Search Results

Search found 1232 results on 50 pages for 'len'.

Page 46/50 | < Previous Page | 42 43 44 45 46 47 48 49 50  | Next Page >

  • Function inserted not all records

    - by user1799459
    I wrote the following code by data transfer from Access to Firebird def FirebirdDatetime(dt): return '\'%s.%s.%s\'' % (str(dt.day).rjust(2,'0'), str(dt.month).rjust(2,'0'), str(dt.year).rjust(4,'0')) def SelectFromAccessTable(tablename): return 'select * from [' + tablename+']' def InsertToFirebirdTable(tablename, row): values='' i=0 for elem in row: i+=1 #print type(elem) if type(elem) == int: temp = str(elem) elif (type(elem) == str) or (type(elem)==unicode): temp = '\'%s\'' % (elem,) elif type(elem) == datetime.datetime: temp =FirebirdDatetime(elem) elif type(elem) == decimal.Decimal: temp = str(elem) elif elem==None: temp='null' if (i<len(row)): values+=temp+', ' else: values+=temp return 'insert into '+tablename+' values ('+values+')' def AccessToFirebird(accesstablename, firebirdtablename, accesscursor, firebirdcursor): SelectSql=SelectFromAccessTable(accesstablename) for row in accesscursor.execute(SelectSql): InsertSql=InsertToFirebirdTable(firebirdtablename, row) InsertSql=InsertSql print InsertSql firebirdcursor.execute(InsertSql) In the main module there is an AccessToFirebird function call conAcc = pyodbc.connect('DRIVER={Microsoft Access Driver (*.mdb, *.accdb)};DBQ=D:\ThirdTask\Northwind.accdb') SqlAccess=conAcc.cursor(); conn.begin() cur=conn.cursor() sql.AccessToFirebird('Customers', 'CLIENTS', SqlAccess, cur) conn.commit() conn.begin() cur=conn.cursor() sql.AccessToFirebird('??????????', 'EMPLOYEES', SqlAccess, cur) sql.AccessToFirebird('????', 'ROLES', SqlAccess, cur) sql.AccessToFirebird('???? ???????????', 'EMPLOYEES_ROLES', SqlAccess, cur) sql.AccessToFirebird('????????', 'DELIVERY', SqlAccess, cur) sql.AccessToFirebird('??????????', 'SUPPLIERS', SqlAccess, cur) sql.AccessToFirebird('????????? ?????? ???????', 'TAX_STATUS_OF_ORDERS', SqlAccess, cur) sql.AccessToFirebird('????????? ???????? ? ??????', 'STATE_ORDER_DETAILS', SqlAccess, cur) sql.AccessToFirebird('????????? ???????', 'CONDITION_OF_ORDERS', SqlAccess, cur) sql.AccessToFirebird('??????', 'ORDERS', SqlAccess, cur) sql.AccessToFirebird('?????', 'BILLS', SqlAccess, cur) sql.AccessToFirebird('????????? ?????? ?? ????????????', 'STATUS_PURCHASE_ORDER', SqlAccess, cur) sql.AccessToFirebird('?????? ?? ????????????', 'ORDERS_FOR_ACQUISITION', SqlAccess, cur) sql.AccessToFirebird('???????? ? ?????? ?? ????????????', 'INFORMPURCHASEORDER', SqlAccess, cur) sql.AccessToFirebird('??????', 'PRODUCTS', SqlAccess, cur) conn.commit() conAcc.commit() conn.close() conAcc.close() But as a result, not all records have been inserted into the table Products (Table Goods - Northwind database), for example, does not work request insert into PRODUCTS values ('4', 1, 'NWTB-1', '?????????? ???', null, 13.5000, 18.0000, 10, 40, '10 ??????? ?? 20 ?????????', '10 ??????? ?? 20 ?????????', 10, '???????', '') In ibexpert to this request message issued can't format message 13:587 -- message file C:\Windows\firebird.msg not found. conversion error from string "10 ?????????±???? ???? 20 ???°???µ?‚????????". Worked only requests insert into PRODUCTS values ('1', 82, 'NWTC-82', '???????', null, 2.0000, 4.0000, 20, 100, null, null, null, '????', '') insert into PRODUCTS values ('9', 83, 'NWTCS-83', '???????????? ?????', null, 0.5000, 1.8000, 30, 200, null, null, null, '????? ? ???????', '') insert into PRODUCTS values ('1', 97, 'NWTC-82', '???????', null, 3.0000, 5.0000, 50, 200, null, null, null, '????', '') insert into PRODUCTS values ('6', 98, 'NWTSO-98', '??????? ???', null, 1.0000, 1.8900, 100, 200, null, null, null, '????', '') insert into PRODUCTS values ('6', 99, 'NWTSO-99', '??????? ??????', null, 1.0000, 1.9500, 100, 200, null, null, null, '????', '') other records were not inserted.

    Read the article

  • Django, want to upload eather image (ImageField) or file (FileField)

    - by Serg
    I have a form in my html page, that prompts user to upload File or Image to the server. I want to be able to upload ether file or image. Let's say if user choose file, image should be null, and vice verso. Right now I can only upload both of them, without error. But If I choose to upload only one of them (let's say I choose image) I will get an error: "Key 'attachment' not found in <MultiValueDict: {u'image': [<InMemoryUploadedFile: police.jpg (image/jpeg)>]}>" models.py: #Description of the file class FileDescription(models.Model): TYPE_CHOICES = ( ('homework', 'Homework'), ('class', 'Class Papers'), ('random', 'Random Papers') ) subject = models.ForeignKey('Subjects', null=True, blank=True) subject_name = models.CharField(max_length=100, unique=False) category = models.CharField(max_length=100, unique=False, blank=True, null=True) file_type = models.CharField(max_length=100, choices=TYPE_CHOICES, unique=False) file_uploaded_by = models.CharField(max_length=100, unique=False) file_name = models.CharField(max_length=100, unique=False) file_description = models.TextField(unique=False, blank=True, null=True) file_creation_time = models.DateTimeField(editable=False) file_modified_time = models.DateTimeField() attachment = models.FileField(upload_to='files', blank=True, null=True, max_length=255) image = models.ImageField(upload_to='files', blank=True, null=True, max_length=255) def __unicode__(self): return u'%s' % (self.file_name) def get_fields(self): return [(field, field.value_to_string(self)) for field in FileDescription._meta.fields] def filename(self): return os.path.basename(self.image.name) def category_update(self): category = self.file_name return category def save(self, *args, **kwargs): if self.category is None: self.category = FileDescription.category_update(self) for field in self._meta.fields: if field.name == 'image' or field.name == 'attachment': field.upload_to = 'files/%s/%s/' % (self.file_uploaded_by, self.file_type) if not self.id: self.file_creation_time = datetime.now() self.file_modified_time = datetime.now() super(FileDescription, self).save(*args, **kwargs) forms.py class ContentForm(forms.ModelForm): file_name =forms.CharField(max_length=255, widget=forms.TextInput(attrs={'size':20})) file_description = forms.CharField(widget=forms.Textarea(attrs={'rows':4, 'cols':25})) class Meta: model = FileDescription exclude = ('subject', 'subject_name', 'file_uploaded_by', 'file_creation_time', 'file_modified_time', 'vote') def clean_file_name(self): name = self.cleaned_data['file_name'] # check the length of the file name if len(name) < 2: raise forms.ValidationError('File name is too short') # check if file with same name is already exists if FileDescription.objects.filter(file_name = name).exists(): raise forms.ValidationError('File with this name already exists') else: return name views.py if request.method == "POST": if "upload-b" in request.POST: form = ContentForm(request.POST, request.FILES, instance=subject_id) if form.is_valid(): # need to add some clean functions # handle_uploaded_file(request.FILES['attachment'], # request.user.username, # request.POST['file_type']) form.save() up_f = FileDescription.objects.get_or_create( subject=subject_id, subject_name=subject_name, category = request.POST['category'], file_type=request.POST['file_type'], file_uploaded_by = username, file_name=form.cleaned_data['file_name'], file_description=request.POST['file_description'], image = request.FILES['image'], attachment = request.FILES['attachment'], ) return HttpResponseRedirect(".")

    Read the article

  • str is not callable error in python .

    - by mekasperasky
    import sys import md5 from TOSSIM import * from RadioCountMsg import * t = Tossim([]) #The Tossim object is defined here m = t.mac()#The mac layer is defined here , in which the communication takes place r = t.radio()#The radio communication link object is defined here , as the communication needs Rf frequency to transfer t.addChannel("RadioCountToLedsC", sys.stdout)# The various channels through which communication will take place t.addChannel("LedsC", sys.stdout) #The no of nodes that would be required in the simulation has to be entered here print("enter the no of nodes you want ") n=input() for i in range(0, n): m = t.getNode(i) m.bootAtTime((31 + t.ticksPerSecond() / 10) * i + 1) #The booting time is defined so that the time at which the node would be booted is given f = open("topo.txt", "r") #The topography is defined in topo.txt so that the RF frequencies of the transmission between nodes are are set lines = f.readlines() for line in lines: s = line.split() if (len(s) > 0): if (s[0] == "gain"): r.add(int(s[1]), int(s[2]), float(s[3])) #The topogrography is added to the radio object noise = open("meyer-heavy.txt", "r") #The noise model is defined for the nodes lines = noise.readlines() for line in lines: str = line.strip() if (str != ""): val = int(str) for i in range(0, 4): t.getNode(i).addNoiseTraceReading(val) for i in range (0, n): t.getNode(i).createNoiseModel() #The noise model is created for each node for i in range(0,n): t.runNextEvent() fk=open("key.txt","w") for i in range(0,n): if i ==0 : key=raw_input() fk.write(key) ak=key key=md5.new() key.update(str(ak)) ak=key.digest() fk.write(ak) fk.close() fk=open("key.txt","w") plaint=open("pt.txt") for i in range(0,n): msg = RadioCountMsg() msg.set_counter(7) pkt = t.newPacket()#A packet is defined according to a certain format print("enter message to be transported") ms=raw_input()#The message to be transported is taken as input #The RC5 encryption has to be done here plaint.write(ms) pkt.setData(msg.data) pkt.setType(msg.get_amType()) pkt.setDestination(i+1)#The destination to which the packet will be sent is set print "Delivering " + " to" ,i+1 pkt.deliver(i+1, t.time() + 3) fk.close() print "the key to be displayed" ki=raw_input() fk=open("key.txt") for i in range(0,n): if i==ki: ms=fk.readline() for i in range(0,n): msg=RadioCountMsg() msg.set_counter(7) pkt=t.newPacket() msg.data=ms pkt.setData(msg.data) pkt.setType(msg.get_amType()) pkt.setDestination(i+1) pkt.deliver(i+1,t.time()+3) #The key has to be broadcasted here so that the decryption can take place for i in range(0, n): t.runNextEvent(); this code gives me error here key.update(str(ak)) . when i run a similar code on the python terminal there is no such error but this code pops up an error . why so?

