Search Results

Search found 51790 results on 2072 pages for 'long running'.

Page 454/2072 | < Previous Page | 450 451 452 453 454 455 456 457 458 459 460 461  | Next Page >

• JBoss as a windows service. Where can i set the JAVA_OPTS?

  - by ikky

  hi. I'm running JBoss as a windows service, but i can't seem to find where i can configure the JAVA_OPTS to make it work properly. I need to set the Xms and the Xmx. I have tried to just run JBoss manually (run.bat) and in the same file i set the JAVA_OPTS= -Xms128m -Xmx512m. And that works. Here is my install.bat where i install the JBoss as a service: set JBOSS_CLASS_PATH=%JAVA_HOME%\lib\tools.jar;%JBOSS_HOME%\bin\run.jar rem copy /Y JavaService.exe D:\PROJECT\bin\JBossService.exe JBossService.exe -install JBoss %JAVA_HOME%\jre\bin\server\jvm.dll -Djava.class.path=%JBOSS_CLASS_PATH% -start org.jboss.Main -stop org.jboss.Shutdown -method systemExit -out %PROJECT_HOME%\log\JBoss_out.log -err %PROJECT_HOME%\log\JBoss_err.log -current D:\PROJECT\bin net start JBoss When i look at the info about JBoss Application Server (http://localhost:8080/web-console/) i see this info: JVM Environment Free Memory: 9 MB Max Memory: 63 MB Total Memory: 63 MB And i MUST have more Max Memory. Does anybody know where i can set the JAVA_OPTS when running JBoss as a service?

  Read the article

• Testing the program in different OS

  - by Alex Farber

  I want to test my program by installing it in different OS versions. My development computer is Ubuntu. What other Linux versions can I test by installing them inside VirtualBox and running my program there? Though it is not critical for me right now, I want to try something different and see what happens. Also, what is the chance that the program running in Linux will work in the Unix OS? The program is not open source, I can distribute only pre-built binaries.

  Read the article

• Maven: Multiple class with the same path implemented in different jar

  - by Phuong Nguyen de ManCity fan

  I'm running into trouble with having multiple class with the same path (i.e. same name, same package!!!). For some reason, gwt-dev comes with its own version of org.apache.xerces.jaxp.DocumentBuilderFactoryImpl and javax.xml.parsers.DocumentBuilderFactory. At the same time, spring also depends on these classes but from different jar. I don't know what should be, but look like xalan & xml-api are the two dependencies that spring depends on (these dependency are optional) Funny thing is that eclipse can run the same code (it's a unit test) without problem, but surefire cannot. So I guess the problem is due to the way each runner consider the priority of each jar. Now come to the question: How can I setup my POM so that I can sure that when ever any code running inside my app, then class from a jar will be selected over class from other jar? Thanks.

  Read the article

• Facing error in apple multitasking code

  - by user366584

  Actually I am working for multitasking and facing error please assist me, as I need to work on background application and also in foreground application - (void)applicationDidEnterBackground:(UIApplication *)application { UIApplication* app = [UIApplication sharedApplication]; // Request permission to run in the background. Provide an // expiration handler in case the task runs long. NSAssert(bgTask == UIBackgroundTaskInvalid, nil); bgTask = [app beginBackgroundTaskWithExpirationHandler:^{ // Synchronize the cleanup call on the main thread in case // the task actually finishes at around the same time. dispatch_async(dispatch_get_main_queue(), ^{ if (bgTask != UIBackgroundTaskInvalid) { [app endBackgroundTask:bgTask]; bgTask = UIBackgroundTaskInvalid; } }); }]; // Start the long-running task and return immediately. dispatch_async(dispatch_get_global_queue(DISPATCH_QUEUE_PRIORITY_DEFAULT, 0), ^{ // Do the work associated with the task. // Synchronize the cleanup call on the main thread in case // the expiration handler is fired at the same time. dispatch_async(dispatch_get_main_queue(), ^{ if (bgTask != UIBackgroundTaskInvalid) { [app endBackgroundTask:bgTask]; bgTask = UIBackgroundTaskInvalid; } }); }); }

