Search Results

Search found 5254 results on 211 pages for 'concept analysis'.

Page 47/211 | < Previous Page | 43 44 45 46 47 48 49 50 51 52 53 54  | Next Page >

  • Data Mining open source tools

    - by Andriyev
    Hi I'm due to take up a project which is into data mining. Before I jump in I wanted to probe around for different data mining tools (preferably open source) which allows web based reporting. In my scenario the all the data would be provided to me, so I'm not supposed to crawl for it. In n nutshell, am looking for a tool which does - Data Analysis, Web based Reporting, provides some kind of a dashboard and mining features. I have worked on the Microsoft Analysis Services and BOXI and off late I have been looking at Pentaho, which seems to be a good option. Please share your experiences on any such tool which you know of. cheers

    Read the article

  • What software analogies have helped you?

    - by Galwegian
    I have often enjoyed the use of analogies in understanding a software scenario or problem. For example, to understand the concept of public key encryption, the 'locked mailbox' analogy or similar is often used as an aid: An analogy for public-key encryption is that of a locked mailbox with a mail slot. The mail slot is exposed and accessible to the public; its location (the street address) is in essence the public key. Anyone knowing the street address can go to the door and drop a written message through the slot; however, only the person who possesses the key can open the mailbox and read the message. My question is: What analogies have you used or heard of in your career that have given you that "Eureka" moment with a complex concept? EDIT: If you have a good one, don't just state the name, please share with the group!

    Read the article

  • How do I branch an individual file in SVN?

    - by Michael Carman
    The subversion concept of branching appears to be focused on creating an [un]stable fork of the entire repository on which to do development. Is there a mechanism for creating branches of individual files? For a use case, think of a common header (*.h) file that has multiple platform-specific source (*.c) implementations. This type of branch is a permanent one. All of these branches would see ongoing development with occasional cross-branch merging. This is in sharp contrast to unstable development/stable release branches which generally have a finite lifespan. I do not want to branch the entire repository (cheap or not) as it would create an unreasonable amount of maintenance to continuously merge between the trunk and all the branches. At present I'm using ClearCase, which has a different concept of branching that makes this easy. I've been asked to consider transitioning to SVN but this paradigm difference is important. I'm much more concerned about being able to easily create alternate versions for individual files than about things like cutting a stable release branch.

    Read the article

  • Domain Model and Contracts

    - by devoured elysium
    I am modelling a DVD Rental Store: A Client gives its clientNumber to the System. The System checks whenever the given clientNumber is valid. The Client gives the name of the DVD he wants to rent. ... n. ...I will later have to form an association between a new instance of "RentDVD" class concept to the current Client c. My Domain Model is something like: I've made the Contract for the first and second operations as: Preconditions: none Postconditions: there exists a Client c such that c.clientNumber = clientNumber. Now, I don't know if I should form an association between this Client c and the DVDStore(that I intend to use as front-end). If I don't make the association, how will I later be able to "reference" this same Client? Should I be making an association between Client and a different concept? Thanks

    Read the article

  • ORM on which standards i can select?

    - by just_name
    Q: This question is about how can i figure or select the convenient ORM to my web application. when beginning a new web application,What are the criteria on which i can consider a specific ORM is better than another one for my project or case(web application)? another part of my question : when i begin any web application i use three layers: the DB layer (which contains the connections , and handle the CRUD operations ) the Managers layer(the Data Access Layer) a class for each table on my db (loosely coupled with the previous layer )it contains the CRUD operations for the specific table and the other required operations. the interface layer.. and i use Object Data source.Is that considered as an ORM (as a concept) or I'm wrong in understanding this concept. note:I still a beginner in this field ,, and every day i learn more about web development. please i want explanation and suggestions for this point. Thanks in advance.

    Read the article

  • is it posible to upload directly to remote server using SFTP on ASP.net MVC

    - by DucDigital
    Hi! I am currently develope something using asp.net MVC, im still quite not experience with it so please help me out. I have a form for user to upload Video. The current ideal concept to upload to remote server is to Upload it to to the current server, then use FTP to push it to a remote server. For me, this is not quite fast since you have to upload to current server (Time x1) and then the current server push to new server (Time x2) so it's double the time. So my idea is to make user upload it to the current server, and WHILE user is uploading, the current server add the file to DB and also send the file to the remote server at the same time using SFTP... is it posible and are there any security hole in this concept? Thank you very much

    Read the article

  • Creating a new buffer with text using EmacsClient

    - by User1
    I have a program that can send text to any other program for further analysis (eg sed, grep, etc). I would like it to send the data to Emacs and do analysis there. How would I do that? EmacsClient takes a filename by default, this is a data string not a file and I really don't want to create and delete files just to send data to Emacs. EmacsClient has an "eval" command-line option that let's you execute lisp code instead of open files. Is there a simple lisp function that will open a new buffer with the given text?