    Read the article

  • LSP packet modify

    - by kellogs
    Hello, anybody care to share some insights on how to use LSP for packet modifying ? I am using the non IFS subtype and I can see how (pseudo?) packets first enter WSPRecv. But how do I modify them ? My inquiry is about one single HTTP response that causes WSPRecv to be called 3 times :((. I need to modify several parts of this response, but since it comes in 3 slices, it is pretty hard to modify it accordingly. And, maybe on other machines or under different conditions (such as high traffic) there would only be one sole WSPRecv call, or maybe 10 calls. What is the best way to work arround this (please no NDIS :D), and how to properly change the buffer (lpBuffers-buf) by increasing it ? int WSPAPI WSPRecv( SOCKET s, LPWSABUF lpBuffers, DWORD dwBufferCount, LPDWORD lpNumberOfBytesRecvd, LPDWORD lpFlags, LPWSAOVERLAPPED lpOverlapped, LPWSAOVERLAPPED_COMPLETION_ROUTINE lpCompletionRoutine, LPWSATHREADID lpThreadId, LPINT lpErrno ) { LPWSAOVERLAPPEDPLUS ProviderOverlapped = NULL; SOCK_INFO *SocketContext = NULL; int ret = SOCKET_ERROR; *lpErrno = NO_ERROR; // // Find our provider socket corresponding to this one // SocketContext = FindAndRefSocketContext(s, lpErrno); if ( NULL == SocketContext ) { dbgprint( "WSPRecv: FindAndRefSocketContext failed!" ); goto cleanup; } // // Check for overlapped I/O // if ( NULL != lpOverlapped ) { /*bla bla .. not interesting in my case*/ } else { ASSERT( SocketContext->Provider->NextProcTable.lpWSPRecv ); SetBlockingProvider(SocketContext->Provider); ret = SocketContext->Provider->NextProcTable.lpWSPRecv( SocketContext->ProviderSocket, lpBuffers, dwBufferCount, lpNumberOfBytesRecvd, lpFlags, lpOverlapped, lpCompletionRoutine, lpThreadId, lpErrno); SetBlockingProvider(NULL); //is this the place to modify packet length and contents ? if (strstr(lpBuffers->buf, "var mapObj = null;")) { int nLen = strlen(lpBuffers->buf) + 200; /*CHAR *szNewBuf = new CHAR[]; CHAR *pIndex; pIndex = strstr(lpBuffers->buf, "var mapObj = null;"); nLen = strlen(strncpy(szNewBuf, lpBuffers->buf, (pIndex - lpBuffers->buf) * sizeof (CHAR))); nLen = strlen(strncpy(szNewBuf + nLen * sizeof(CHAR), "var com = null;\r\n", 17 * sizeof(CHAR))); pIndex += 18 * sizeof(CHAR); nLen = strlen(strncpy(szNewBuf + nLen * sizeof(CHAR), pIndex, 1330 * sizeof (CHAR))); nLen = strlen(strncpy(szNewBuf + nLen * sizeof(CHAR), "if (com == null)\r\n" \ "com = new ActiveXObject(\"InterCommJS.Gateway\");\r\n" \ "com.lat = latitude;\r\n" \ "com.lon = longitude;\r\n}", 111 * sizeof (CHAR))); pIndex = strstr(szNewBuf, "Content-Length:"); pIndex += 16 * sizeof(CHAR); strncpy(pIndex, "1465", 4 * sizeof(CHAR)); lpBuffers->buf = szNewBuf; lpBuffers->len += 128;*/ } if ( SOCKET_ERROR != ret ) { SocketContext->BytesRecv += *lpNumberOfBytesRecvd; } } cleanup: if ( NULL != SocketContext ) DerefSocketContext( SocketContext, lpErrno ); return ret; } Thank you

    Read the article

  • Scipy Negative Distance? What?

    - by disappearedng
    I have a input file which are all floating point numbers to 4 decimal place. i.e. 13359 0.0000 0.0000 0.0001 0.0001 0.0002` 0.0003 0.0007 ... (the first is the id). My class uses the loadVectorsFromFile method which multiplies it by 10000 and then int() these numbers. On top of that, I also loop through each vector to ensure that there are no negative values inside. However, when I perform _hclustering, I am continually seeing the error, "Linkage Z contains negative values". I seriously think this is a bug because: I checked my values, the values are no where small enough or big enough to approach the limits of the floating point numbers and the formula that I used to derive the values in the file uses absolute value (my input is DEFINITELY right). Can someone enligten me as to why I am seeing this weird error? What is going on that is causing this negative distance error? ===== def loadVectorsFromFile(self, limit, loc, assertAllPositive=True, inflate=True): """Inflate to prevent "negative" distance, we use 4 decimal points, so *10000 """ vectors = {} self.winfo("Each vector is set to have %d limit in length" % limit) with open( loc ) as inf: for line in filter(None, inf.read().split('\n')): l = line.split('\t') if limit: scores = map(float, l[1:limit+1]) else: scores = map(float, l[1:]) if inflate: vectors[ l[0]] = map( lambda x: int(x*10000), scores) #int might save space else: vectors[ l[0]] = scores if assertAllPositive: #Assert that it has no negative value for dirID, l in vectors.iteritems(): if reduce(operator.or_, map( lambda x: x < 0, l)): self.werror( "Vector %s has negative values!" % dirID) return vectors def main( self, inputDir, outputDir, limit=0, inFname="data.vectors.all", mappingFname='all.id.features.group.intermediate'): """ Loads vector from a file and start clustering INPUT vectors is { featureID: tfidfVector (list), } """ IDFeatureDic = loadIdFeatureGroupDicFromIntermediate( pjoin(self.configDir, mappingFname)) if not os.path.exists(outputDir): os.makedirs(outputDir) vectors = self.loadVectorsFromFile( limit, pjoin( inputDir, inFname)) for threshold in map( lambda x:float(x)/30, range(20,30)): clusters = self._hclustering(threshold, vectors) if clusters: outputLoc = pjoin(outputDir, "threshold.%s.result" % str(threshold)) with open(outputLoc, 'w') as outf: for clusterNo, cluster in clusters.iteritems(): outf.write('%s\n' % str(clusterNo)) for featureID in cluster: feature, group = IDFeatureDic[featureID] outline = "%s\t%s\n" % (feature, group) outf.write(outline.encode('utf-8')) outf.write("\n") else: continue def _hclustering(self, threshold, vectors): """function which you should call to vary the threshold vectors: { featureID: [ tfidf scores, tfidf score, .. ] """ clusters = defaultdict(list) if len(vectors) > 1: try: results = hierarchy.fclusterdata( vectors.values(), threshold, metric='cosine') except ValueError, e: self.werror("_hclustering: %s" % str(e)) return False for i, featureID in enumerate( vectors.keys()):

    Read the article

  • PyOpenGL - passing transformation matrix into shader

    - by M-V
    I am having trouble passing projection and modelview matrices into the GLSL shader from my PyOpenGL code. My understanding is that OpenGL matrices are column major, but when I pass in projection and modelview matrices as shown, I don't see anything. I tried the transpose of the matrices, and it worked for the modelview matrix, but the projection matrix doesn't work either way. Here is the code: import OpenGL from OpenGL.GL import * from OpenGL.GL.shaders import * from OpenGL.GLU import * from OpenGL.GLUT import * from OpenGL.GLUT.freeglut import * from OpenGL.arrays import vbo import numpy, math, sys strVS = """ attribute vec3 aVert; uniform mat4 uMVMatrix; uniform mat4 uPMatrix; uniform vec4 uColor; varying vec4 vCol; void main() { // option #1 - fails gl_Position = uPMatrix * uMVMatrix * vec4(aVert, 1.0); // option #2 - works gl_Position = vec4(aVert, 1.0); // set color vCol = vec4(uColor.rgb, 1.0); } """ strFS = """ varying vec4 vCol; void main() { // use vertex color gl_FragColor = vCol; } """ # particle system class class Scene: # initialization def __init__(self): # create shader self.program = compileProgram(compileShader(strVS, GL_VERTEX_SHADER), compileShader(strFS, GL_FRAGMENT_SHADER)) glUseProgram(self.program) self.pMatrixUniform = glGetUniformLocation(self.program, 'uPMatrix') self.mvMatrixUniform = glGetUniformLocation(self.program, "uMVMatrix") self.colorU = glGetUniformLocation(self.program, "uColor") # attributes self.vertIndex = glGetAttribLocation(self.program, "aVert") # color self.col0 = [1.0, 1.0, 0.0, 1.0] # define quad vertices s = 0.2 quadV = [ -s, s, 0.0, -s, -s, 0.0, s, s, 0.0, s, s, 0.0, -s, -s, 0.0, s, -s, 0.0 ] # vertices self.vertexBuffer = glGenBuffers(1) glBindBuffer(GL_ARRAY_BUFFER, self.vertexBuffer) vertexData = numpy.array(quadV, numpy.float32) glBufferData(GL_ARRAY_BUFFER, 4*len(vertexData), vertexData, GL_STATIC_DRAW) # render def render(self, pMatrix, mvMatrix): # use shader glUseProgram(self.program) # set proj matrix glUniformMatrix4fv(self.pMatrixUniform, 1, GL_FALSE, pMatrix) # set modelview matrix glUniformMatrix4fv(self.mvMatrixUniform, 1, GL_FALSE, mvMatrix) # set color glUniform4fv(self.colorU, 1, self.col0) #enable arrays glEnableVertexAttribArray(self.vertIndex) # set buffers glBindBuffer(GL_ARRAY_BUFFER, self.vertexBuffer) glVertexAttribPointer(self.vertIndex, 3, GL_FLOAT, GL_FALSE, 0, None) # draw glDrawArrays(GL_TRIANGLES, 0, 6) # disable arrays glDisableVertexAttribArray(self.vertIndex) class Renderer: def __init__(self): pass def reshape(self, width, height): self.width = width self.height = height self.aspect = width/float(height) glViewport(0, 0, self.width, self.height) glEnable(GL_DEPTH_TEST) glDisable(GL_CULL_FACE) glClearColor(0.8, 0.8, 0.8,1.0) glutPostRedisplay() def keyPressed(self, *args): sys.exit() def draw(self): glClear(GL_COLOR_BUFFER_BIT | GL_DEPTH_BUFFER_BIT) # build projection matrix fov = math.radians(45.0) f = 1.0/math.tan(fov/2.0) zN, zF = (0.1, 100.0) a = self.aspect pMatrix = numpy.array([f/a, 0.0, 0.0, 0.0, 0.0, f, 0.0, 0.0, 0.0, 0.0, (zF+zN)/(zN-zF), -1.0, 0.0, 0.0, 2.0*zF*zN/(zN-zF), 0.0], numpy.float32) # modelview matrix mvMatrix = numpy.array([1.0, 0.0, 0.0, 0.0, 0.0, 1.0, 0.0, 0.0, 0.0, 0.0, 1.0, 0.0, 0.5, 0.0, -5.0, 1.0], numpy.float32) # render self.scene.render(pMatrix, mvMatrix) # swap buffers glutSwapBuffers() def run(self): glutInitDisplayMode(GLUT_RGBA) glutInitWindowSize(400, 400) self.window = glutCreateWindow("Minimal") glutReshapeFunc(self.reshape) glutDisplayFunc(self.draw) glutKeyboardFunc(self.keyPressed) # Checks for key strokes self.scene = Scene() glutMainLoop() glutInit(sys.argv) prog = Renderer() prog.run() When I use option #2 in the shader without either matrix, I get the following output: What am I doing wrong?