  Read the article

• Drupal: I cannot connect to the database.. please help

  - by Patrick

  hi, I've hard time to make Drupal work on IIS Microsoft server. I've succesfully run Joomla on the same server so I'm pretty sure the following information are correct: host: localhost user: user pass: pass databaseName = servername_databasename I've set the following line in settings.php file: $db_url = 'mysql://user:password@localhost/servername_databasename'; but what I get is this: If you are the maintainer of this site, please check your database settings in the settings.php file and ensure that your hosting provider's database server is running. For more help, see the handbook, or contact your hosting provider. I don't get any other error message such as: database doesn't exist, user/pass wrong.. just this. The database is running, I can access with phpmyadmin. I've tried both "mysql" and "mysqli". The host is a private server (IIS Microsoft), the database is Mysql The database and website files upload have also been succesfull.. so I dunno what to do to fix this issue. thanks

  Read the article

• Symfony2 and RabbitMqBundle. Can`t publish a message

  - by Gabriel Filipiak

  I am trying to use syfmony2 framework with RabbitMqBundle from here: https://github.com/videlalvaro/RabbitMqBundle I am sure that my rabbitmq server is up and running and I am doing the configuration and publishers code accordingly to the docs delivered on github. Unfortunately I can`t add any message to the queue. I am sure that my rabbitmq server is up and running. I have queue named accordingly to the symfony configuration file. Have anyone got any clue what is wrong? Thanks in advance for any suggestions.

  Read the article

• Timeout with GAE Java

  - by user242153

  Hi, I am having some issues with an app I have deployed on GAE. Specifically, I am intermittently running into the DeadlineExceededException where the server is not responding within the 30 seconds required. What is odd is that the code is not overly complex, it should run in milliseconds. My guess is that the delay is in dealing with the persistence manager and accessing the datastore. 2 questions: 1) What is the best way to track where all of the CPU time on the server is being used up? Log files do not seem helpful and to make things more complicated the code runs very fast when I am running it locally 2) Any tips / best practices in dealing with the 30 second exception? What are the biggest drivers of this? Datastore? HTTP requests / responses? Thanks

  Read the article

• Why sockets does not die when server dies? Why socket dies when server is alive?

  - by Roman

  I try to play with sockets a bit. For that I wrote very simple "client" and "server" applications. Client: import java.net.*; public class client { public static void main(String[] args) throws Exception { InetAddress localhost = InetAddress.getLocalHost(); System.out.println("before"); Socket clientSideSocket = null; try { clientSideSocket = new Socket(localhost,12345,localhost,54321); } catch (ConnectException e) { System.out.println("Connection Refused"); } System.out.println("after"); if (clientSideSocket != null) { clientSideSocket.close(); } } } Server: import java.net.*; public class server { public static void main(String[] args) throws Exception { ServerSocket listener = new ServerSocket(12345); while (true) { Socket serverSideSocket = listener.accept(); System.out.println("A client-request is accepted."); } } } And I found a behavior that I cannot explain: I start a server, than I start a client. Connection is successfully established (client stops running and server is running). Then I close the server and start it again in a second. After that I start a client and it writes "Connection Refused". It seems to me that the server "remember" the old connection and does not want to open the second connection twice. But I do not understand how it is possible. Because I killed the previous server and started a new one! I do not start the server immediately after the previous one was killed (I wait like 20 seconds). In this case the server "forget" the socket from the previous server and accepts the request from the client. I start the server and then I start the client. Connection is established (server writes: "A client-request is accepted"). Then I wait a minute and start the client again. And server (which was running the whole time) accept the request again! Why? The server should not accept the request from the same client-IP and client-port but it does!

  Read the article

• Setting acquired location to a text view: How to maintain?

  - by Mark

  Hi, I have built an app for the Motorola Droid which should automatically update a server with the phone's location. After the user performs a particular task on the main activity screen, an alarm is set to update the user's location periodically, using a service. The alarm is explicitly stopped when the user completes another task. Thing is, I have set up a location manager within the main activity's onCreate() method which is supposed to place the first acquired lat/long into two textview fields. Even though the manifest is set up for acquiring coarse and fine coords and I'm using requestLocationUpdates (String provider, long minTime, float minDistance, LocationListener listener), with minTime and minDistance set to zero, I'm not seeing the coords coming up on the screen. With that, I'm not recording any locations on the server. When I seed the textviews with sample coords, they are being recorded fine on the server. I am not at a computer that can run the IDE, so don't currently have the code, but am desperate for some help on this. One other thing is that the main activity screen calls a photography app before the user manually clicks "send data". I'm suspicious that I may need to override the main activity's onResume() method to do this location acquisition. Please help, thanks. Mark.