    Read the article

  • Is there a Java Descriptor like thing in .Net?

    - by Sun Liwen
    I'm working on a static analysis tool for .NET assembly. In Java, there is a Descriptor which can be used to represent method or field in a string with specified grammar. for field: double d[][][]; will be [[[D It's useful especially when doing bytecode analysis. Coz it's easy to describe. If there a similar thing in .NET CLR? Or is there a better way to achieve this? Thanks!

    Read the article

  • multiple move operations and data processes in work thread

    - by younevertell
    main thread-- start workthread--StartStage(get list of positions for data process) -- move to one position -- data sampling*strong text*-- data collection--data analysis------data sampling*strong text* basically, work thread does the data sampling*strong text*-- data collection--data analysis------data sampling*strong text* loop for one positioin until press stop or target is obtained. my questions: After work thread finishs the loop for one positioin, it would end itself. now how to make the work thread moves to the next position to do the data process loop after work thread finish one position work, would not end itself until data process for all the positions are done? Thanks in advance!

    Read the article

  • Minimum number of training examples for Find-S/Candidate Elimination algorithms?

    - by Rich
    Consider the instance space consisting of integer points in the x, y plane, where 0 = x, y = 10, and the set of hypotheses consisting of rectangles (i.e. being of the form (a = x = b, c = y = d), where 0 = a, b, c, d = 10). What is the smallest number of training examples one needs to provide so that the Find-S algorithm perfectly learns a particular target concept (e.g. (2 = x = 4, 6 = y = 9))? When can we say that the target concept is exactly learned in the case of the Find-S algorithm, and what is the optimal query strategy? I'd also like to know the answer w.r.t Candidate Elimination. Thanks in advance.

    Read the article

  • Running [R] on a Netbook

    - by Thomas
    I am interested in purchasing a netbook to do field research in another country. My hardware specifications for the nebtook are fairly basic: Be rugged enough to survive a bit of wear and tear Fairly fast processing (the ability to upgrade from 1GB of RAM to 2GB) A battery life of longer than 6 hours At least a 10 inch screen A decent camera for Skyping However, I am mainly concerned about being able to do basic statistical analysis in conjunction with R Be able run a Spreadsheet program to do basic data input (like Excel or Open Office) Use R to do basic data analysis (Regression, some simulation (nothing crazy), data cleaning, and some of the functionality) Word Processing (Word or Open Office) Do you have any suggestions on which models or brands my fit my needs? Some of the models I am considering: Samsung NB-30 Toshiba NB 305 Asus Eee PC 1005HA Lenovo S10-2 Does anyone use R on a netbook, and if so do you have any recommendations on how best to optimize it? This article from Lifehacker mentions some OS. Anybody use these in conjunction with R? Any help would be much appreciated.

    Read the article

  • finding the numbers in a given range?

    - by Jamis
    Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

    Read the article

  • doctrine default values and relations

    - by Skirmantas
    Concept: Lets say we have table Properties with columns id and name (lets say with some predefined values: "Good" "Better" "Best"). Another table Users has column property_id with many to one relation on Properties (property_id = id). Users has default value on property_id, lets say 1 which means "Good". We might have another table analogue to Users however with default property, lets say "Better". What I need is ability to change default value for Users or other tables in administrator's panel. In mysql I can set default value for column like this: ALTER TABLE <Table> CHANGE <Column> DEFAULT <NEW_DEFAULT_VALUE> I can retrieve default value: SELECT DEFAULT(<Column>) FROM <Table> LIMIT 1 Is it possible to achieve this concept with Doctrine? What I actually need is such method in my table class: class UserTable extend Doctrine_Table { /* ... */ getDefaultProperty() { } setDefaultProperty($value) { /* $value can be either integer or Doctrine_Record */ } }

    Read the article

  • Determining whether a class implements a generic list in a T4 template

    - by James Hollingworth
    I'm writing a T4 template which loads some classes from an assembly, does some analysis of the classes and then generates some code. One particular bit of analysis I need to do is to determine whether the class implements a generic list. I can do this pretty simply in C#, e.g. public class Foo : List<string> { } var t = typeof(Foo); if (t.BaseType != null && t.BaseType.IsGenericType && t.BaseType.GetGenericTypeDefinition() == typeof(List<>))) Console.WriteLine("Win"); However T4 templates use the FXCop introspection engine and so you do not have access to the .net reflection API. I've spent the past couple of hours in Reflector but still can't figure it out. Does anyone have any clues about how to do this?