    Read the article

  • conversion of DNA to Protein - c structure issue

    - by sam
    I am working on conversion of DNA sequence to Protein sequence. I had completed all program only one error I found there is of structure. dna_codon is a structure and I am iterating over it.In first iteration it shows proper values of structure but from next iteration, it dont show the proper value stored in structure. Its a small error so do not think that I havnt done anything and downvote. I am stucked here because I am new in c for structures. CODE : #include <stdio.h> #include<string.h> void main() { int i, len; char short_codons[20]; char short_slc[1000]; char sequence[1000]; struct codons { char amino_acid[20], slc[20], dna_codon[40]; }; struct codons c1 [20]= { {"Isoleucine", "I", "ATT, ATC, ATA"}, {"Leucine", "L", "CTT, CTC, CTA, CTG, TTA, TTG"}, {"Valine", "V", "GTT, GTC, GTA, GTG"}, {"Phenylalanine", "F", "TTT, TTC"}, {"Methionine", "M", "ATG"}, {"Cysteine", "C", "TGT, TGC"}, {"Alanine", "A", "GCT, GCC, GCA, GCG"}, {"Proline", "P", "CCT, CCC, CCA,CCG "}, {"Threonine", "T", "ACT, ACC, ACA, ACG"}, {"Serine", "S", "TCT, TCC, TCA, TCG, AGT, AGC"}, {"Tyrosine", "Y", "TAT, TAC"}, {"Tryptophan", "W", "TGG"}, {"Glutamine", "Q", "CAA, CAG"}, {"Aspargine","N" "AAT, AAC"}, {"Histidine", "H", "CAT, CAC"}, {"Glutamic acid", "E", "GAA, GAG"}, {"Aspartic acid", "D", "GAT, GAC"}, {"Lysine", "K", "AAA, AAG"}, {"Arginine", "R", "CGT, CGC, CGA, CGG, AGA, AGG"}, {"Stop codons", "Stop", "AA, TAG, TGA"} }; int count = 0; printf("Enter the sequence: "); gets(sequence); char *input_string = sequence; char *tmp_str = input_string; int k; char *pch; while (*input_string != '\0') { char string_3l[4] = {'\0'}; strncpy(string_3l, input_string, 3); printf("\n-----------%s & %s----------", string_3l, tmp_str ); for(k=0;k<20;k++) { //printf("@REAL - %s", c1[0].dna_codon); printf("@ %s", c1[k].dna_codon); int x; x = c1[k].dna_codon; pch = strtok(x, ","); while (pch != NULL) { printf("\n%d : %s with %s", k, string_3l, pch); count=strcmp(string_3l, pch); if(count==0) { strcat(short_slc, c1[k].slc); printf("\n==>%s", short_slc); } pch = strtok (NULL, " ,.-"); } } input_string = input_string+3; } printf("\nProtien sequence is : %s\n", short_slc); } INPUT : TAGTAG OUTPUT : If you see output of printf("\n-----------%s & %s----------", string_3l, tmp_str ); in both iterations, we found that values defined in structure are reduced. I want to know why structure reduces it or its my mistake? because I am stucked here

    Read the article

  • Python read multiline JSON

    - by Paul W
    I have been trying to use JSON to store settings for a program. I can't seem to get Python 2.6 's JSON Decoder to decode multi-line JSON strings... Here is example input: .settings file: """ {\ 'user':'username',\ 'password':'passwd',\ }\ """ I have tried a couple other syntaxes for this file, which I will specify below (with the traceback they cause). My python code for reading the file in is import json settings_text = open(".settings", "r").read() settings = json.loads(settings_text) The Traceback for this is: Traceback (most recent call last): File "json_test.py", line 4, in <module> print json.loads(text) File "/System/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/json/__init__.py", line 307, in loads return _default_decoder.decode(s) File "/System/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/json/decoder.py", line 322, in decode raise ValueError(errmsg("Extra data", s, end, len(s))) ValueError: Extra data: line 1 column 2 - line 7 column 1 (char 2 - 41) I assume the "Extra data" is the triple-quote. Here are the other syntaxes I have tried for the .settings file, with their respective Tracebacks: "{\ 'user':'username',\ 'pass':'passwd'\ }" Traceback (most recent call last): File "json_test.py", line 4, in <module> print json.loads(text) File "/System/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/json/__init__.py", line 307, in loads return _default_decoder.decode(s) File "/System/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/json/decoder.py", line 319, in decode obj, end = self.raw_decode(s, idx=_w(s, 0).end()) File "/System/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/json/decoder.py", line 336, in raw_decode obj, end = self._scanner.iterscan(s, **kw).next() File "/System/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/json/scanner.py", line 55, in iterscan rval, next_pos = action(m, context) File "/System/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/json/decoder.py", line 155, in JSONString return scanstring(match.string, match.end(), encoding, strict) ValueError: Invalid \escape: line 1 column 2 (char 2) '{\ "user":"username",\ "pass":"passwd",\ }' Traceback (most recent call last): File "json_test.py", line 4, in <module> print json.loads(text) File "/System/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/json/__init__.py", line 307, in loads return _default_decoder.decode(s) File "/System/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/json/decoder.py", line 319, in decode obj, end = self.raw_decode(s, idx=_w(s, 0).end()) File "/System/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/json/decoder.py", line 338, in raw_decode raise ValueError("No JSON object could be decoded") ValueError: No JSON object could be decoded If I put the settings all on one line, it decodes fine.

