame data to memory, so it can be picked up and passed to a texture on the GPU easily. Super simple - all that is needed is a way to load, jump and render a frame programatically - ideally it would use the systems codecs and not require an assortment of plugins. Permissive license (LGPL or more free-er) .NET bindings at least; all the better if it is natively managed Can anyone suggest a lightweight, (.NET) library, that can take a video file, and spit out some frames into a byte[]?

    Read the article

  • Why is Python used for high-performance/scientific computing (but Ruby isn't)?

    - by Cyclops
    There's a quote from a PyCon 2011 talk that goes: At least in our shop (Argonne National Laboratory) we have three accepted languages for scientific computing. In this order they are C/C++, Fortran in all its dialects, and Python. You’ll notice the absolute and total lack of Ruby, Perl, Java. It was in the more general context of high-performance computing. Granted the quote is only from one shop, but another question about languages for HPC, also lists Python as one to learn (and not Ruby). Now, I can understand C/C++ and Fortran being used in that problem-space (and Perl/Java not being used). But I'm surprised that there would be a major difference in Python and Ruby use for HPC, given that they are fairly similar. (Note - I'm a fan of Python, but have nothing against Ruby). Is there some specific reason why the one language took off? Is it about the libraries available? Some specific language features? The community? Or maybe just historical contigency, and it could have gone the other way?

    Read the article

  • Setting up a Google Analytics Campaign

    - by Ashfame
    I will be doing a bunch of things to give one of my projects (main app) a big initial push for which I will be building a few small Facebook apps which will help in promoting the main apps. Traffic from these apps need to be tracked individually. My main app will be posting on the walls when the user needs to be notified. Traffic from these posts need to be tracked. Traffic from emails sent by the main app need to be tracked, like different types of email. I need to track all of these & possibly a couple of more but I need to be sure that I build my campaign URLs correctly as I won't get another chance to fix it. Correct me where I am wrong: Campaign Name: Launch Campaign Medium: Email Campaign Source: Type1 or Type2 (I can break it down for different types of email, right?) For apps: Campaign Name: Launch Campaign Medium: Apps Campaign Source: App1 or App2 (I can break it down here for different apps, right?) What if I want to track two different links within a single email or a single app? Any way of tracking them individually too but still keeping to track them as one because tracking them as one makes more sense for me. Campaign Term & Campaign content is irrelevant in my case, or I can/should use them for something? And I will also be tracking traffic of different apps. Should I do more? Let me know if my scenario wasn't clear enough & I need to explain more.

    Read the article

  • Best way: restructure an existing Team Foundation Server (TFS) solution

    - by dhh
    In my department we are developing several smaller AddOns for some unified communication server. For versioning and distributed development we use a Team Foundation Server 2012. But: there is only one large TFS solution for all of our applications and libraries: Main Solution Applications App 1 App 2 App 3 Externals Libraries Lib 1 Lib 2 Tools The "Application" path contains all main applications. Those are not depending on each other, but they depend on the Libraries and Externals projects. The "Externals" path contains some external DLLs referenced in our Applications and Libraries. The Libraries path contains commonly used libs (UI templates, Helper classes, etc.). They do not depend on each other and they are referenced in the Libraries and the Tools projects. The Tools path contains some helper programs like setup helpers, update web services, etc. Now, there's some major points why I'd like to change this structure: We can't use server builds. It's uncomfortable to manage TFS scrum management with sprints, impediments, etc. with a solution structure like that. Every developer always has access to all projects in the solution. A complete build lasts too long if one accidentally hits [F6] in Visual Studio... What would you change in this solution? How would you break those projects into smaller Solutions, how should those solutions be structured. My first approach would be, to create one TFS project for each Application, Library and Tool. But how can I ensure that e.g. App 2 always contains the newest version of Lib 1? Do I have to monitor changes on Lib 1 and update App 2 manually as soon as the Lib changes? Or can I somehow force Visual Studio to always use the newest version of an external project somehow?

    Read the article

  • How do you make slides for programming talks?

    - by Yuvi Masory
    I've given a few talks recently and I have not found a good way to make slides. Here are a few desirable characteristics for programming slides: They're slides. A standard emacs buffer won't do it. They have syntax highlighting for code. They support basic formatting, like font size and color and bullets. No fancy animations needed. The only animation I desire is one-by-one appearance of bullets. So far I have considered: Microsoft Office - out of the question for Linux users. OpenOffice.org - too much for my needs, code formatting/highlighting needs to be done externally and pasted in. On the plus side supports bullets, bullet-by-bullet animation, and font formatting. Emacs - Supports all the code formatting but I haven't found a slides mode that lets me transition from one chunk to another. HTML5 - I once made slides using html5rocks as a template. It supports everything, but is too hard and time-consuming the "throw together" a few slides before a minor talk. Also the html5-only features may not work on the podium computer's installed browser. Any suggestions for programs/techniques for making code-centric presentations?