    Read the article

  • How to obtain a random sub-datatable from another data table

    - by developerit
    Introduction In this article, I’ll show how to get a random subset of data from a DataTable. This is useful when you already have queries that are filtered correctly but returns all the rows. Analysis I came across this situation when I wanted to display a random tag cloud. I already had the query to get the keywords ordered by number of clicks and I wanted to created a tag cloud. Tags that are the most popular should have more chance to get picked and should be displayed larger than less popular ones. Implementation In this code snippet, there is everything you need. ' Min size, in pixel for the tag Private Const MIN_FONT_SIZE As Integer = 9 ' Max size, in pixel for the tag Private Const MAX_FONT_SIZE As Integer = 14 ' Basic function that retreives Tags from a DataBase Public Shared Function GetTags() As MediasTagsDataTable ' Simple call to the TableAdapter, to get the Tags ordered by number of clicks Dim dt As MediasTagsDataTable = taMediasTags.GetDataValide ' If the query returned no result, return an empty DataTable If dt Is Nothing OrElse dt.Rows.Count < 1 Then Return New MediasTagsDataTable End If ' Set the font-size of the group of data ' We are dividing our results into sub set, according to their number of clicks ' Example: 10 results -> [0,2] will get font size 9, [3,5] will get font size 10, [6,8] wil get 11, ... ' This is the number of elements in one group Dim groupLenth As Integer = CType(Math.Floor(dt.Rows.Count / (MAX_FONT_SIZE - MIN_FONT_SIZE)), Integer) ' Counter of elements in the same group Dim counter As Integer = 0 ' Counter of groups Dim groupCounter As Integer = 0 ' Loop througt the list For Each row As MediasTagsRow In dt ' Set the font-size in a custom column row.c_FontSize = MIN_FONT_SIZE + groupCounter ' Increment the counter counter += 1 ' If the group counter is less than the counter If groupLenth <= counter Then ' Start a new group counter = 0 groupCounter += 1 End If Next ' Return the new DataTable with font-size Return dt End Function ' Function that generate the random sub set Public Shared Function GetRandomSampleTags(ByVal KeyCount As Integer) As MediasTagsDataTable ' Get the data Dim dt As MediasTagsDataTable = GetTags() ' Create a new DataTable that will contains the random set Dim rep As MediasTagsDataTable = New MediasTagsDataTable ' Count the number of row in the new DataTable Dim count As Integer = 0 ' Random number generator Dim rand As New Random() While count < KeyCount Randomize() ' Pick a random row Dim r As Integer = rand.Next(0, dt.Rows.Count - 1) Dim tmpRow As MediasTagsRow = dt(r) ' Import it into the new DataTable rep.ImportRow(tmpRow) ' Remove it from the old one, to be sure not to pick it again dt.Rows.RemoveAt(r) ' Increment the counter count += 1 End While ' Return the new sub set Return rep End Function Pro’s This method is good because it doesn’t require much work to get it work fast. It is a good concept when you are working with small tables, let says less than 100 records. Con’s If you have more than 100 records, out of memory exception may occur since we are coping and duplicating rows. I would consider using a stored procedure instead.

    Read the article

  • SQL Authority News – Download Microsoft SQL Server 2014 Feature Pack and Microsoft SQL Server Developer’s Edition

