Search Results

Search found 68614 results on 2745 pages for 'full set arguments'.

Page 454/2745 | < Previous Page | 450 451 452 453 454 455 456 457 458 459 460 461  | Next Page >

  • VB.NET - using textfile as source for menus and textboxes

    - by Kenny Bones
    Hi, this is probably a bit tense and I'm not sure if this is possible at all. But basically, I'm trying to create a small application which contains alot of PowerShell-code which I want to run in an easy matter. I've managed to create everything myself and it does work. But all of the PowerShell code is manually hardcoded and this gives me a huge disadvantage. What I was thinking was creating some sort of dynamic structure where I can read a couple of text files (possible a numerous amount of text files) and use these as the source for both the comboboxes and the richtextbox which provovides as the string used to run in PowerShell. I was thinking something like this: Combobox - "Choose cmdlet" - Use "menucode.txt" as source Richtextbox - Use "code.txt" as source But, the thing is, Powershell snippets need a few arguments in order for them to work. So I've got a couple of comboboxes and a few textboxes which provides as input for these arguments. And this is done manually as it is right now. So rewriting this small application should also search the textfile for some keywords and have the comboboxes and textboxes to replace those keywords. And I'm not sure how to do this. So, would this requre a whole lot of textfiles? Or could I use one textfile and separate each PowerShell cmdlet snippets with something? Like some sort of a header? Right now, I've got this code at the eventhandler (ComboBox_SelectedIndexChanged) If ComboBoxFunksjon.Text = "Set attribute" Then TxtBoxUsername.Visible = True End If If chkBoxTextfile.Checked = True Then If txtboxBrowse.Text = "" Then MsgBox("You haven't choses a textfile as input for usernames") End If LabelAttribute.Visible = True LabelUsername.Visible = False ComboBoxAttribute.Visible = True TxtBoxUsername.Visible = False txtBoxCode.Text = "$users = Get-Content " & txtboxBrowse.Text & vbCrLf & "foreach ($a in $users)" & vbCrLf & "{" & vbCrLf & "Set-QADUser -Identity $a -ObjectAttributes @{" & ComboBoxAttribute.SelectedItem & "='" & TxtBoxValue.Text & "'}" & vbCrLf & "}" If ComboBoxAttribute.SelectedItem = "Outlook WebAccess" Then TxtBoxValue.Visible = False CheckBoxValue.Visible = True CheckBoxValue.Text = "OWA Enabled?" txtBoxCode.Text = "$users = Get-Content " & txtboxBrowse.Text & vbCrLf & "foreach ($a in $users)" & vbCrLf & "{" & vbCrLf & "Set-CASMailbox -Identity $a -OWAEnabled" & " " & "$" & CheckBoxValue.Checked & " '}" & vbCrLf & "}" End If If ComboBoxAttribute.SelectedItem = "MobileSync" Then TxtBoxValue.Visible = False CheckBoxValue.Visible = True CheckBoxValue.Text = "MobileSync Enabled?" Dim value If CheckBoxValue.Checked = True Then value = "0" Else value = "7" End If txtBoxCode.Text = "$users = Get-Content " & txtboxBrowse.Text & vbCrLf & "foreach ($a in $users)" & vbCrLf & "{" & vbCrLf & "Set-QADUser -Identity $a -ObjectAttributes @{msExchOmaAdminWirelessEnable='" & value & " '}" & vbCrLf & "}" End If Else LabelAttribute.Visible = True LabelUsername.Visible = True ComboBoxAttribute.Visible = True txtBoxCode.Text = "Set-QADUser -Identity " & TxtBoxUsername.Text & " -ObjectAttributes @{" & ComboBoxAttribute.SelectedItem & "='" & TxtBoxValue.Text & " '}" If ComboBoxAttribute.SelectedItem = "Outlook WebAccess" Then TxtBoxValue.Visible = False CheckBoxValue.Visible = True CheckBoxValue.Text = "OWA Enabled?" txtBoxCode.Text = "Set-CASMailbox " & TxtBoxUsername.Text & " -OWAEnabled " & "$" & CheckBoxValue.Checked End If If ComboBoxAttribute.SelectedItem = "MobileSync" Then TxtBoxValue.Visible = False CheckBoxValue.Visible = True CheckBoxValue.Text = "MobileSync Enabled?" Dim value If CheckBoxValue.Checked = True Then value = "0" Else value = "7" End If txtBoxCode.Text = "Set-QADUser " & TxtBoxUsername.Text & " -ObjectAttributes @{msExchOmaAdminWirelessEnable='" & value & "'}" End If End If Now, this snippet above lets me either use a text file as a source for each username used in the powershell snippet. Just so you know :) And I know, this is probably coded as stupidly as it gets. But it does work! :)