    Read the article

  • ROW_NUMBER() VS. DISTINCT

    - by ramadan2050
    Dear All, I have a problem with ROW_NUMBER() , if i used it with DISTINCT in the following Query I have 2 scenarios: 1- run this query direct : give me for example 400 record as a result 2- uncomment a line which start with [--Uncomment1--] : give me 700 record as a result it duplicated some records not all the records what I want is to solve this problem or to find any way to show a row counter beside each row, to make a [where rownumber between 1 and 30] --Uncomment2-- if I put the whole query in a table, and then filter it , it is work but it still so slow waiting for any feedback and I will appreciate that Thanks in advance SELECT * FROM (SELECT Distinct CRSTask.ID AS TaskID, CRSTask.WFLTaskID, --Uncomment1-- ROW_NUMBER() OVER (ORDER By CRSTask.CreateDate asc ) AS RowNum , CRSTask.WFLStatus AS Task_WFLStatus, CRSTask.Name AS StepName, CRSTask.ModifiedDate AS Task_ModifyDate, CRSTask.SendingDate AS Task_SendingDate, CRSTask.ReceiveDate AS Task_ReceiveDate, CRSTask.CreateDate AS Task_CreateDate, CRS_Task_Recipient_Vw.Task_CurrentSenderName, CRS_Task_Recipient_Vw.Task_SenderName, CRS_INFO.ID AS CRS_ID, CRS_INFO.ReferenceNumber, CRS_INFO.CRSBeneficiaries, CRS_INFO.BarCodeNumber, ISNULL(dbo.CRS_FNC_GetTaskReceiver(CRSTask.ID), '') + ' ' + ISNULL (CRS_Organization.ArName, '') AS OrgName, CRS_Info.IncidentID, COALESCE(CRS_Subject.ArSubject, '??? ????') AS ArSubject, COALESCE(CRS_INFO.Subject, 'Blank Subject') AS CRS_Subject, CRS_INFO.Mode, CRS_Task_Recipient_Vw.ReceiverID, CRS_Task_Recipient_Vw.ReceiverType, CRS_Task_Recipient_Vw.CC, Temp_Portal_Users_View.ID AS CRS_LockedByID, Temp_Portal_Users_View.ArabicName AS CRS_LockedByName, CRSDraft.ID AS DraftID, CRSDraft.Type AS DraftType, CASE WHEN CRS_Folder = 1 THEN Task_SenderName WHEN CRS_Folder = 2 THEN Task_SenderName WHEN CRS_Folder = 3 THEN Task_CurrentSenderName END AS SenderName, CRS_Task_Folder_Vw.CRS_Folder, CRS_INFO.Status, CRS_INFO.CRS_Type, CRS_Type.arName AS CRS_Type_Name FROM CRS_Task_Folder_Vw LEFT OUTER JOIN CRSTask ON CRSTask.ID = CRS_Task_Folder_Vw.TaskID LEFT OUTER JOIN CRS_INFO ON CRS_INFO.ID = CRSTask.CRSID LEFT OUTER JOIN CRS_Subject ON COALESCE( SUBSTRING( CRS_INFO.Subject, CHARINDEX('_', CRS_INFO.Subject) + 1, LEN(CRS_INFO.Subject) ), 'Blank Subject' ) = CRS_Subject.ID LEFT OUTER JOIN CRSInfoAttribute ON CRS_INFO.ID = CRSInfoAttribute.ID LEFT OUTER JOIN CRS_Organization ON CRS_Organization.ID = CRSInfoAttribute.SourceID LEFT OUTER JOIN CRS_Type ON CRS_INFO.CRS_Type = CRS_Type.ID LEFT OUTER JOIN CRS_Way ON CRS_INFO.CRS_Send_Way = CRS_Way.ID LEFT OUTER JOIN CRS_Priority ON CRS_INFO.CRS_Priority_ID = CRS_Priority.ID LEFT OUTER JOIN CRS_SecurityLevel ON CRS_INFO.SecurityLevelID = CRS_SecurityLevel.ID LEFT OUTER JOIN Portal_Users_View ON Portal_Users_View.ID = CRS_INFO.CRS_Initiator LEFT OUTER JOIN AD_DOC_TBL ON CRS_INFO.DocumentID = AD_DOC_TBL.ID LEFT OUTER JOIN CRSTask AS Temp_CRSTask ON CRSTask.ParentTask = Temp_CRSTask.ID LEFT OUTER JOIN Portal_Users_View AS Temp_Portal_Users_View ON Temp_Portal_Users_View.ID = AD_DOC_TBL.Lock_User_ID LEFT OUTER JOIN Portal_Users_View AS Temp1_Portal_Users_View ON Temp1_Portal_Users_View.ID = CRS_INFO.ClosedBy LEFT OUTER JOIN CRSDraft ON CRSTask.ID = CRSDraft.TaskID LEFT OUTER JOIN CRS_Task_Recipient_Vw ON CRSTask.ID = CRS_Task_Recipient_Vw.TaskID --LEFT OUTER JOIN CRSTaskReceiverUsers ON CRSTask.ID = CRSTaskReceiverUsers.CRSTaskID AND CRS_Task_Recipient_Vw.ReceiverID = CRSTaskReceiverUsers.ReceiverID LEFT OUTER JOIN CRSTaskReceiverUserProfile ON CRSTask.ID = CRSTaskReceiverUserProfile.TaskID WHERE Crs_Info.SUBJECT <> 'Blank Subject' AND (CRS_INFO.Subject NOT LIKE '%null%') AND CRS_Info.IsDeleted <> 1 /* AND CRSTask.WFLStatus <> 6 AND CRSTask.WFLStatus <> 8 */ AND ( ( CRS_Task_Recipient_Vw.ReceiverID IN (1, 29) AND CRS_Task_Recipient_Vw.ReceiverType IN (1, 3, 4) ) ) AND 1 = 1 )Codes --Uncomment2-- WHERE Codes.RowNum BETWEEN 1 AND 30 ORDER BY Codes.Task_CreateDate ASC

    Read the article

  • ActiveMQ 5.2.0 + REST + HTTP POST = java.lang.OutOfMemoryError

    - by Bruce Loth
    First off, I am a newbie when it comes to JMS & ActiveMQ. I have been looking into a messaging solution to serve as middleware for a message producer that will insert XML messages into a queue via HTTP POST. The producer is an existing system written in C++ that cannot be modified (so Java and the C++ API are out). Using the "demo" examples and some trial and error, I have cobbled together a working example of what I want to do (on a windows box). The web.xml I configured in a test directory under "webapps" specifies that the HTTP POST messages received from the producer are to be handled by the MessageServlet. I added a line for the text app in "activemq.xml" ('ow' is the test app dir): I created a test script to "insert" messages into the queue which works well. The problem I am running into is that it as I continue to insert messages via REST/HTTP POST, the memory consumption and thread count used by ActiveMQ continues to rise (It happens when I have timely consumers as well as slow or non-existent consumers). When memory consumption gets around 250MB's and the thread count exceeds 5000 (as shown in windows task manager), ActiveMQ crashes and I see this in the log: Exception in thread "ActiveMQ Transport Initiator: vm://localhost#3564" java.lang.OutOfMemoryError: unable to create new native thread It is as if Jetty is spawning a new thread to handle each HTTP POST and the thread never dies. I did look at this page: http://activemq.apache.org/javalangoutofmemory.html and tried but that didn't fix the problem (although I didn't fully understand the implications of the change either). Does anyone have any ideas? Thanks! Bruce Loth PS - I included the "test message producer" python script below for what it is worth. I created batches of 100 messages and continued to run the script manually from the command line while watching the memory consumption and thread count of ActiveMQ in task manager. def foo(): import httplib, urllib body = "<?xml version='1.0' encoding='UTF-8'?>\n \ <ROOT>\n \ [snip: xml deleted to save space] </ROOT>" headers = {"content-type": "text/xml", "content-length": str(len(body))} conn = httplib.HTTPConnection("127.0.0.1:8161") conn.request("POST", "/ow/message/RDRCP_Inbox?type=queue", body, headers) response = conn.getresponse() print response.status, response.reason data = response.read() conn.close() ## end method definition ## Begin test code count = 0; while(count < 100): # Test with batches of 100 msgs count += 1 foo()

    Read the article

  • Python/Biophysics- Trying to code a simple stochastic simulation!

    - by user359597
    Hey guys- I'm trying to figure out what to make of the following code- this is not the clear, intuitive python I've been learning. Was it written in C or something then wrapped in a python fxn? The code I wrote (not shown) is using the same math, but I couldn't figure out how to write a conditional loop. If anyone could explain/decipher/clean this up, I'd be really appreciative. I mean- is this 'good' python- or does it look funky? I'm brand new to this- but it's like the order of the fxns is messed up? I understand Gillespie's- I've successfully coded several simpler simulations. So in a nutshell- good code-(pythonic)? order? c? improvements? am i being an idiot? The code shown is the 'answer,' to the following question from a biophysics text (petri-net not shown and honestly not necessary to understand problem): "In a programming language of your choice, implement Gillespie’s First Reaction Algorithm to study the temporal behaviour of the reaction A---B in which the transition from A to B can only take place if another compound, C, is present, and where C dynamically interconverts with D, as modelled in the Petri-net below. Assume that there are 100 molecules of A, 1 of C, and no B or D present at the start of the reaction. Set kAB to 0.1 s-1 and both kCD and kDC to 1.0 s-1. Simulate the behaviour of the system over 100 s." def sim(): # Set the rate constants for all transitions kAB = 0.1 kCD = 1.0 kDC = 1.0 # Set up the initial state A = 100 B = 0 C = 1 D = 0 # Set the start and end times t = 0.0 tEnd = 100.0 print "Time\t", "Transition\t", "A\t", "B\t", "C\t", "D" # Compute the first interval transition, interval = transitionData(A, B, C, D, kAB, kCD, kDC) # Loop until the end time is exceded or no transition can fire any more while t <= tEnd and transition >= 0: print t, '\t', transition, '\t', A, '\t', B, '\t', C, '\t', D t += interval if transition == 0: A -= 1 B += 1 if transition == 1: C -= 1 D += 1 if transition == 2: C += 1 D -= 1 transition, interval = transitionData(A, B, C, D, kAB, kCD, kDC) def transitionData(A, B, C, D, kAB, kCD, kDC): """ Returns nTransition, the number of the firing transition (0: A->B, 1: C->D, 2: D->C), and interval, the interval between the time of the previous transition and that of the current one. """ RAB = kAB * A * C RCD = kCD * C RDC = kDC * D dt = [-1.0, -1.0, -1.0] if RAB > 0.0: dt[0] = -math.log(1.0 - random.random())/RAB if RCD > 0.0: dt[1] = -math.log(1.0 - random.random())/RCD if RDC > 0.0: dt[2] = -math.log(1.0 - random.random())/RDC interval = 1e36 transition = -1 for n in range(len(dt)): if dt[n] > 0.0 and dt[n] < interval: interval = dt[n] transition = n return transition, interval if __name__ == '__main__': sim()

    Read the article

  • Accidental Complexity in OpenSSL HMAC functions

    - by Hassan Syed
    SSL Documentation Analaysis This question is pertaining the usage of the HMAC routines in OpenSSL. Since Openssl documentation is a tad on the weak side in certain areas, profiling has revealed that using the: unsigned char *HMAC(const EVP_MD *evp_md, const void *key, int key_len, const unsigned char *d, int n, unsigned char *md, unsigned int *md_len); From here, shows 40% of my library runtime is devoted to creating and taking down **HMAC_CTX's behind the scenes. There are also two additional function to create and destroy a HMAC_CTX explicetly: HMAC_CTX_init() initialises a HMAC_CTX before first use. It must be called. HMAC_CTX_cleanup() erases the key and other data from the HMAC_CTX and releases any associated resources. It must be called when an HMAC_CTX is no longer required. These two function calls are prefixed with: The following functions may be used if the message is not completely stored in memory My data fits entirely in memory, so I choose the HMAC function -- the one whose signature is shown above. The context, as described by the man page, is made use of by using the following two functions: HMAC_Update() can be called repeatedly with chunks of the message to be authenticated (len bytes at data). HMAC_Final() places the message authentication code in md, which must have space for the hash function output. The Scope of the Application My application generates a authentic (HMAC, which is also used a nonce), CBC-BF encrypted protocol buffer string. The code will be interfaced with various web-servers and frameworks Windows / Linux as OS, nginx, Apache and IIS as webservers and Python / .NET and C++ web-server filters. The description above should clarify that the library needs to be thread safe, and potentially have resumeable processing state -- i.e., lightweight threads sharing a OS thread (which might leave thread local memory out of the picture). The Question How do I get rid of the 40% overhead on each invocation in a (1) thread-safe / (2) resume-able state way ? (2) is optional since I have all of the source-data present in one go, and can make sure a digest is created in place without relinquishing control of the thread mid-digest-creation. So, (1) can probably be done using thread local memory -- but how do I resuse the CTX's ? does the HMAC_final() call make the CTX reusable ?. (2) optional: in this case I would have to create a pool of CTX's. (3) how does the HMAC function do this ? does it create a CTX in the scope of the function call and destroy it ? Psuedocode and commentary will be useful.