    Read the article

  • Help with design structure choice: Using classes or library of functions

    - by roverred
    So I have GUI Class that will call another class called ImageProcessor that contains a bunch functions that will perform image processing algorithms like edgeDetection, gaussianblur, contourfinding, contour map generations, etc. The GUI passes an image to ImageProcessor, which performs one of those algorithm on it and it returns the image back to the GUI to display. So essentially ImageProcessor is a library of independent image processing functions right now. It is called in the GUI like so Image image = ImageProcessor.EdgeDetection(oldImage); Some of the algorithms procedures require many functions, and some can be done in a single function or even one line. All these functions for the algorithms jam packed into ImageProcessor can be pretty messy, and ImageProcessor doesn't sound it should be a library. So I was thinking about making every algorithm be a class with a shared interface say IAlgorithm. Then I pass the IAlgorithm interface from the GUI to the ImageProcessor. public interface IAlgorithm{ public Image Process(); } public class ImageProcessor{ public Image Process(IAlgorithm TheAlgorithm){ return IAlgorithm.Process(); } } Calling in the GUI like so Image image = ImageProcessor.Process(new EdgeDetection(oldImage)); I think it makes sense in an object point of view, but the problem is I'll end up with some classes that are just one function. What do you think is a better design, or are they both crap and you have a much better idea? Thanks!

    Read the article

  • Integrating Amazon EC2 in Java via NetBeans IDE

    - by Geertjan
    Next, having looked at Amazon Associates services and Amazon S3, let's take a look at Amazon EC2, the elastic compute cloud which provides remote computing services. I started by launching an instance of Ubuntu Server 14.04 on Amazon EC2, which looks a bit like this in the on-line AWS Management Console, though I whitened out most of the details: Now that I have at least one running instance available on Amazon EC2, it makes sense to use the services that are integrated into NetBeans IDE:  I created a new application with one class, named "AmazonEC2Demo". Then I dragged the "describeInstances" service that you see above, with the mouse, into the class. Then the IDE automatically created all the other files you see below, i.e., 4 Java classes and one properties file: In the properties file, register the access ID and secret keys. These are read by the other generated Java classes. Signing and authentication are done automatically by the code that is generated, i.e., there's nothing generic you need to do and you can immediately begin working on your domain-specific code. Finally, you're now able to rewrite the code in "AmazonEC2Demo" to connect to Amazon EC2 and obtain information about your running instance: public class AmazonEC2Demo { public static void main(String[] args) { String instanceId1 = "i-something"; RestResponse result; try { result = AmazonEC2Service.describeInstances(instanceId1); System.out.println(result.getDataAsString()); } catch (IOException ex) { Logger.getLogger(AmazonEC2Demo.class.getName()).log(Level.SEVERE, null, ex); } } } From the above, you'll receive a chunk of XML with data about the running instance, it's name, status, dates, etc. In other words, you're now ready to integrate Amazon EC2 features directly into the applications you're writing, without very much work to get started. Within about 5 minutes, you're working on your business logic, rather than on the generic code that anyone needs when integrating with Amazon EC2.

    Read the article

  • JavaScript regular expression literal persists between function calls

    - by Charles Anderson
    I have this piece of code: function func1(text) { var pattern = /([\s\S]*?)(\<\?(?:attrib |if |else-if |else|end-if|search |for |end-for)[\s\S]*?\?\>)/g; var result; while (result = pattern.exec(text)) { if (some condition) { throw new Error('failed'); } ... } } This works, unless the throw statement is executed. In that case, the next time I call the function, the exec() call starts where it left off, even though I am supplying it with a new value of 'text'. I can fix it by writing var pattern = new RegExp('.....'); instead, but I don't understand why the first version is failing. How is the regular expression persisting between function calls? (This is happening in the latest versions of Firefox and Chrome.) Edit Complete test case: <!DOCTYPE HTML> <html> <head> <meta http-equiv="Content-type" content="text/html;charset=UTF-8"> <title>Test Page</title> <style type='text/css'> body { font-family: sans-serif; } #log p { margin: 0; padding: 0; } </style> <script type='text/javascript'> function func1(text, count) { var pattern = /(one|two|three|four|five|six|seven|eight)/g; log("func1"); var result; while (result = pattern.exec(text)) { log("result[0] = " + result[0] + ", pattern.index = " + pattern.index); if (--count <= 0) { throw "Error"; } } } function go() { try { func1("one two three four five six seven eight", 3); } catch (e) { } try { func1("one two three four five six seven eight", 2); } catch (e) { } try { func1("one two three four five six seven eight", 99); } catch (e) { } try { func1("one two three four five six seven eight", 2); } catch (e) { } } function log(msg) { var log = document.getElementById('log'); var p = document.createElement('p'); p.innerHTML = msg; log.appendChild(p); } </script> </head> <body><div> <input type='button' id='btnGo' value='Go' onclick='go();'> <hr> <div id='log'></div> </div></body> </html> The regular expression continues with 'four' as of the second call on FF and Chrome, not on IE7 or Opera.

