Search Results

Search found 17972 results on 719 pages for 'always on'.

Page 469/719 | < Previous Page | 465 466 467 468 469 470 471 472 473 474 475 476  | Next Page >

• Generate multiple attribute?

  - by acidzombie24

  ATM i cant quiet imagine how this will work. I'm sure it can be done. I notice a pattern use in my attribute where i always use 3 specific attributes together. Take the below as an example [MyAttr(4, @"a"), MyAttr(41, "b"), MyAttr(45, "ab")] Mine is much more complicated but i would like to define one attribute with more params to generate the data above. How might i do that? Lets say my one attribute will look like this MyAttr2(4, 41, "a", "b"); //4+41=45, "a"+"b" = "ab" How might i generate the 3 MyAttr to apply to a class using MyAttr2?

  Read the article

• Why does FrameworkElement's FindResource() Method Accept an Object and not a String?

  - by ChrisNel52

  I understand that calling FindResource() on a FrameworkElement (e.g. a Window) can be used to find a resource in the FrameworkElement's ResourceDictionary. For example, I've used it many times to access a Style through code to add a new Setter to the Style dynamically. I always pass the x:Key value of the Style as a string into the FindResource() method. Like... Style style = w.FindResource("GridDescriptionColumn") as Style; My question is, I noticed that FindResource() accepts an argument of type object and not an argument of type string. I can't for the life of my think of a reason I would call FindResource() with an argument that is not a string. It makes me think that I may unaware of other ways to use FindResource(). Does anyone know why FindResource() accepts a parameter type of object and not string? If so, what would be an example of calling FindResource() with a parameter type other than a string? Thanks.

  Read the article

• class member access specifiers

  - by pdehaan

  I understand what the typical access specifiers are, and what they mean. 'public' members are accessible anywhere, 'private' members are accessible only by the same class and friends, etc. What I'm wondering is what, if anything, this equates to in lower-level terms. Are their any post-compilation functional differences between these beyond the high-level restrictions (what can access what) imposed by the language (c++ in this case) they're used in. Another way to put it - if this were a perfect world where programmers always made good choices (like not accessing members that may change later and using only well defined members that should stay the same between implementations), would their be any reason to use these things?

  Read the article

• Personalize Diff Command in Ubuntu

  - by acidboy

  I have two files, both with a lot of data, what I need is compare the first word of each file (each file always starts with a number, and each number could have many digits). The files are identical when these numbers are the same. Example: I have 3 files: a.txt, b.txt and c.txt a.txt content is "1 a b c 3 5 6 hjkj" b.txt content is "1 c f a 1234 h" c.txt content is "2 a b c 3 5 6 hjkj" diff a.txt b.txt should return "files are identical" diff a.txt c.txt should return "files are different" How can I compare them using the diff command?

  Read the article

• What's wrong with my If-statement to check uploaded file? (PHP)

  - by ggfan

  I am trying to test if the uploaded file is the image type I want. If it isn't a gif,jpeg, png, it should echo "Problem". But when I execute this code, it always says there's a problem. What's wrong with my if statement? $uploadfile_type=$_FILES['userfile']['type']; if ( ($uploadfile_type !='image/gif') || ($uploadfile_type !='image/jpeg') || ($uploadfile_type !='image/png')) { echo 'Problem: file is not a gif or jpeg or png!'; exit; } This code works when I am only checking one type of image. Ex: if($uploadfile_type !='image/gif') -- this statement would work but when I add a OR it doesn't.

  Read the article

• Implement a top level window from a broadcast receiver

  - by kwatts

  I have a broadcast receiver that listens for incoming calls, then displays a popup. The popup is a dialog type of theme and has FLAG_NOT_FOCUSABLE and FLAG_NOT_TOUCHABLE - basically, it's an informational window that goes away after x seconds, and is not meant to interfere or take focus over anything else. The issue is that the incoming call intent, built into android, is getting the broadcast after my intent. This is causing that window to be stacked in front of mine. How to I get my window to always be on top? Thanks!

  Read the article

• Why is it called NoSQL?

  - by beef jerky

  I've recently worked with MongoDB and learned about its schemaless design. However, I'm confused with the term NoSQL? Why is it called that? Doesn't it use SQL or SQL-like queries? I've also read from an article that the main difference lies in how data is stored. In the case of MongoDB, it's stored like JSON documents. Is this true? Also, I'm confused why I always see 'NoSQL vs relational databases'. Aren't NoSQL databases relational? I believe documents in MongoDB are still related/linked through some keys (please correct me if I'm wrong). So why is it labeled as non-relational? Thanks in advance!

  Read the article

• Difference between :: and -> in PHP

  - by vrode

  I always see people in serious projects use :: everywhere, and - only occasionally in local environment. I only use - myself and never end up in situations when I need a static value outside of a class. Am I a bad person? As I understand, the only situation when -> won't work is when I try following: class StaticDemo { private static $static } $staticDemo = new StaticDemo( ); $staticDemo->static; // wrong $staticDemo::static; // right But am I missing out on some programming correctness when I don't call simple public methods by :: ? Or is it just so that I can call a method without creating an instance?