    Read the article

  • how get fully result from Asynchronism communication?

    - by rima
    Hi all refer to these post : here1 and here2 at last I solve my problem by build a asynchronous solution,and it work well!!! but there is a problem that i face with it,now my code is like this: class MyProcessStarter { private Process process; private StreamWriter myStreamWriter; private static StringBuilder shellOutput = null; public String GetShellOutput { get { return shellOutput.ToString(); }} public MyProcessStarter(){ shellOutput = new StringBuilder(""); process = new Process(); process.StartInfo.FileName = "sqlplus"; process.StartInfo.UseShellExecute = false; process.StartInfo.CreateNoWindow = true; process.OutputDataReceived += new DataReceivedEventHandler(ShellOutputHandler); process.StartInfo.RedirectStandardInput = true; process.StartInfo.RedirectStandardOutput = true; //process.StartInfo.RedirectStandardError = true; process.Start(); myStreamWriter = process.StandardInput; process.BeginOutputReadLine(); } private static void ShellOutputHandler(object sendingProcess,DataReceivedEventArgs outLine) { if (!String.IsNullOrEmpty(outLine.Data)) shellOutput.Append(Environment.NewLine + outLine.Data); } public void closeConnection() { myStreamWriter.Close(); process.WaitForExit(); process.Close(); } public void RunCommand(string arguments) { myStreamWriter.WriteLine(arguments); myStreamWriter.Flush(); process.WaitForExit(100); Console.WriteLine(shellOutput); Console.WriteLine("============="+Environment.NewLine); process.WaitForExit(2000); Console.WriteLine(shellOutput); } } and my input is like this: myProcesStarter.RunCommand("myusername/mypassword"); Console.writeline(myProcesStarter.GetShellOutput); but take a look at my out put: SQL*Plus: Release 11.1.0.6.0 - Production on Thu May 20 11:57:38 2010 Copyright (c) 1982, 2007, Oracle. All rights reserved. ============= SQL*Plus: Release 11.1.0.6.0 - Production on Thu May 20 11:57:38 2010 Copyright (c) 1982, 2007, Oracle. All rights reserved. Enter user-name: Connected to: Oracle Database 11g Enterprise Edition Release 11.1.0.6.0 - Production With the Partitioning, OLAP, Data Mining and Real Application Testing options as u see the output for run a function is not same in different time!So now would you do me a faver and help me that how I can wait until all the output done in other mean how I can customize my process to wait until output finishing ?? because I want to write a sqlcompiler so I need the exact output of shell. plz help me soon.thanxxxxxxxxxxxx :X

    Read the article

  • JQuery UI popup elements not positioning correctly

    - by Okku
    I am using both JQuery UI Dialog and JQuery UI autocomplete both have the same erroneous behavior when they popup, the position is always 0,0! I have tried some different position arguments when popping up the dialog but non seems to help. Any clues? Is this a bug in the position calculation in JQuery? Or is this some css bug? Versions are 1.4.2 and 1.8.0

    Read the article

  • Passing BLOB/CLOB as parameter to PL/SQL function

    - by Ula Krukar
    I have this procedure i my package: PROCEDURE pr_export_blob( p_name IN VARCHAR2, p_blob IN BLOB, p_part_size IN NUMBER); I would like for parameter p_blob to be either BLOB or CLOB. When I call this procedure with BLOB parameter, everything is fine. When I call it with CLOB parameter, I get compilation error: PLS-00306: wrong number or types of arguments in call to 'pr_export_blob' Is there a way to write a procedure, that can take either of those types as parameter? Some kind of a superclass maybe?