  Read the article

• Asp.net mvc retriev images from db and display on Page

  - by Trey Carroll

  //Inherits="System.Web.Mvc.ViewPage<FilmFestWeb.Models.ListVideosViewModel>" <h2>ListVideos</h2> <% foreach(BusinessObjects.Video vid in Model.VideoList){%> <div class="videoBox"> <%= Html.Encode(vid.Name) %> <img src="<% vid.ThumbnailImage; %>" /> </div> <%} %> //ListVideosViewModel public class ListVideosViewModel { public IList<Video> VideoList { get; set; } } //Video public class Video { public long VideoId { get; set; } public long TeamId { get; set; } public string Name { get; set; } public string Tags { get; set; } public string TeamMembers { get; set; } public string TranscriptFileName { get; set; } public string VideoFileName { get; set; } public int TotalNumRatings { get; set; } public int CumulativeTotalScore { get; set; } public string VideoUri { get; set; } public Image ThumbnailImage { get; set; } } I am getting the "red x" that I usually associate with image file not found. I have verified that my database table shows <binary data> after the stored proc that uploads the image executes. Any insight or advice would be greatly appreciated.

  Read the article

• How accurately (in terms of time) does Windows play audio?

  - by MusiGenesis

  Let's say I play a stereo WAV file with 317,520,000 samples, which is theoretically 1 hour long. Assuming no interruptions of the playback, will the file finish playing in exactly one hour, or is there some occasional tiny variation in the playback speed such that it would be slightly more or slightly less (by some number of milliseconds) than one hour? I am trying to synchronize animation with audio, and I am using a System.Diagnostics.Stopwatch to keep the frames matching the audio. But if the playback speed of WAV audio in Windows can vary slightly over time, then the audio will drift out of sync with the Stopwatch-driven animation. Which leads to a second question: it appears that a Stopwatch - while highly granular and accurate for short durations - runs slightly fast. On my laptop, a Stopwatch run for exactly 24 hours (as measured by the computer's system time and a real stopwatch) shows an elapsed time of 24 hours plus about 5 seconds (not milliseconds). Is this a known problem with Stopwatch? (A related question would be "am I crazy?", but you can try it for yourself.) Given its usage as a diagnostics tool, I can see where a discrepancy like this would only show up when measuring long durations, for which most people would use something other than a Stopwatch. If I'm really lucky, then both Stopwatch and audio playback are driven by the same underlying mechanism, and thus will stay in sync with each other for days on end. Any chance this is true?

  Read the article

• DRb connecting to linux client from windows

  - by Christopher Dancy

  I have a few DRb services running on different windows machines and they can all connect and talk with each other just fine. When I put these DRb services on Linux machines and try to connect from windows nothing happens and I get a DRB:ConnError ... the service on Linux is never touched. So I did a netstat on the linux box and the service(port) were not listed anywhere even though the program is clearly running. Is there someting that I'm missing when talking to DRb services on Linux from a windows machine?

  Read the article

• Why can't untrusted code change the log level under Java Logging?

  - by cdmckay

  I'm have a Java app that also runs as an applet. The app also happens to use a library called BasicPlayer to play .ogg files. BasicPlayer has a built-in logger that uses Apache Logging Commons to create a logger for BasicPlayer.class using the built-in Java logger. The only way that I know about to turn off the BasicPlayer logging is to run this code: Logger.getLogger(BasicPlayer.class.getName()).setLevel(Level.OFF); This works fine when running as a regular app. However, when running as an applet, this code will throw a SecurityException because for some reason applets can't change the log level of non-anonymous loggers (see here for a sorta-explanation). Why would they do this? Who cares if an applet changes the log level?

  Read the article

• How to stop the execution of Java program from Command line?

  - by Aakash

  My main field is .Net but recently I have got something to do with Java. I have to create a shell utility in Java that could run in background reading few database records after specified duration and do further processing. It's a kind of scheduler. Now I have few concerns: How to make this work as a service. I want to execute it through a shell script and the utility should start running. Off course the control should get back to the calling script. Secondly, eventually i may want to stop this process from running. How to achieve this? I understand these are basic question but I really have no idea where to begin and what options are best for me. Any help / advise please?