  Read the article

• How can I get Ruby to treat the index of a string as a character (rather than the ASCII code)?

  - by user336777

  I am checking to see if the last character in a directory path is a '/'. How do you get ruby to treat the specific index of a string as a character rather than the associated ASCII code? For example the following always returns false: dir[dir.length - 1] == '/' This is because dir[dir.length - 1] returns the ASCII code 47 (rather than '/'). Any thoughts on how to interpret 47 as '/'? Or is there a completely different way to handle this in the first place? thanks.

  Read the article

• Help me with query string parameters (Rails)

  - by Martin Petrov

  Hi, I'm creating a newsletter. Each email contains a link for editing your subscription: <%= edit_user_url(@user, :secret => @user.created_at.to_i) %> :secret = @user.created_at.to_i prevents users from editing each others profiles. def edit @user = user.find(params[:id]) if params[:secret] == @user.created_at.to_i render 'edit' else redirect_to root_path end end It doesn't work - you're always redirected to root_path. It works if I modify it like this: def edit @user = user.find(params[:id]) if params[:secret] == "1293894219" ... 1293894219 is the "created_at.to_i" for a particular user. Do you have any ideas why?

  Read the article

• Set the thumbImage and watch the slider-bar disappear?

  - by Roberta

  [sld1 setThumbImage:[UIImage imageNamed:@"Blue.png"] forState:UIControlStateHighlighted]; [sld1 setThumbImage:[UIImage imageNamed:@"Blue.png"] forState:UIControlStateNormal ]; Would that cause the slider-bar image to disappear? Mine are all gone. (The thumb-image displays just fine.) Apple's docs make it sounds like I can use any ONE of above 2 lines of code. (But I guess I really need both.) And I can't find anything about "you must always do all 4": Set the normal-state image. Set the highlighted-state image. Set the setMinimumTrackImage. Set the setMaximumTrackImage.

  Read the article

• Programming in a noisy office [closed]

  - by John Isaacks

  Can anyone recommend any techniques or advice for working in a noisy office? I know some people wear headphones and listen to music but I prefer silence. I work in a room with 4 others, there are no walls between us, we just each have our own desk. There is usually always someone talking, or on the phone, or on the intercom. Has anyone else had to deal with this? What did you do? What would you recommend?

  Read the article

• Fail to resolve a name when calling ConnMgrEstablishConnectionSync()

  - by Rodriguez

  Hi Guys, I'm trying to setup a GPRS connection with ConnMgrEstablishConnectionSync(), so far so good, the connection is established and if I try to connect to an IP address, everything works fine. Alas, when I try to resolve a name: ConnMgrEstablishConnectionSync(); ... gethostbyname("www.google.com"); The result is always an error: 0x00002af9 (host not found). Therefor I'm not able to resolve any name, but if I try to open a browser, the browser is able to resolve everything. Am I doing something wrong? Thanx for your help.

  Read the article

• class member access specifiers and binary code

  - by pdehaan

  I understand what the typical access specifiers are, and what they mean. 'public' members are accessible anywhere, 'private' members are accessible only by the same class and friends, etc. What I'm wondering is what, if anything, this equates to in lower-level terms. Are their any post-compilation functional differences between these beyond the high-level restrictions (what can access what) imposed by the language (c++ in this case) they're used in. Another way to put it - if this were a perfect world where programmers always made good choices (like not accessing members that may change later and using only well defined members that should stay the same between implementations), would their be any reason to use these things?

  Read the article

• Include a repetitive chunk of html with PHP?

  - by user146780

  I basically have a div on my Web Site that always has the same stuff. However, this div is not present on all pages which is why I won't use the dynamic web template. I was wondering if it was possible for PHP to get the code from a document on the server and put in into the div? Ex: div id="section... then my text file contains (p) hello (p) basically I want PHP to put it into the div when the user sees it. If theres a smarter way of acheiving this I'd be open to it aswell. Thanks

  Read the article

• ArrayIndexOutOfBound exception even though I check for array length!

  - by xtracto

  I have the following code in some app: int lowRange=50; int[] ageRangeIndividual = {6, 10, 18, 25, 45, 65, 90}; int index=0; for (; index<ageRangeIndividual.length-1 && ageRangeIndividual[index]<=lowRange;index++); I am getting an "Exception in thread "main" java.lang.ArrayIndexOutOfBoundsException: 7" in the for line! even though I explicitly specify to break the cycle if index < last indexable item in the array! This does not happen always, but after some time of running said program (lowRange varies each time the function is called) What am I not seeing?

  Read the article

• PHP - turning register globals off, what is the best way to go about fixing the code?