    Read the article

  • A python random function acts differently when assigned to a list or called directly...

    - by Dror Hilman
    I have a python function that randomize a dictionary representing a position specific scoring matrix. for example: mat = { 'A' : [ 0.53, 0.66, 0.67, 0.05, 0.01, 0.86, 0.03, 0.97, 0.33, 0.41, 0.26 ] 'C' : [ 0.14, 0.04, 0.13, 0.92, 0.99, 0.04, 0.94, 0.00, 0.07, 0.23, 0.35 ] 'T' : [ 0.25, 0.07, 0.01, 0.01, 0.00, 0.04, 0.00, 0.03, 0.06, 0.12, 0.14 ] 'G' : [ 0.08, 0.23, 0.20, 0.02, 0.00, 0.06, 0.04, 0.00, 0.54, 0.24, 0.25 ] } The scambling function: def scramble_matrix(matrix, iterations): mat_len = len(matrix["A"]) pos1 = pos2 = 0 for count in range(iterations): pos1,pos2 = random.sample(range(mat_len), 2) #suffle the matrix: for nuc in matrix.keys(): matrix[nuc][pos1],matrix[nuc][pos2] = matrix[nuc][pos2],matrix[nuc][pos1] return matrix def print_matrix(matrix): for nuc in matrix.keys(): print nuc+"[", for count in matrix[nuc]: print "%.2f"%count, print "]" now to the problem... When I try to scramble a matrix directly, It's works fine: print_matrix(mat) print "" print_matrix(scramble_matrix(mat,10)) gives: A[ 0.53 0.66 0.67 0.05 0.01 0.86 0.03 0.97 0.33 0.41 0.26 ] C[ 0.14 0.04 0.13 0.92 0.99 0.04 0.94 0.00 0.07 0.23 0.35 ] T[ 0.25 0.07 0.01 0.01 0.00 0.04 0.00 0.03 0.06 0.12 0.14 ] G[ 0.08 0.23 0.20 0.02 0.00 0.06 0.04 0.00 0.54 0.24 0.25 ] A[ 0.41 0.97 0.03 0.86 0.53 0.66 0.33.05 0.67 0.26 0.01 ] C[ 0.23 0.00 0.94 0.04 0.14 0.04 0.07 0.92 0.13 0.35 0.99 ] T[ 0.12 0.03 0.00 0.04 0.25 0.07 0.06 0.01 0.01 0.14 0.00 ] G[ 0.24 0.00 0.04 0.06 0.08 0.23 0.54 0.02 0.20 0.25 0.00 ] but when I try to assign this scrambling to a list , it does not work!!! ... print_matrix(mat) s=[] for x in range(3): s.append(scramble_matrix(mat,10)) for matrix in s: print "" print_matrix(matrix) result: A[ 0.53 0.66 0.67 0.05 0.01 0.86 0.03 0.97 0.33 0.41 0.26 ] C[ 0.14 0.04 0.13 0.92 0.99 0.04 0.94 0.00 0.07 0.23 0.35 ] T[ 0.25 0.07 0.01 0.01 0.00 0.04 0.00 0.03 0.06 0.12 0.14 ] G[ 0.08 0.23 0.20 0.02 0.00 0.06 0.04 0.00 0.54 0.24 0.25 ] A[ 0.01 0.66 0.97 0.67 0.03 0.05 0.33 0.53 0.26 0.41 0.86 ] C[ 0.99 0.04 0.00 0.13 0.94 0.92 0.07 0.14 0.35 0.23 0.04 ] T[ 0.00 0.07 0.03 0.01 0.00 0.01 0.06 0.25 0.14 0.12 0.04 ] G[ 0.00 0.23 0.00 0.20 0.04 0.02 0.54 0.08 0.25 0.24 0.06 ] A[ 0.01 0.66 0.97 0.67 0.03 0.05 0.33 0.53 0.26 0.41 0.86 ] C[ 0.99 0.04 0.00 0.13 0.94 0.92 0.07 0.14 0.35 0.23 0.04 ] T[ 0.00 0.07 0.03 0.01 0.00 0.01 0.06 0.25 0.14 0.12 0.04 ] G[ 0.00 0.23 0.00 0.20 0.04 0.02 0.54 0.08 0.25 0.24 0.06 ] A[ 0.01 0.66 0.97 0.67 0.03 0.05 0.33 0.53 0.26 0.41 0.86 ] C[ 0.99 0.04 0.00 0.13 0.94 0.92 0.07 0.14 0.35 0.23 0.04 ] T[ 0.00 0.07 0.03 0.01 0.00 0.01 0.06 0.25 0.14 0.12 0.04 ] G[ 0.00 0.23 0.00 0.20 0.04 0.02 0.54 0.08 0.25 0.24 0.06 ] What is the problem??? Why the scrambling do not work after the first time, and all the list filled with the same matrix?!

    Read the article

  • Optimizing tasks to reduce CPU in a trading application

    - by Joel
    Hello, I have designed a trading application that handles customers stocks investment portfolio. I am using two datastore kinds: Stocks - Contains unique stock name and its daily percent change. UserTransactions - Contains information regarding a specific purchase of a stock made by a user : the value of the purchase along with a reference to Stock for the current purchase. db.Model python modules: class Stocks (db.Model): stockname = db.StringProperty(multiline=True) dailyPercentChange=db.FloatProperty(default=1.0) class UserTransactions (db.Model): buyer = db.UserProperty() value=db.FloatProperty() stockref = db.ReferenceProperty(Stocks) Once an hour I need to update the database: update the daily percent change in Stocks and then update the value of all entities in UserTransactions that refer to that stock. The following python module iterates over all the stocks, update the dailyPercentChange property, and invoke a task to go over all UserTransactions entities which refer to the stock and update their value: Stocks.py # Iterate over all stocks in datastore for stock in Stocks.all(): # update daily percent change in datastore db.run_in_transaction(updateStockTxn, stock.key()) # create a task to update all user transactions entities referring to this stock taskqueue.add(url='/task', params={'stock_key': str(stock.key(), 'value' : self.request.get ('some_val_for_stock') }) def updateStockTxn(stock_key): #fetch the stock again - necessary to avoid concurrency updates stock = db.get(stock_key) stock.dailyPercentChange= data.get('some_val_for_stock') # I get this value from outside ... some more calculations here ... stock.put() Task.py (/task) # Amount of transaction per task amountPerCall=10 stock=db.get(self.request.get("stock_key")) # Get all user transactions which point to current stock user_transaction_query=stock.usertransactions_set cursor=self.request.get("cursor") if cursor: user_transaction_query.with_cursor(cursor) # Spawn another task if more than 10 transactions are in datastore transactions = user_transaction_query.fetch(amountPerCall) if len(transactions)==amountPerCall: taskqueue.add(url='/task', params={'stock_key': str(stock.key(), 'value' : self.request.get ('some_val_for_stock'), 'cursor': user_transaction_query.cursor() }) # Iterate over all transaction pointing to stock and update their value for transaction in transactions: db.run_in_transaction(updateUserTransactionTxn, transaction.key()) def updateUserTransactionTxn(transaction_key): #fetch the transaction again - necessary to avoid concurrency updates transaction = db.get(transaction_key) transaction.value= transaction.value* self.request.get ('some_val_for_stock') db.put(transaction) The problem: Currently the system works great, but the problem is that it is not scaling well… I have around 100 Stocks with 300 User Transactions, and I run the update every hour. In the dashboard, I see that the task.py takes around 65% of the CPU (Stock.py takes around 20%-30%) and I am using almost all of the 6.5 free CPU hours given to me by app engine. I have no problem to enable billing and pay for additional CPU, but the problem is the scaling of the system… Using 6.5 CPU hours for 100 stocks is very poor. I was wondering, given the requirements of the system as mentioned above, if there is a better and more efficient implementation (or just a small change that can help with the current implemntation) than the one presented here. Thanks!! Joel

    Read the article

  • Multiprogramming in Django, writing to the Database

    - by Marcus Whybrow
    Introduction I have the following code which checks to see if a similar model exists in the database, and if it does not it creates the new model: class BookProfile(): # ... def save(self, *args, **kwargs): uniqueConstraint = {'book_instance': self.book_instance, 'collection': self.collection} # Test for other objects with identical values profiles = BookProfile.objects.filter(Q(**uniqueConstraint) & ~Q(pk=self.pk)) # If none are found create the object, else fail. if len(profiles) == 0: super(BookProfile, self).save(*args, **kwargs) else: raise ValidationError('A Book Profile for that book instance in that collection already exists') I first build my constraints, then search for a model with those values which I am enforcing must be unique Q(**uniqueConstraint). In addition I ensure that if the save method is updating and not inserting, that we do not find this object when looking for other similar objects ~Q(pk=self.pk). I should mention that I ham implementing soft delete (with a modified objects manager which only shows non-deleted objects) which is why I must check for myself rather then relying on unique_together errors. Problem Right thats the introduction out of the way. My problem is that when multiple identical objects are saved in quick (or as near as simultaneous) succession, sometimes both get added even though the first being added should prevent the second. I have tested the code in the shell and it succeeds every time I run it. Thus my assumption is if say we have two objects being added Object A and Object B. Object A runs its check upon save() being called. Then the process saving Object B gets some time on the processor. Object B runs that same test, but Object A has not yet been added so Object B is added to the database. Then Object A regains control of the processor, and has allready run its test, even though identical Object B is in the database, it adds it regardless. My Thoughts The reason I fear multiprogramming could be involved is that each Object A and Object is being added through an API save view, so a request to the view is made for each save, thus not a single request with multiple sequential saves on objects. It might be the case that Apache is creating a process for each request, and thus causing the problems I think I am seeing. As you would expect, the problem only occurs sometimes, which is characteristic of multiprogramming or multiprocessing errors. If this is the case, is there a way to make the test and set parts of the save() method a critical section, so that a process switch cannot happen between the test and the set?