    Read the article

  • Running Java CORBA Client on Unix

    - by Benny
    I'm trying to run a Java application I wrote to subscribe to a CORBA event service. It runs OK on my Windows machine, but as soon as I deploy it to the UNIX server, it gives me an org.omg.CORBA.NO_IMPLEMENT exception. Any ideas as to why this might be happening? I'm using JacORB on my Windows machine and passing VM arguments to initialize the client ORB, but I'm not sure how to do that on UNIX and if it's even necessary. Thanks in advance!

    Read the article

  • How to compare a memory bits in C++?

    - by Trunet
    Hi, I need help with a memory bit comparison function. I bought a LED Matrix here with 4 x HT1632C chips and I'm using it on my arduino mega2560. There're no code available for this chipset(it's not the same as HT1632) and I'm writing on my own. I have a plot function that get x,y coordinates and a color and that pixel turn on. Only this is working perfectly. But I need more performance on my display so I tried to make a shadowRam variable that is a "copy" of my device memory. Before I plot anything on display it checks on shadowRam to see if it's really necessary to change that pixel. When I enabled this(getShadowRam) on plot function my display has some, just SOME(like 3 or 4 on entire display) ghost pixels(pixels that is not supposed to be turned on). If I just comment the prev_color if's on my plot function it works perfectly. Also, I'm cleaning my shadowRam array setting all matrix to zero. variables: #define BLACK 0 #define GREEN 1 #define RED 2 #define ORANGE 3 #define CHIP_MAX 8 byte shadowRam[63][CHIP_MAX-1] = {0}; getShadowRam function: byte HT1632C::getShadowRam(byte x, byte y) { byte addr, bitval, nChip; if (x>=32) { nChip = 3 + x/16 + (y>7?2:0); } else { nChip = 1 + x/16 + (y>7?2:0); } bitval = 8>>(y&3); x = x % 16; y = y % 8; addr = (x<<1) + (y>>2); if ((shadowRam[addr][nChip-1] & bitval) && (shadowRam[addr+32][nChip-1] & bitval)) { return ORANGE; } else if (shadowRam[addr][nChip-1] & bitval) { return GREEN; } else if (shadowRam[addr+32][nChip-1] & bitval) { return RED; } else { return BLACK; } } plot function: void HT1632C::plot (int x, int y, int color) { if (x<0 || x>X_MAX || y<0 || y>Y_MAX) return; if (color != BLACK && color != GREEN && color != RED && color != ORANGE) return; char addr, bitval; byte nChip; byte prev_color = HT1632C::getShadowRam(x,y); bitval = 8>>(y&3); if (x>=32) { nChip = 3 + x/16 + (y>7?2:0); } else { nChip = 1 + x/16 + (y>7?2:0); } x = x % 16; y = y % 8; addr = (x<<1) + (y>>2); switch(color) { case BLACK: if (prev_color != BLACK) { // compare with memory to only set if pixel is other color // clear the bit in both planes; shadowRam[addr][nChip-1] &= ~bitval; HT1632C::sendData(nChip, addr, shadowRam[addr][nChip-1]); shadowRam[addr+32][nChip-1] &= ~bitval; HT1632C::sendData(nChip, addr+32, shadowRam[addr+32][nChip-1]); } break; case GREEN: if (prev_color != GREEN) { // compare with memory to only set if pixel is other color // set the bit in the green plane and clear the bit in the red plane; shadowRam[addr][nChip-1] |= bitval; HT1632C::sendData(nChip, addr, shadowRam[addr][nChip-1]); shadowRam[addr+32][nChip-1] &= ~bitval; HT1632C::sendData(nChip, addr+32, shadowRam[addr+32][nChip-1]); } break; case RED: if (prev_color != RED) { // compare with memory to only set if pixel is other color // clear the bit in green plane and set the bit in the red plane; shadowRam[addr][nChip-1] &= ~bitval; HT1632C::sendData(nChip, addr, shadowRam[addr][nChip-1]); shadowRam[addr+32][nChip-1] |= bitval; HT1632C::sendData(nChip, addr+32, shadowRam[addr+32][nChip-1]); } break; case ORANGE: if (prev_color != ORANGE) { // compare with memory to only set if pixel is other color // set the bit in both the green and red planes; shadowRam[addr][nChip-1] |= bitval; HT1632C::sendData(nChip, addr, shadowRam[addr][nChip-1]); shadowRam[addr+32][nChip-1] |= bitval; HT1632C::sendData(nChip, addr+32, shadowRam[addr+32][nChip-1]); } break; } } If helps: The datasheet of board I'm using. On page 7 has the memory mapping I'm using. Also, I have a video of display working.