  - by user187809

  I am working on a old code base, where programmers assumed that register_globals will always be on. Hence variables are used without $_GET or $_POST prefix, pretty much in every page (the code base is huge, hundreds of scripts). I tried turning it off, but the very first script (login script) goes on an infinite loop. I understand that going through one script at a time, and one line at a time and fixing the variables is probably the only option (adding the prefix $_GET or $_POST as the case may be). Has anyone does this before? How did you go about doing it? Any advice?

  Read the article

• One input file to multiple output files

  - by user1265669

  I found some helpful stuff on this site but my input file is different from the examples already posted and I cannot make the leap in an efficient manner. My input file looks like this: sample_dude data1 data2 data3 data4 sample_lady data5 data6 data7 data8 sample_dude data9 data10 data11 data12 sample_child data13 data14 data15 data16 I want to create a separate file for each sample with all the data columns. For example, one file would be called sample_dude.txt and look like this: data1 data2 data3 data4 data9 data10 data11 data12 There is an unknown number of samples but always just four data columns. Any help greatly appreciated. Thank you. PS: I'm trying to do this in python.

  Read the article

• Is it good practise to use meta refresh tags for redirects instead of header() function in php?

  - by Kent

  I have to use redirects a lot in my scripts, for example after a user logs in I need to redirect them to the admin area, etc. But I find it inconvenient to always have to have the header function at the very top. So if I use the meta refresh tags for my redirects, is that something that would be frowned upon according to best practices or is it acceptable? function redirect($location) { echo "<meta http-equiv='refresh' content='0; url=$location' />"; }

  Read the article

• doubt in - Function Objects - c++

  - by Eternal Learner

  I have a class class fobj{ public: fobj(int i):id(i) {} void operator()() { std::cout<<"Prints"<<std::endl; } private: int id; }; template<typename T> void func(T type) { type(); } My Doubt is if I invoke func like Method 1: func(fobj(1); the message I wanted to print is printed. I was always thinking I needed to do something like Method 2: fobj Iobj(1); // create an instance of the fobj class func(Iobj); //call func by passing Iobj(which is a function object) How does Method 1 work? I mean what exactly happens? and how is a call made to the operator() in class fobj ?

  Read the article

• How to hang up (disconnect, terminate,..) incomings call???

  - by Cesar Valiente

  "How do you hang up incoming calls (in Android of course)?" First, I know this question has been asked and answered several times, and the response is always "you can't". But if we look in the market we get a few applications (all private software, no access to the source code... :-( ) that do this action, such as CallFilter, Panda firewall and others... So... does somebody know how these apps do the hang up action, (or terminate, or disconnect or whatever you call it..)? And other question, if the first don't get a response.. does somebody know how send an incoming call to the voice mail? Of course, all questions are about how to do it programmatically. So with the voicemail question I know there's a flag in contacts that is used for that, but like I said, I'd like to know the programmatical way. Thanks all!

  Read the article

• What was your first home computer?

  - by Adam Tegen

  What was your first home computer? The one that made you "fall in love" with programming. There are 300+ entries, many (most?) of which are duplicates. As with all StackOverflow Poll type Q&As, please make certain your answer is NOT listed already before adding a new answer - searching doesn't always find it (model naming variations, I assume). If it already exists, vote that one up so we see what the most popular answer is, rather than duplicating an existing entry. If you see a duplicate, vote it down so the top entries have only one of each model listed. If you have interesting or additional information to add, use a comment or edit the original entry rather than creating a duplicate.

  Read the article

• Getting Reference to Calling Activity from AsyncTask (NOT as an inner class)

  - by stormin986

  Is it at all possible, from within an AsyncTask that is NOT an inner class of the calling Activity class, to get a reference to the instance of Activity that initiated execution of the AsyncTask? I am aware of this thread, however it doesn't exactly address how to reference the calling Activity. Some suggest passing a reference to the Activity as a parameter to the AsyncTask constructor, however, it's reported that doing so will always result in a NullPointerException. So, I'm at a loss. My AsyncTask provides robust functionality, and I don't want to have to duplicate it as an inner class in every Activity that wants to use it. There must be an elegant solution.

  Read the article

• increasing speed and efficiency of ajax call

  - by user1048824

  I'm not the most disciplined dev, dont know standards and am self-taught so bear with me. I create stuff very logically and fast but not always using 'programming standards'. I have a mobile app using geolocation API. it gets thousands of places from my db and makes gmaps v3 markers for the ones around the user's current location. there is an ajax call from my JS to an aspx page that calls the database, makes a json string, and sends the json string to the javascript that then creates the google map markers. would i save time if the json string was in a flat file? im not sure if, generally speaking, accessing a sql db from an aspx page is faster than c# file i/o on a flat file with pre-rendered JSON. (of course, using the flat file, it would update everytime the db is updated)

  Read the article

• Splitting Nucleotide Sequences in JS with Regexp

  - by TEmerson

  I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

  Read the article

< Previous Page | 465 466 467 468 469 470 471 472 473 474 475 476  | Next Page >