    - by Pinal Dave
    Yesterday I attended the SQL Server Community Launch in Bangalore and presented on Performing an effective Presentation. It was a fun presentation and people very well received it. No matter on what subject, I present, I always end up talking about SQL. Here are two of the questions I had received during the event. Q1) I want to install SQL Server on my development server, where can we get it for free or at an economical price (I do not have MSDN)? A1) If you are not going to use your server in a production environment, you can just get SQL Server Developer’s Edition and you can read more about it over here. Here is another favorite question which I keep on receiving it during the event. Q2) I already have SQL Server installed on my machine, what are different feature pack should I install and where can I get them from. A2) Just download and install Microsoft SQL Server 2014 Service Pack. Here is the link for downloading it. The Microsoft SQL Server 2014 Feature Pack is a collection of stand-alone packages which provide additional value for Microsoft SQL Server. It includes tool and components for Microsoft SQL Server 2014 and add-on providers for Microsoft SQL Server 2014. Here is the list of component this product contains: Microsoft SQL Server Backup to Windows Azure Tool Microsoft SQL Server Cloud Adapter Microsoft Kerberos Configuration Manager for Microsoft SQL Server Microsoft SQL Server 2014 Semantic Language Statistics Microsoft SQL Server Data-Tier Application Framework Microsoft SQL Server 2014 Transact-SQL Language Service Microsoft Windows PowerShell Extensions for Microsoft SQL Server 2014 Microsoft SQL Server 2014 Shared Management Objects Microsoft Command Line Utilities 11 for Microsoft SQL Server Microsoft ODBC Driver 11 for Microsoft SQL Server – Windows Microsoft JDBC Driver 4.0 for Microsoft SQL Server Microsoft Drivers 3.0 for PHP for Microsoft SQL Server Microsoft SQL Server 2014 Transact-SQL ScriptDom Microsoft SQL Server 2014 Transact-SQL Compiler Service Microsoft System CLR Types for Microsoft SQL Server 2014 Microsoft SQL Server 2014 Remote Blob Store SQL RBS codeplex samples page SQL Server Remote Blob Store blogs Microsoft SQL Server Service Broker External Activator for Microsoft SQL Server 2014 Microsoft OData Source for Microsoft SQL Server 2014 Microsoft Balanced Data Distributor for Microsoft SQL Server 2014 Microsoft Change Data Capture Designer and Service for Oracle by Attunity for Microsoft SQL Server 2014 Microsoft SQL Server 2014 Master Data Service Add-in for Microsoft Excel Microsoft SQL Server StreamInsight Microsoft Connector for SAP BW for Microsoft SQL Server 2014 Microsoft SQL Server Migration Assistant Microsoft SQL Server 2014 Upgrade Advisor Microsoft OLEDB Provider for DB2 v5.0 for Microsoft SQL Server 2014 Microsoft SQL Server 2014 PowerPivot for Microsoft SharePoint 2013 Microsoft SQL Server 2014 ADOMD.NET Microsoft Analysis Services OLE DB Provider for Microsoft SQL Server 2014 Microsoft SQL Server 2014 Analysis Management Objects Microsoft SQL Server Report Builder for Microsoft SQL Server 2014 Microsoft SQL Server 2014 Reporting Services Add-in for Microsoft SharePoint Reference: Pinal Dave (http://blog.sqlauthority.com)Filed under: PostADay, SQL, SQL Authority, SQL Download, SQL Query, SQL Server, SQL Tips and Tricks, SQLAuthority News, T SQL

    Read the article

  • Toorcon 15 (2013)