    Read the article

  • wxpython - Nested Notebooks

    - by madtowneast
    I have been trying to make my nested notebooks a little bit more appealing code wise. At the moment, I got this #!/usr/bin/env python import os import sys import datetime import numpy as np from readmonifile import MonitorFile from sortmonifile import sort import wx class NestedPanelOne(wx.Panel): #---------------------------------------------------------------------- # First notebook that creates the tab to select the component number #---------------------------------------------------------------------- def __init__(self, parent, label, data): wx.Panel.__init__(self, parent=parent, id=wx.ID_ANY) sizer = wx.BoxSizer(wx.VERTICAL) #Loop creating the tabs according to the component name nestedNotebook = wx.Notebook(self, wx.ID_ANY) for slabel in sorted(data[label].keys()): tab = NestedPanelTwo(nestedNotebook, label, slabel, data) nestedNotebook.AddPage(tab,slabel) sizer = wx.BoxSizer(wx.VERTICAL) sizer.Add(nestedNotebook, 1, wx.ALL|wx.EXPAND, 5) self.SetSizer(sizer) class NestedPanelTwo(wx.Panel): #------------------------------------------------------------------------------ # Second notebook that creates the tab to select the main monitoring variables #------------------------------------------------------------------------------ def __init__(self, parent, label, slabel, data): wx.Panel.__init__(self, parent=parent, id=wx.ID_ANY) sizer = wx.BoxSizer(wx.VERTICAL) nestedNotebook = wx.Notebook(self, wx.ID_ANY) for sslabel in sorted(data[label][slabel][data[label][slabel].keys()[0]].keys()): tab = NestedPanelThree(nestedNotebook, label, slabel, sslabel, data) nestedNotebook.AddPage(tab, sslabel) sizer.Add(nestedNotebook, 1, wx.ALL|wx.EXPAND, 5) self.SetSizer(sizer) class NestedPanelThree(wx.Panel): #------------------------------------------------------------------------------- # Third notebook that creates checkboxes to select the monitoring sub-variables #------------------------------------------------------------------------------- def __init__(self, parent, label, slabel, sslabel, data): wx.Panel.__init__(self, parent=parent, id=wx.ID_ANY) labels=[] chbox =[] chboxdict={} for ssslabel in sorted(data[label][slabel][data[label][slabel].keys()[0]][sslabel].keys()): labels.append(ssslabel) for item in list(set(labels)): cb = wx.CheckBox(self, -1, item) chbox.append(cb) chboxdict[item]=cb gridSizer = wx.GridSizer(np.shape(list(set(labels)))[0],3, 5, 5) gridSizer.AddMany(chbox) self.SetSizer(gridSizer) ######################################################################## class NestedNotebookDemo(wx.Notebook): #--------------------------------------------------------------------------------- # Main notebook creating tabs for the monitored components #--------------------------------------------------------------------------------- def __init__(self, parent, data): wx.Notebook.__init__(self, parent, id=wx.ID_ANY, style= wx.BK_DEFAULT ) for label in sorted(data.keys()): print label tab = NestedPanelOne(self,label, data) self.AddPage(tab, label) ######################################################################## class DemoFrame(wx.Frame): #---------------------------------------------------------------------- # Putting it all together #---------------------------------------------------------------------- def __init__(self,data): wx.Frame.__init__(self, None, wx.ID_ANY, "pDAQ monitoring plotting tool", size=(800,400) ) panel = wx.Panel(self) notebook = NestedNotebookDemo(panel, data) sizer = wx.BoxSizer(wx.VERTICAL) sizer.Add(notebook, 1, wx.ALL|wx.EXPAND, 5) panel.SetSizer(sizer) self.Layout() #Menu Bar to be added later ''' menubar = wx.MenuBar() file = wx.Menu() file.Append(1, '&Quit', 'Exit Tool') menubar.Append(file, '&File') self.SetMenuBar(menubar) self.Bind(wx.EVT_MENU, self.OnClose, id=1) ''' self.Show() #---------------------------------------------------------------------- if __name__ == "__main__": if len(sys.argv) == 1: raise SystemExit("Please specify a file to process") for f in sys.argv[1:]: data=sort.sorting(f) print data['stringHub'].keys() print data.keys() print data[data.keys()[0]].keys() print 'test' app = wx.PySimpleApp() frame = DemoFrame(data) app.MainLoop() print 'testend' and I would like to reduce this whole mess into something that only has three nested for loops, so something like for label in sorted(data.keys()): self.SubNoteBooks[label] = wx.Notebook(self.Notebook, wx.ID_ANY) self.Notebook.AddPage(self.SubNoteBooks[label], label) for slabel in sorted(data[label].keys()): self.SubNoteBooks[label][slabel] = wx.Notebook(self, wx.ID_ANY) self.SubNoteBooks[label].AddPage(self.SubNoteBooks[label][slabel], slabel) for sslabel in sorted(data[label][slabel][data[label][slabel].keys()[0]].keys()): self.SubNoteBooks[label][slabel][sslabel] = wx.Notebook(self.Notebook, wx.ID_ANY) self.Notebook.AddPage(self.SubNoteBooks[label][slabel][sslabel], sslabel) I have been trying to fiddle this around but the problem seems to be the line self.SubNoteBooks[label][slabel] = wx.Notebook(self, wx.ID_ANY) I get the error: Traceback (most recent call last): File "./reducelinenumbers.py", line 162, in <module> frame = DemoFrame(data) File "./reducelinenumbers.py", line 126, in __init__ self.SubNoteBooks[label][slabel] = wx.Notebook(self, wx.ID_ANY) TypeError: 'Notebook' object does not support item assignment I understand why notebook is being type raises a TypeError here. Is there a way around this? Thanks a bunch in advance.

    Read the article

  • How to get compatibility between C# and SQL2k8 AES Encryption?

    - by Victor Rodrigues
    I have an AES encryption being made on two columns: one of these columns is stored at a SQL Server 2000 database; the other is stored at a SQL Server 2008 database. As the first column's database (2000) doesn't have native functionality for encryption / decryption, we've decided to do the cryptography logic at application level, with .NET classes, for both. But as the second column's database (2008) allow this kind of functionality, we'd like to make the data migration using the database functions to be faster, since the data migration in SQL 2k is much smaller than this second and it will last more than 50 hours because of being made at application level. My problem started at this point: using the same key, I didn't achieve the same result when encrypting a value, neither the same result size. Below we have the full logic in both sides.. Of course I'm not showing the key, but everything else is the same: private byte[] RijndaelEncrypt(byte[] clearData, byte[] Key) { var memoryStream = new MemoryStream(); Rijndael algorithm = Rijndael.Create(); algorithm.Key = Key; algorithm.IV = InitializationVector; var criptoStream = new CryptoStream(memoryStream, algorithm.CreateEncryptor(), CryptoStreamMode.Write); criptoStream.Write(clearData, 0, clearData.Length); criptoStream.Close(); byte[] encryptedData = memoryStream.ToArray(); return encryptedData; } private byte[] RijndaelDecrypt(byte[] cipherData, byte[] Key) { var memoryStream = new MemoryStream(); Rijndael algorithm = Rijndael.Create(); algorithm.Key = Key; algorithm.IV = InitializationVector; var criptoStream = new CryptoStream(memoryStream, algorithm.CreateDecryptor(), CryptoStreamMode.Write); criptoStream.Write(cipherData, 0, cipherData.Length); criptoStream.Close(); byte[] decryptedData = memoryStream.ToArray(); return decryptedData; } This is the SQL Code sample: open symmetric key columnKey decryption by password = N'{pwd!!i_ll_not_show_it_here}' declare @enc varchar(max) set @enc = dbo.VarBinarytoBase64(EncryptByKey(Key_GUID('columnKey'), 'blablabla')) select LEN(@enc), @enc This varbinaryToBase64 is a tested sql function we use to convert varbinary to the same format we use to store strings in the .net application. The result in C# is: eg0wgTeR3noWYgvdmpzTKijkdtTsdvnvKzh+uhyN3Lo= The same result in SQL2k8 is: AI0zI7D77EmqgTQrdgMBHAEAAACyACXb+P3HvctA0yBduAuwPS4Ah3AB4Dbdj2KBGC1Dk4b8GEbtXs5fINzvusp8FRBknF15Br2xI1CqP0Qb/M4w I just didn't get yet what I'm doing wrong. Do you have any ideas? EDIT: One point I think is crucial: I have one Initialization Vector at my C# code, 16 bytes. This IV is not set at SQL symmetric key, could I do this? But even not filling the IV in C#, I get very different results, both in content and length.

    Read the article

  • How to display the data of DOM parsed attributes in the listView display ?

    - by Praween k
    Hi, I am building a test output for DOM parser with node "Rider" and within that 7 attributes are there.URL://http://ps700.pranasystems.com/tours/8/xml/results/stage1results.xml. I want to display only the "name" and the "team" attributes output in the listview mode of the device.I am not getting clear where to store the output to display. Please help me someone for how to store and display that data to the output of the device in List view. Thanks in advance //-------------------------------// Here is my code------------// public String getSearch(String strURL) { URL url; URLConnection urlConn = null; NamedNodeMap nnm = null; int len; try { url = new URL(strURL); urlConn = url.openConnection(); } catch (IOException ioe) { Log.e("Could not Connect: "+ioe.getMessage(), "."); } DocumentBuilder builder = null ; Document doc = null ; try { DocumentBuilderFactory dbf = DocumentBuilderFactory.newInstance(); DocumentBuilder db = dbf.newDocumentBuilder(); doc = db.parse(urlConn.getInputStream()); Node thisNode, currentNode, node,theAttribute ; NodeList nchild, nodeList; String name; ArrayList<Node> result = new ArrayList<Node>(); nodeList = doc.getElementsByTagName("rider"); int length = nodeList.getLength(); for (int i = 0; i < length; i++) { currentNode = nodeList.item(i); NamedNodeMap attributes = currentNode.getAttributes(); Log.i("TAG", attributes.toString()); for (int a = 0; a < attributes.getLength(); a++) { theAttribute = attributes.item(a); } // s1.setAdapter(new ArrayAdapter<Node>(this, // android.R.layout.simple_list_item_1,result)); }catch(ParserConfigurationException pce ){ Log.e("Could not Parse XML:" +pce.getMessage() ,"."); } catch (SAXException se) {Log.e("Could not Parse XML: "+se.getMessage(), ".");} catch (IOException ioe) {Log.e("Invalid XML: "+ioe.getMessage(), ".");} return strURL; }

    Read the article

  • Why does extend() engage in bizarre behaviour when passed the same list twice?