    Read the article

  • Good policy to force all developers in a company to use the same IDE?

    - by Henrik
    In my organization they are thinking about rolling out Eclipse company wide but I prefer using another editor (UltraEdit). I do not have any good arguments against this except subjective opinions that a developer should get to use whatever he/she wants as long as he's productive enough. This to make the developer a happy employee :-) Do you guys think its a good policy to force all developers in the same company to use the same IDE? Would there be any technical (dis)advantages of this decision?

    Read the article

  • Simulating "focus" and "blur" in jQuery .live() method...

    - by Jonathan Sampson
    Update: As of jQuery 1.4, $.live() now supports focusin and focusout events. jQuery currently1 doesn't support "blur" or "focus" as arguments for the $.live() method. What type of work-around could I implement to achieve the following: $("textarea") .live("focus", function() { foo = "bar"; }) .live("blur", function() { foo = "fizz"; }); 1. 07/29/2009, version 1.3.2

    Read the article

  • How can I implement NotOfType<T> in LINQ that has a nice calling syntax?

    - by Lette
    I'm trying to come up with an implementation for NotOfType, which has a readable call syntax. NotOfType should be the complement to OfType<T> and would consequently yield all elements that are not of type T My goal was to implement a method which would be called just like OfType<T>, like in the last line of this snippet: public abstract class Animal {} public class Monkey : Animal {} public class Giraffe : Animal {} public class Lion : Animal {} var monkey = new Monkey(); var giraffe = new Giraffe(); var lion = new Lion(); IEnumerable<Animal> animals = new Animal[] { monkey, giraffe, lion }; IEnumerable<Animal> fewerAnimals = animals.NotOfType<Giraffe>(); However, I can not come up with an implementation that supports that specific calling syntax. This is what I've tried so far: public static class EnumerableExtensions { public static IEnumerable<T> NotOfType<T>(this IEnumerable<T> sequence, Type type) { return sequence.Where(x => x.GetType() != type); } public static IEnumerable<T> NotOfType<T, TExclude>(this IEnumerable<T> sequence) { return sequence.Where(x => !(x is TExclude)); } } Calling these methods would look like this: // Animal is inferred IEnumerable<Animal> fewerAnimals = animals.NotOfType(typeof(Giraffe)); and // Not all types could be inferred, so I have to state all types explicitly IEnumerable<Animal> fewerAnimals = animals.NotOfType<Animal, Giraffe>(); I think that there are major drawbacks with the style of both of these calls. The first one suffers from a redundant "of type/type of" construct, and the second one just doesn't make sense (do I want a list of animals that are neither Animals nor Giraffes?). So, is there a way to accomplish what I want? If not, could it be possible in future versions of the language? (I'm thinking that maybe one day we will have named type arguments, or that we only need to explicitly supply type arguments that can't be inferred?) Or am I just being silly?