    - by danx
    The Toorcon gang (senior staff): h1kari (founder), nfiltr8, and Geo Introduction to Toorcon 15 (2013) A Tale of One Software Bypass of MS Windows 8 Secure Boot Breaching SSL, One Byte at a Time Running at 99%: Surviving an Application DoS Security Response in the Age of Mass Customized Attacks x86 Rewriting: Defeating RoP and other Shinanighans Clowntown Express: interesting bugs and running a bug bounty program Active Fingerprinting of Encrypted VPNs Making Attacks Go Backwards Mask Your Checksums—The Gorry Details Adventures with weird machines thirty years after "Reflections on Trusting Trust" Introduction to Toorcon 15 (2013) Toorcon 15 is the 15th annual security conference held in San Diego. I've attended about a third of them and blogged about previous conferences I attended here starting in 2003. As always, I've only summarized the talks I attended and interested me enough to write about them. Be aware that I may have misrepresented the speaker's remarks and that they are not my remarks or opinion, or those of my employer, so don't quote me or them. Those seeking further details may contact the speakers directly or use The Google. For some talks, I have a URL for further information. A Tale of One Software Bypass of MS Windows 8 Secure Boot Andrew Furtak and Oleksandr Bazhaniuk Yuri Bulygin, Oleksandr ("Alex") Bazhaniuk, and (not present) Andrew Furtak Yuri and Alex talked about UEFI and Bootkits and bypassing MS Windows 8 Secure Boot, with vendor recommendations. They previously gave this talk at the BlackHat 2013 conference. MS Windows 8 Secure Boot Overview UEFI (Unified Extensible Firmware Interface) is interface between hardware and OS. UEFI is processor and architecture independent. Malware can replace bootloader (bootx64.efi, bootmgfw.efi). Once replaced can modify kernel. Trivial to replace bootloader. Today many legacy bootkits—UEFI replaces them most of them. MS Windows 8 Secure Boot verifies everything you load, either through signatures or hashes. UEFI firmware relies on secure update (with signed update). You would think Secure Boot would rely on ROM (such as used for phones0, but you can't do that for PCs—PCs use writable memory with signatures DXE core verifies the UEFI boat loader(s) OS Loader (winload.efi, winresume.efi) verifies the OS kernel A chain of trust is established with a root key (Platform Key, PK), which is a cert belonging to the platform vendor. Key Exchange Keys (KEKs) verify an "authorized" database (db), and "forbidden" database (dbx). X.509 certs with SHA-1/SHA-256 hashes. Keys are stored in non-volatile (NV) flash-based NVRAM. Boot Services (BS) allow adding/deleting keys (can't be accessed once OS starts—which uses Run-Time (RT)). Root cert uses RSA-2048 public keys and PKCS#7 format signatures. SecureBoot — enable disable image signature checks SetupMode — update keys, self-signed keys, and secure boot variables CustomMode — allows updating keys Secure Boot policy settings are: always execute, never execute, allow execute on security violation, defer execute on security violation, deny execute on security violation, query user on security violation Attacking MS Windows 8 Secure Boot Secure Boot does NOT protect from physical access. Can disable from console. Each BIOS vendor implements Secure Boot differently. There are several platform and BIOS vendors. It becomes a "zoo" of implementations—which can be taken advantage of. Secure Boot is secure only when all vendors implement it correctly. Allow only UEFI firmware signed updates protect UEFI firmware from direct modification in flash memory protect FW update components program SPI controller securely protect secure boot policy settings in nvram protect runtime api disable compatibility support module which allows unsigned legacy Can corrupt the Platform Key (PK) EFI root certificate variable in SPI flash. If PK is not found, FW enters setup mode wich secure boot turned off. Can also exploit TPM in a similar manner. One is not supposed to be able to directly modify the PK in SPI flash from the OS though. But they found a bug that they can exploit from User Mode (undisclosed) and demoed the exploit. It loaded and ran their own bootkit. The exploit requires a reboot. Multiple vendors are vulnerable. They will disclose this exploit to vendors in the future. Recommendations: allow only signed updates protect UEFI fw in ROM protect EFI variable store in ROM Breaching SSL, One Byte at a Time Yoel Gluck and Angelo Prado Angelo Prado and Yoel Gluck, Salesforce.com CRIME is software that performs a "compression oracle attack." This is possible because the SSL protocol doesn't hide length, and because SSL compresses the header. CRIME requests with every possible character and measures the ciphertext length. Look for the plaintext which compresses the most and looks for the cookie one byte-at-a-time. SSL Compression uses LZ77 to reduce redundancy. Huffman coding replaces common byte sequences with shorter codes. US CERT thinks the SSL compression problem is fixed, but it isn't. They convinced CERT that it wasn't fixed and they issued a CVE. BREACH, breachattrack.com BREACH exploits the SSL response body (Accept-Encoding response, Content-Encoding). It takes advantage of the fact that the response is not compressed. BREACH uses gzip and needs fairly "stable" pages that are static for ~30 seconds. It needs attacker-supplied content (say from a web form or added to a URL parameter). BREACH listens to a session's requests and responses, then inserts extra requests and responses. Eventually, BREACH guesses a session's secret key. Can use compression to guess contents one byte at-a-time. For example, "Supersecret SupersecreX" (a wrong guess) compresses 10 bytes, and "Supersecret Supersecret" (a correct guess) compresses 11 bytes, so it can find each character by guessing every character. To start the guess, BREACH needs at least three known initial characters in the response sequence. Compression length then "leaks" information. Some roadblocks include no winners (all guesses wrong) or too many winners (multiple possibilities that