    - by intuited
    I'm pretty confused by one of the subtleties of the vimscript extend() function. If you use it to extend a list with another list, it does pretty much what you'd expect, which is to insert the second list into the first list at the index given by the third parameter: let list1 = [1,2,3,4,5,6] | echo extend(list1,[1,2,3,4,5,6],5) " [1, 2, 3, 4, 5, 1, 2, 3, 4, 5, 6, 6] However if you give it the same list twice it starts tripping out a bit. let list1 = [1,2,3,4,5,6] | echo extend(list1,list1,0) " [1, 2, 3, 4, 5, 6, 1, 2, 3, 4, 5, 6] let list1 = [1,2,3,4,5,6] | echo extend(list1,list1,1) " [1, 1, 1, 1, 1, 1, 1, 2, 3, 4, 5, 6] let list1 = [1,2,3,4,5,6] | echo extend(list1,list1,2) " [1, 2, 1, 2, 1, 2, 1, 2, 3, 4, 5, 6] let list1 = [1,2,3,4,5,6] | echo extend(list1,list1,3) " [1, 2, 3, 1, 2, 3, 1, 2, 3, 4, 5, 6] let list1 = [1,2,3,4,5,6] | echo extend(list1,list1,4) " [1, 2, 3, 4, 1, 2, 3, 4, 1, 2, 5, 6] let list1 = [1,2,3,4,5,6] | echo extend(list1,list1,5) " [1, 2, 3, 4, 5, 1, 2, 3, 4, 5, 1, 6] let list1 = [1,2,3,4,5,6] | echo extend(list1,list1,6) " [1, 2, 3, 4, 5, 6, 1, 2, 3, 4, 5, 6] Extra-confusingly, this behaviour applies when the list is referenced with two different variables: let list1 = [1,2,3,4,5,6] | let list2 = list1 | echo extend(list1,list2,4) " [1, 2, 3, 4, 1, 2, 3, 4, 1, 2, 5, 6] This is totally bizarre to me. I can't fathom a use for this functionality, and it seems like it would be really easy to invoke it by accident when you just wanted to insert one list into another and didn't realize that the variables were referencing the same array. The documentation says the following: If they are |Lists|: Append {expr2} to {expr1}. If {expr3} is given insert the items of {expr2} before item {expr3} in {expr1}. When {expr3} is zero insert before the first item. When {expr3} is equal to len({expr1}) then {expr2} is appended. Examples: :echo sort(extend(mylist, [7, 5])) :call extend(mylist, [2, 3], 1) When {expr1} is the same List as {expr2} then the number of items copied is equal to the original length of the List. E.g., when {expr3} is 1 you get N new copies of the first item (where N is the original length of the List). Does this make sense in a way that I'm not getting, or is it just an eccentricity?

    Read the article

  • Yes, another thread question...

    - by Michael
    I can't understand why I am loosing control of my GUI even though I am implementing a thread to play a .wav file. Can someone pin point what is incorrect? #!/usr/bin/env python import wx, pyaudio, wave, easygui, thread, time, os, sys, traceback, threading import wx.lib.delayedresult as inbg isPaused = False isStopped = False class Frame(wx.Frame): def __init__(self): print 'Frame' wx.Frame.__init__(self, parent=None, id=-1, title="Jasmine", size=(720, 300)) #initialize panel panel = wx.Panel(self, -1) #initialize grid bag sizer = wx.GridBagSizer(hgap=20, vgap=20) #initialize buttons exitButton = wx.Button(panel, wx.ID_ANY, "Exit") pauseButton = wx.Button(panel, wx.ID_ANY, 'Pause') prevButton = wx.Button(panel, wx.ID_ANY, 'Prev') nextButton = wx.Button(panel, wx.ID_ANY, 'Next') stopButton = wx.Button(panel, wx.ID_ANY, 'Stop') #add widgets to sizer sizer.Add(pauseButton, pos=(1,10)) sizer.Add(prevButton, pos=(1,11)) sizer.Add(nextButton, pos=(1,12)) sizer.Add(stopButton, pos=(1,13)) sizer.Add(exitButton, pos=(5,13)) #initialize song time gauge #timeGauge = wx.Gauge(panel, 20) #sizer.Add(timeGauge, pos=(3,10), span=(0, 0)) #initialize menuFile widget menuFile = wx.Menu() menuFile.Append(0, "L&oad") menuFile.Append(1, "E&xit") menuBar = wx.MenuBar() menuBar.Append(menuFile, "&File") menuAbout = wx.Menu() menuAbout.Append(2, "A&bout...") menuAbout.AppendSeparator() menuBar.Append(menuAbout, "Help") self.SetMenuBar(menuBar) self.CreateStatusBar() self.SetStatusText("Welcome to Jasime!") #place sizer on panel panel.SetSizer(sizer) #initialize icon self.cd_image = wx.Image('cd_icon.png', wx.BITMAP_TYPE_PNG) self.temp = self.cd_image.ConvertToBitmap() self.size = self.temp.GetWidth(), self.temp.GetHeight() wx.StaticBitmap(parent=panel, bitmap=self.temp) #set binding self.Bind(wx.EVT_BUTTON, self.OnQuit, id=exitButton.GetId()) self.Bind(wx.EVT_BUTTON, self.pause, id=pauseButton.GetId()) self.Bind(wx.EVT_BUTTON, self.stop, id=stopButton.GetId()) self.Bind(wx.EVT_MENU, self.loadFile, id=0) self.Bind(wx.EVT_MENU, self.OnQuit, id=1) self.Bind(wx.EVT_MENU, self.OnAbout, id=2) #Load file usiing FileDialog, and create a thread for user control while running the file def loadFile(self, event): foo = wx.FileDialog(self, message="Open a .wav file...", defaultDir=os.getcwd(), defaultFile="", style=wx.FD_MULTIPLE) foo.ShowModal() self.queue = foo.GetPaths() self.threadID = 1 while len(self.queue) != 0: self.song = myThread(self.threadID, self.queue[0]) self.song.start() while self.song.isAlive(): time.sleep(2) self.queue.pop(0) self.threadID += 1 def OnQuit(self, event): self.Close() def OnAbout(self, event): wx.MessageBox("This is a great cup of tea.", "About Jasmine", wx.OK | wx.ICON_INFORMATION, self) def pause(self, event): global isPaused isPaused = not isPaused def stop(self, event): global isStopped isStopped = not isStopped class myThread (threading.Thread): def __init__(self, threadID, wf): self.threadID = threadID self.wf = wf threading.Thread.__init__(self) def run(self): global isPaused global isStopped self.waveFile = wave.open(self.wf, 'rb') #initialize stream self.p = pyaudio.PyAudio() self.stream = self.p.open(format = self.p.get_format_from_width(self.waveFile.getsampwidth()), channels = self.waveFile.getnchannels(), rate = self.waveFile.getframerate(), output = True) self.data = self.waveFile.readframes(1024) isPaused = False isStopped = False #main play loop, with pause event checking while self.data != '': # while isPaused != True: # if isStopped == False: self.stream.write(self.data) self.data = self.waveFile.readframes(1024) # elif isStopped == True: # self.stream.close() # self.p.terminate() self.stream.close() self.p.terminate() class App(wx.App): def OnInit(self): self.frame = Frame() self.frame.Show() self.SetTopWindow(self.frame) return True def main(): app = App() app.MainLoop() if __name__=='__main__': main()

    Read the article

  • Python/Biomolecular Physics- Trying to code a simple stochastic simulation of a system exhibiting co

    - by user359597
    *edited 6/17/10 I'm trying to understand how to improve my code (make it more pythonic). Also, I'm interested in writing more intuitive 'conditionals' that would describe scenarios that are commonplace in biochemistry. The conditional criteria in the below program is explained in Answer #2, but I am not satisfied with it- it is correct, but isn't obvious and isn't easy to implement for more complicated conditional scenarios. Ideas welcome. Comments/criticisms welcome. First posting experience @ stackoverflow- please comment on etiquette if needed. The code generates a list of values that are the solution to the following exercise: "In a programming language of your choice, implement Gillespie’s First Reaction Algorithm to study the temporal behaviour of the reaction A---B in which the transition from A to B can only take place if another compound, C, is present, and where C dynamically interconverts with D, as modelled in the Petri-net below. Assume that there are 100 molecules of A, 1 of C, and no B or D present at the start of the reaction. Set kAB to 0.1 s-1 and both kCD and kDC to 1.0 s-1. Simulate the behaviour of the system over 100 s." def sim(): # Set the rate constants for all transitions kAB = 0.1 kCD = 1.0 kDC = 1.0 # Set up the initial state A = 100 B = 0 C = 1 D = 0 # Set the start and end times t = 0.0 tEnd = 100.0 print "Time\t", "Transition\t", "A\t", "B\t", "C\t", "D" # Compute the first interval transition, interval = transitionData(A, B, C, D, kAB, kCD, kDC) # Loop until the end time is exceded or no transition can fire any more while t <= tEnd and transition >= 0: print t, '\t', transition, '\t', A, '\t', B, '\t', C, '\t', D t += interval if transition == 0: A -= 1 B += 1 if transition == 1: C -= 1 D += 1 if transition == 2: C += 1 D -= 1 transition, interval = transitionData(A, B, C, D, kAB, kCD, kDC) def transitionData(A, B, C, D, kAB, kCD, kDC): """ Returns nTransition, the number of the firing transition (0: A->B, 1: C->D, 2: D->C), and interval, the interval between the time of the previous transition and that of the current one. """ RAB = kAB * A * C RCD = kCD * C RDC = kDC * D dt = [-1.0, -1.0, -1.0] if RAB > 0.0: dt[0] = -math.log(1.0 - random.random())/RAB if RCD > 0.0: dt[1] = -math.log(1.0 - random.random())/RCD if RDC > 0.0: dt[2] = -math.log(1.0 - random.random())/RDC interval = 1e36 transition = -1 for n in range(len(dt)): if dt[n] > 0.0 and dt[n] < interval: interval = dt[n] transition = n return transition, interval if __name__ == '__main__': sim()

    Read the article

  • What's Wrong With My VB.NET Code Of Windows Forms Application?