    Read the article

  • What You Said: How Do You Browse Securely Away From Home?

    - by Jason Fitzpatrick
    Responses to this week’s Ask the Reader question show that just because you’re away from home doesn’t mean you have to give up the security and privacy that your home network provides. Earlier this week we asked you to share you browsing away from home security tips and tricks and obliged. JC offered one of the more entertaining tales of away-from-home browsing: Recently a bunch of us stayed at a high end resort down in Mexico. Internet was offered as a pay per device service at about $80/week/device. Considering we had about 12 wifi devices there among us(a few geeks), I decided to plan ahead. I setup a WRT54G as a WiFi client with a vpn back to my house and NAT. Setup a second one as a basic wireless access point with password and plugged it into the first. Onsite we setup the devices and connected to the wireless with one paid account(tied to the MAC address). Everyone connected to the other device for wireless access and it was all tunnelled through my home network with encryption. HTG Explains: Learn How Websites Are Tracking You Online Here’s How to Download Windows 8 Release Preview Right Now HTG Explains: Why Linux Doesn’t Need Defragmenting

    Read the article

  • How to control messages to the same port from different emitters?

    - by Alex In Paris
    Scene: A company has many factories X, each emits a message to the same receive port in a Biztalk server Y; if all messages are processed without much delay, each will trigger an outgoing message to another system Z. Problem: Sometimes a factory loses its connection for a half-day or more and, when the connection is reestablished, thousands of messages get emitted. Now, the messages still get processed well by Y (Biztalk can easily handle the load) but system Z can't handle the flood and may lock up and severely delay the processing of all other messages from the other X. What is the solution? Creating multiple receive locations that permits us to pause one X or another would lose us information if the factory isn't smart enough to know whether the message was received or not. What is the basic pattern to apply in Biztalk for this problem? Would some throttling parameters help to limit the flow from any one X? Or are their techniques on the end part of Y which I should use instead ? I would prefer this last one since I can be confident that the message box will remember any failures, which could then be resumed.

    Read the article

  • How to get "Fn" keys to work (Asus 4830T)? (specificly, the "suspend" key)

    - by Pointy
    I've got an Asus 4830T onto which I've just re-installed 12.04 because I installed an SSD. I was running 12.04 before too, which had been upgraded over a few releases. At some point on that old install, I had gotten all the "Fn" keys to work, or at least all the ones I cared about. (Oh except I think the screen brightness keys never worked.) I have no recollection of what I did. Anyway now things are fine, and some of the Fn keys work: the one to turn of the trackpad and the one to turn off wireless (grr I hate that one). However, the "suspend" key for some reason does not work. Now the system will suspend and resume just fine, but I'm having to do it from the menu. Is there an easy (or hard) way to make those work? I'm running straight Ubuntu but with Xfce installed as my normal desktop. (In other words, it's not Xubuntu, though I doubt it matters.) I recall at some point having found some arcane mapping mechanism to bind the Fn keys to actions, but I can't find it now. (I'm perfectly OK with editing weird files; I'm a long-time Unix user.) (Very long-time.)

    Read the article

  • How should I compress a file with multiple bytes that are the same with Huffman coding?

    - by Omega
    On my great quest for compressing/decompressing files with a Java implementation of Huffman coding (http://en.wikipedia.org/wiki/Huffman_coding) for a school assignment, I am now at the point of building a list of prefix codes. Such codes are used when decompressing a file. Basically, the code is made of zeroes and ones, that are used to follow a path in a Huffman tree (left or right) for, ultimately, finding a byte. In this Wikipedia image, to reach the character m the prefix code would be 0111 The idea is that when you compress the file, you will basically convert all the bytes of the file into prefix codes instead (they tend to be smaller than 8 bits, so there's some gain). So every time the character m appears in a file (which in binary is actually 1101101), it will be replaced by 0111 (if we used the tree above). Therefore, 1101101110110111011011101101 becomes 0111011101110111 in the compressed file. I'm okay with that. But what if the following happens: In the file to be compressed there exists only one unique byte, say 1101101. There are 1000 of such byte. Technically, the prefix code of such byte would be... none, because there is no path to follow, right? I mean, there is only one unique byte anyway, so the tree has just one node. Therefore, if the prefix code is none, I would not be able to write the prefix code in the compressed file, because, well, there is nothing to write. Which brings this problem: how would I compress/decompress such file if it is impossible to write a prefix code when compressing? (using Huffman coding, due to the school assignment's rules) This tutorial seems to explain a bit better about prefix codes: http://www.cprogramming.com/tutorial/computersciencetheory/huffman.html but doesn't seem to address this issue either.

    Read the article

< Previous Page | 446 447 448 449 450 451 452 453 454 455 456 457  | Next Page >