    Read the article

  • Find the version of an installed npm package

    - by Laurent Couvidou
    How to find the local version of an installed node.js/npm package? This prints the version of npm itself: npm -v <package-name> This prints a cryptic error: npm version <package-name> For some reason, probably because of the weird arguments ordering, or because of the false positives mentioned above, I just can't remember the proper command. So this question is a note for self that might help others.

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • Filling an Area in .NET

    - by lajoo
    I'm drawing a circle in C# and i have divided it into some parts,i want to fill different parts with different colors,is there anyway to do this? and how?i tried using fillpie() but i couldn't get the arguments to work.

    Read the article

  • Are GUID primary keys bad in theory, or just practice?

    - by Yarin
    Whenever I design a database I automatically start with an auto-generating GUID primary key for each of my tables (excepting look-up tables) I know I'll never lose sleep over duplicate keys, merging tables, etc. To me it just makes sense philosophically that any given record should be unique across all domains, and that that uniqueness should be represented in a consistent way from table to table. I realize it will never be the most performant option, but putting performance aside, I'd like to know if there are philosophical arguments against this practice?

    Read the article

  • Usable mainmenu when sheet is shown

    - by neoneye
    How does one react to menuitems that are clicked via mouse or invoked via keyboard, e.g: CMD+Q ? [NSApp beginSheet:my_sheet ...arguments... ]; /* The sheet is now shown and the mainmenu isn't usable. How does one make it usable? */ [NSApp endSheet:my_sheet returnCode:0];

    Read the article

  • What are the reasons *not* to use a GUID for a primary key?

    - by Yarin
    Whenever I design a database I automatically start with an auto-generating GUID primary key for each of my tables (excepting look-up tables) I know I'll never lose sleep over duplicate keys, merging tables, etc. To me it just makes sense philosophically that any given record should be unique across all domains, and that that uniqueness should be represented in a consistent way from table to table. I realize it will never be the most performant option, but putting performance aside, I'd like to know if there are philosophical arguments against this practice?

    Read the article

  • Can this jQuery/Javascript functionality be replicated with PHP

    - by benhowdle89
    This is the code to grab tweets, but i need this in PHP, can anybody offer any insight? $(document).ready( function() { var url = "http://twitter.com/status/user_timeline/joebloggs.json?count=1&callback=?"; $.getJSON(url, function(data){ $.each(data, function(i, item) { $("#twitter-posts").append("<p>" + item.text.linkify() + " <span class='created_at'>" + relative_time(item.created_at) + " via " + item.source + "</span></p>"); }); }); }); String.prototype.linkify = function() { return this.replace(/[A-Za-z]+:\/\/[A-Za-z0-9-_]+\.[A-Za-z0-9-_:%&\?\/.=]+/, function(m) { return m.link(m); }); }; function relative_time(time_value) { var values = time_value.split(" "); time_value = values[1] + " " + values[2] + ", " + values[5] + " " + values[3]; var parsed_date = Date.parse(time_value); var relative_to = (arguments.length > 1) ? arguments[1] : new Date(); var delta = parseInt((relative_to.getTime() - parsed_date) / 1000); delta = delta + (relative_to.getTimezoneOffset() * 60); var r = ''; if (delta < 60) { r = 'a minute ago'; } else if(delta < 120) { r = 'couple of minutes ago'; } else if(delta < (45*60)) { r = (parseInt(delta / 60)).toString() + ' minutes ago'; } else if(delta < (90*60)) { r = 'an hour ago'; } else if(delta < (24*60*60)) { r = '' + (parseInt(delta / 3600)).toString() + ' hours ago'; } else if(delta < (48*60*60)) { r = '1 day ago'; } else { r = (parseInt(delta / 86400)).toString() + ' days ago'; } return r; } function twitter_callback () { return true; }

    Read the article

< Previous Page | 450 451 452 453 454 455 456 457 458 459 460 461  | Next Page >