    - by Krishanu Dey
    I've to forms frmPrint & frmEmail and a dataset(MyDataset) with some DataTable and DataTable Adapters. In frmPrint I've the following Sub Public Sub StartPrinting() try adapterLettersInSchedules.Fill(ds.LettersInSchedules) adapterLetters.Fill(ds.Letters) adapterClients.Fill(ds.Clients) adapterPrintJobs.GetPrintJobsDueToday(ds.PrintJobs, False, DateTime.Today) For Each prow As MyDataSet.PrintJobsRow In ds.PrintJobs Dim lisrow As MyDataSet.LettersInSchedulesRow = ds.LettersInSchedules.FindByID(prow.LetterInScheduleID) If lisrow.Isemail = False Then Dim clientrow As MyDataSet.ClientsRow = ds.Clients.FindByClientID(prow.ClientID) Dim letterrow As MyDataSet.LettersRow = ds.Letters.FindByID(lisrow.LetterID) 'prow. 'lisrow.is Label1.SuspendLayout() Label1.Refresh() Label1.Text = "Printing letter" txt.Rtf = letterrow.LetterContents txt.Rtf = txt.Rtf.Replace("<%Firstname%>", clientrow.FirstName) txt.Rtf = txt.Rtf.Replace("<%Lastname%>", clientrow.LastName) txt.Rtf = txt.Rtf.Replace("<%Title%>", clientrow.Title) txt.Rtf = txt.Rtf.Replace("<%Street%>", clientrow.Street) txt.Rtf = txt.Rtf.Replace("<%City%>", clientrow.City) txt.Rtf = txt.Rtf.Replace("<%State%>", clientrow.State) txt.Rtf = txt.Rtf.Replace("<%Zip%>", clientrow.Zip) txt.Rtf = txt.Rtf.Replace("<%PhoneH%>", clientrow.PhoneH) txt.Rtf = txt.Rtf.Replace("<%PhoneW%>", clientrow.PhoneW) txt.Rtf = txt.Rtf.Replace("<%Date%>", DateTime.Today.ToShortDateString) Try PDoc.PrinterSettings = printDlg.PrinterSettings PDoc.Print() prow.Printed = True adapterPrintJobs.Update(prow) Catch ex As Exception End Try End If Next prow ds.PrintJobs.Clear() Catch ex As Exception MessageBox.Show(ex.Message, "Print", MessageBoxButtons.OK, MessageBoxIcon.Error) End Try End Sub And in frmEmail i've the Following Sub Public Sub SendEmails() try adapterLettersInSchedules.Fill(ds.LettersInSchedules) adapterLetters.Fill(ds.Letters) adapterClients.Fill(ds.Clients) adapterEmailJobs.GetEmailJobsDueToday(ds.EmailJobs, False, Today) Dim ls_string As String For Each prow As MyDataSet.EmailJobsRow In ds.EmailJobs Dim lisrow As MyDataSet.LettersInSchedulesRow = ds.LettersInSchedules.FindByID(prow.LetterInScheduleID) If lisrow.Isemail = True Then Dim clientrow As MyDataSet.ClientsRow = ds.Clients.FindByClientID(prow.ClientID) Dim letterrow As MyDataSet.LettersRow = ds.Letters.FindByID(lisrow.LetterID) txt.Rtf = letterrow.LetterContents ls_string = RTF2HTML(txt.Rtf) ls_string = Mid(ls_string, 1, Len(ls_string) - 176) If ls_string = "" Then Throw New Exception("Rtf To HTML Conversion Failed") Label1.SuspendLayout() Label1.Refresh() Label1.Text = "Sending Email" If SendEmail(clientrow.Email, ls_string, letterrow.EmailSubject) Then Try prow.Emailed = True adapterEmailJobs.Update(prow) Catch ex As Exception End Try Else prow.Emailed = False adapterEmailJobs.Update(prow) End If End If Next prow Catch ex As Exception MessageBox.Show(ex.Message, "Email", MessageBoxButtons.OK, MessageBoxIcon.Error) End Try End Sub I'm running this two subs using two different Threads. Public th As New Thread(New ThreadStart(AddressOf StartFirstPrint)) Public th4 As New Thread(New ThreadStart(AddressOf sendFirstEmail)) Here is the code of StartFirstPrint and sendFirstEmail Public Sub StartFirstPrint() Do While thCont Try Dim frm As New frmPrint() 'frm.MdiParent = Me frm.StartPrinting() Catch ex As Exception End Try Loop End Sub Public Sub sendFirstEmail() Do While thCont Try Dim frmSNDEmail As New frmEmail frmSNDEmail.SendEmails() Catch ex As Exception End Try Loop End Sub the thCont is a public boolean variable that specifies when to shop those threads. Most Of the time this works very well. But some times it gives errors Like the following image I don't know why is this occurring. Please help me.

    Read the article

  • Python: How best to parse a simple grammar?

    - by Rosarch
    Ok, so I've asked a bunch of smaller questions about this project, but I still don't have much confidence in the designs I'm coming up with, so I'm going to ask a question on a broader scale. I am parsing pre-requisite descriptions for a course catalog. The descriptions almost always follow a certain form, which makes me think I can parse most of them. From the text, I would like to generate a graph of course pre-requisite relationships. (That part will be easy, after I have parsed the data.) Some sample inputs and outputs: "CS 2110" => ("CS", 2110) # 0 "CS 2110 and INFO 3300" => [("CS", 2110), ("INFO", 3300)] # 1 "CS 2110, INFO 3300" => [("CS", 2110), ("INFO", 3300)] # 1 "CS 2110, 3300, 3140" => [("CS", 2110), ("CS", 3300), ("CS", 3140)] # 1 "CS 2110 or INFO 3300" => [[("CS", 2110)], [("INFO", 3300)]] # 2 "MATH 2210, 2230, 2310, or 2940" => [[("MATH", 2210), ("MATH", 2230), ("MATH", 2310)], [("MATH", 2940)]] # 3 If the entire description is just a course, it is output directly. If the courses are conjoined ("and"), they are all output in the same list If the course are disjoined ("or"), they are in separate lists Here, we have both "and" and "or". One caveat that makes it easier: it appears that the nesting of "and"/"or" phrases is never greater than as shown in example 3. What is the best way to do this? I started with PLY, but I couldn't figure out how to resolve the reduce/reduce conflicts. The advantage of PLY is that it's easy to manipulate what each parse rule generates: def p_course(p): 'course : DEPT_CODE COURSE_NUMBER' p[0] = (p[1], int(p[2])) With PyParse, it's less clear how to modify the output of parseString(). I was considering building upon @Alex Martelli's idea of keeping state in an object and building up the output from that, but I'm not sure exactly how that is best done. def addCourse(self, str, location, tokens): self.result.append((tokens[0][0], tokens[0][1])) def makeCourseList(self, str, location, tokens): dept = tokens[0][0] new_tokens = [(dept, tokens[0][1])] new_tokens.extend((dept, tok) for tok in tokens[1:]) self.result.append(new_tokens) For instance, to handle "or" cases: def __init__(self): self.result = [] # ... self.statement = (course_data + Optional(OR_CONJ + course_data)).setParseAction(self.disjunctionCourses) def disjunctionCourses(self, str, location, tokens): if len(tokens) == 1: return tokens print "disjunction tokens: %s" % tokens How does disjunctionCourses() know which smaller phrases to disjoin? All it gets is tokens, but what's been parsed so far is stored in result, so how can the function tell which data in result corresponds to which elements of token? I guess I could search through the tokens, then find an element of result with the same data, but that feel convoluted... What's a better way to approach this problem?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • C++ using cdb_read returns extra characters on some reads

    - by Moe Be
    Hi All, I am using the following function to loop through a couple of open CDB hash tables. Sometimes the value for a given key is returned along with an additional character (specifically a CTRL-P (a DLE character/0x16/0o020)). I have checked the cdb key/value pairs with a couple of different utilities and none of them show any additional characters appended to the values. I get the character if I use cdb_read() or cdb_getdata() (the commented out code below). If I had to guess I would say I am doing something wrong with the buffer I create to get the result from the cdb functions. Any advice or assistance is greatly appreciated. char* HashReducer::getValueFromDb(const string &id, vector <struct cdb *> &myHashFiles) { unsigned char hex_value[BUFSIZ]; size_t hex_len; //construct a real hex (not ascii-hex) value to use for database lookups atoh(id,hex_value,&hex_len); char *value = NULL; vector <struct cdb *>::iterator my_iter = myHashFiles.begin(); vector <struct cdb *>::iterator my_end = myHashFiles.end(); try { //while there are more databases to search and we have not found a match for(; my_iter != my_end && !value ; my_iter++) { //cerr << "\n looking for this MD5:" << id << " hex(" << hex_value << ") \n"; if (cdb_find(*my_iter, hex_value, hex_len)){ //cerr << "\n\nI found the key " << id << " and it is " << cdb_datalen(*my_iter) << " long\n\n"; value = (char *)malloc(cdb_datalen(*my_iter)); cdb_read(*my_iter,value,cdb_datalen(*my_iter),cdb_datapos(*my_iter)); //value = (char *)cdb_getdata(*my_iter); //cerr << "\n\nThe value is:" << value << " len is:" << strlen(value)<< "\n\n"; }; } } catch (...){} return value; }

    Read the article

< Previous Page | 42 43 44 45 46 47 48 49 50  | Next Page >