  Read the article

• Latex - Apply an operation to every character in a string

  - by hroest

  Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

  Read the article

• Get CruiseControl to talk to github with the correct public key.

  - by Danny Lister

  Hi All, Has anybody installed git and ControlControl and got CruiseControl to pull from GitHub on a window 2003 server. I keep getting public key errors (access denied) - Which is good i suppose as that confirms git is talking to github. However what is not good is that I dont not know where to install the rsa keys so they will be picked up by the running process (git in the context of cc.net). Any help would save me a lot of hair! I have tried installing the keys into; c:\Program Files\Git.ssh Whereby running git bash and cd ~ take me to: c:\Program Files\Git Current error from CC.net is Error Message: ThoughtWorks.CruiseControl.Core.CruiseControlException: Source control operation failed: Permission denied (publickey). fatal: The remote end hung up unexpectedly . Process command: C:\Program Files\Git\bin\git.exe fetch origin Thanks in advance

  Read the article

• wsdl xml parsing , maxlength problem after encoding of text

  - by MichaelD

  We are working together with another firm. our application communicates with the other application through WCF on our side and a custom implemented java wsdl handler on the other side. They specify the wsdl format and one of the rules is that a specific string cannot contain more then 15 characters. (normally it's 60, but i take 15 for easy example reasons) When we try to send the following string to them we get an error that the string is too long according to the wsdl: "example & test" this is a string of 14 characters, so it should be allowed the microsoft wcf parser translates this to "example &amp; test" . This encoded string is 18 characters long. Now what is the standaard behavior to check a maxlength defined in a message? Is it the encoded message or the decoded message? I would think it's the decoded message , but i ain't sure. If it is the encoded message, how should we handle this so we would know how we have to split the string?

  Read the article

• Unit Testing Private Method in Resource Managing Class (C++)

  - by BillyONeal

  I previously asked this question under another name but deleted it because I didn't explain it very well. Let's say I have a class which manages a file. Let's say that this class treats the file as having a specific file format, and contains methods to perform operations on this file: class Foo { std::wstring fileName_; public: Foo(const std::wstring& fileName) : fileName_(fileName) { //Construct a Foo here. }; int getChecksum() { //Open the file and read some part of it //Long method to figure out what checksum it is. //Return the checksum. } }; Let's say I'd like to be able to unit test the part of this class that calculates the checksum. Unit testing the parts of the class that load in the file and such is impractical, because to test every part of the getChecksum() method I might need to construct 40 or 50 files! Now lets say I'd like to reuse the checksum method elsewhere in the class. I extract the method so that it now looks like this: class Foo { std::wstring fileName_; static int calculateChecksum(const std::vector<unsigned char> &fileBytes) { //Long method to figure out what checksum it is. } public: Foo(const std::wstring& fileName) : fileName_(fileName) { //Construct a Foo here. }; int getChecksum() { //Open the file and read some part of it return calculateChecksum( something ); } void modifyThisFileSomehow() { //Perform modification int newChecksum = calculateChecksum( something ); //Apply the newChecksum to the file } }; Now I'd like to unit test the calculateChecksum() method because it's easy to test and complicated, and I don't care about unit testing getChecksum() because it's simple and very difficult to test. But I can't test calculateChecksum() directly because it is private. Does anyone know of a solution to this problem?

  Read the article

• Higher speed options for executing very large (20 GB) .sql file in MySQL

  - by Jonogan

  My firm was delivered a 20+ GB .sql file in reponse to a request for data from the gov't. I don't have many options for getting the data in a different format, so I need options for how to import it in a reasonable amount of time. I'm running it on a high end server (Win 2008 64bit, MySQL 5.1) using Navicat's batch execution tool. It's been running for 14 hours and shows no signs of being near completion. Does anyone know of any higher speed options for such a transaction? Or is this what I should expect given the large file size? Thanks

  Read the article

• Is there a way to retrieve the Computer Name of a Xenapp client?

  - by mlusby

  What options exist for identifying the client name of a particular client from within the process running on Citrix Presentation 4.0, or Xenapp 5, and are there any important differences in retrieving this information in either scenario? Currently my software is a client that connects to a service on a server, and the primary means of identification are computer name and IP Address. When installed on a Citrix Presentation server, all running instances currently show the same Computer Name and IP Address, which are those of the server. My application is written in VB 6.0, however I am looking to implement the new feature in C# .NET. Any help or clarification on the question itself would be appreciated, as I am not experienced with developing for Citrix thin clients.

  Read the article

• How to use Java on Google App Engine without exceeding minute quotas?

  - by Geo

  A very simple java code inside a doGet() servlet is getting more than a second of cpu time on GAE. I have read some quota related documentation and apparently I am not doing anything wrong. //Request the user Agent info String userAgent = req.getHeader("User-Agent"); I wanted to know what was using the CPU the most, I use a google help recommendation. //The two lines below will get the CPU before requesting User-Agent Information QuotaService qs = QuotaServiceFactory.getQuotaService(); long start = qs.getCpuTimeInMegaCycles(); //Request the user Agent info String userAgent = req.getHeader("User-Agent"); //The three lines below will get the CPU after requesting User-Agent Information // and informed it to the application log. long end = qs.getCpuTimeInMegaCycles(); double cpuSeconds = qs.convertMegacyclesToCpuSeconds(end - start); log.warning("CPU Seconds on geting User Agent: " + cpuSeconds); The only thing that the code above tells me is that inspecting the header will use more than a second (1000ms) of cpu time, which for Google is a warning on the log panel. That seems to be a very simple request and still is using more than a second of cpu. What I am missing?

  Read the article

• Preferred Windows Java Development Environment

  - by JF

  I've been a Linux Java developer for years and have loved it. I just got a new laptop which is running Windows 7. I could wipe the drive and go back to my typical Linux dev setup: vim for editing, tabbed Bash windows running javac and java for smaller projects, ant for big projects That said, I'm really thinking it couldn't hurt to learn to develop in a new environment. So, with that in mind, are there any Windows-based Java devs out there? What setup do you like to use to get things done? It'd be interesting to hear both ways to emulate my Linux-based environment as well as completely different styles that I might benefit from trying.

  Read the article

• How can I get a rails server to use the same databse that cucumber uses during a test?

  - by James

  The cucumber test first makes an entry in the database and posts a form to a second server. This second server does some processing in background and then hits the first app (where the test is being run) with some data that the cucumber test needs to know about. I've tried running the main server via script/server and script/server -e test while the cucumber test is running, but I can't seem to force the server to use the same database that cucumber is using when it runs its step definitions. That is, when the second server pushes some data to a controller in the main server, the main server doesn't know about any entries that cucumber has made in the database. How can I get cucumber and the main server to use the same database?

  Read the article

• How to produce 64 bit masks?

  - by egiakoum1984

  Based on the following simple program the bitwise left shit operator works only for 32 bits. Is it true? #include <iostream> #include <stdlib.h> using namespace std; int main(void) { long long currentTrafficTypeValueDec; int input; cout << "Enter input:" << endl; cin >> input; currentTrafficTypeValueDec = 1 << (input - 1); cout << currentTrafficTypeValueDec << endl; cout << (1 << (input - 1)) << endl; return 0; } The output of the program: Enter input: 30 536870912 536870912 Enter input: 62 536870912 536870912 How could I produce 64-bit masks?

  Read the article

• How to store unlimited characters in Oracle 11g?

  - by vicky21

  We have a table in Oracle 11g with a varchar2 column. We use a proprietary programming language where this column is defined as string. Maximum we can store 2000 characters (4000 bytes) in this column. Now the requirement is such that the column needs to store more than 2000 characters (in fact unlimited characters). The DBAs don't like BLOB or LONG datatypes for maintenance reasons. The solution that I can think of is to remove this column from the original table and have a separate table for this column and then store each character in a row, in order to get unlimited characters. This tble will be joined with the original table for queries. Is there any better solution to this problem? UPDATE: The proprietary programming language allows to define variables of type string and blob, there is no option of CLOB. I understand the responses given, but I cannot take on the DBAs. I understand that deviating from BLOB or LONG will be developers' nightmare, but still cannot help it.

  Read the article

< Previous Page | 450 451 452 453 454 455 456 457 458 459 460 461  | Next Page >