compress the same). The solutions include: lookahead (guess 2 or 3 characters at-a-time instead of 1 character). Expensive rollback to last known conflict check compression ratio can brute-force first 3 "bootstrap" characters, if needed (expensive) block ciphers hide exact plain text length. Solution is to align response in advance to block size Mitigations length: use variable padding secrets: dynamic CSRF tokens per request secret: change over time separate secret to input-less servlets Future work eiter understand DEFLATE/GZIP HTTPS extensions Running at 99%: Surviving an Application DoS Ryan Huber Ryan Huber, Risk I/O Ryan first discussed various ways to do a denial of service (DoS) attack against web services. One usual method is to find a slow web page and do several wgets. Or download large files. Apache is not well suited at handling a large number of connections, but one can put something in front of it Can use Apache alternatives, such as nginx How to identify malicious hosts short, sudden web requests user-agent is obvious (curl, python) same url requested repeatedly no web page referer (not normal) hidden links. hide a link and see if a bot gets it restricted access if not your geo IP (unless the website is global) missing common headers in request regular timing first seen IP at beginning of attack count requests per hosts (usually a very large number) Use of captcha can mitigate attacks, but you'll lose a lot of genuine users. Bouncer, goo.gl/c2vyEc and www.github.com/rawdigits/Bouncer Bouncer is software written by Ryan in netflow. Bouncer has a small, unobtrusive footprint and detects DoS attempts. It closes blacklisted sockets immediately (not nice about it, no proper close connection). Aggregator collects requests and controls your web proxies. Need NTP on the front end web servers for clean data for use by bouncer. Bouncer is also useful for a popularity storm ("Slashdotting") and scraper storms. Future features: gzip collection data, documentation, consumer library, multitask, logging destroyed connections. Takeaways: DoS mitigation is easier with a complete picture Bouncer designed to make it easier to detect and defend DoS—not a complete cure Security Response in the Age of Mass Customized Attacks Peleus Uhley and Karthik Raman Peleus Uhley and Karthik Raman, Adobe ASSET, blogs.adobe.com/asset/ Peleus and Karthik talked about response to mass-customized exploits. Attackers behave much like a business. "Mass customization" refers to concept discussed in the book Future Perfect by Stan Davis of Harvard Business School. Mass customization is differentiating a product for an individual customer, but at a mass production price. For example, the same individual with a debit card receives basically the same customized ATM experience around the world. Or designing your own PC from commodity parts. Exploit kits are another example of mass customization. The kits support multiple browsers and plugins, allows new modules. Exploit kits are cheap and customizable. Organized gangs use exploit kits. A group at Berkeley looked at 77,000 malicious websites (Grier et al., "Manufacturing Compromise: The Emergence of Exploit-as-a-Service", 2012). They found 10,000 distinct binaries among them, but derived from only a dozen or so exploit kits. Characteristics of Mass Malware: potent, resilient, relatively low cost Technical characteristics: multiple OS, multipe payloads, multiple scenarios, multiple languages, obfuscation Response time for 0-day exploits has gone down from ~40 days 5 years ago to about ~10 days now. So the drive with malware is towards mass customized exploits, to avoid detection There's plenty of evicence that exploit development has Project Manager bureaucracy. They infer from the malware edicts to: support all versions of reader support all versions of windows support all versions of flash support all browsers write large complex, difficult to main code (8750 lines of JavaScript for example Exploits have "loose coupling" of multipe versions of software (adobe), OS, and browser. This allows specific attacks against specific versions of multiple pieces of software. Also allows exploits of more obscure software/OS/browsers and obscure versions. Gave examples of exploits that exploited 2, 3, 6, or 14 separate bugs. However, these complete exploits are more likely to be buggy or fragile in themselves and easier to defeat. Future research includes normalizing malware and Javascript. Conclusion: The coming trend is that mass-malware with mass zero-day attacks will result in mass customization of attacks. x86 Rewriting: Defeating RoP and other Shinanighans Richard Wartell Richard Wartell The attack vector we are addressing here is: First some malware causes a buffer overflow. The malware has no program access, but input access and buffer overflow code onto stack Later the stack became non-executable. The workaround malware used was to write a bogus return address to the stack jumping to malware Later came ASLR (Address Space Layout Randomization) to randomize memory layout and make addresses non-deterministic. The workaround malware used was to jump t existing code segments in the program that can be used in bad ways "RoP" is Return-oriented Programming attacks. RoP attacks use your own code and write return address on stack to (existing) expoitable code found in program ("gadgets"). Pinkie Pie was paid $60K last year for a RoP attack. One solution is using anti-RoP compilers that compile source code with NO return instructions. ASLR does not randomize address space, just "gadgets". IPR/ILR ("Instruction Location Randomization") randomizes each instruction with a virtual machine. Richard's goal was to randomize a binary with no source code access. He created "STIR" (Self-Transofrming Instruction Relocation). STIR disassembles binary and operates on "basic blocks" of code. The STIR disassembler is conservative in what to disassemble. Each basic block is moved to a random location in memory. Next, STIR writes new code sections with copies of "basic blocks" of code in randomized locations. The old code is copied and rewritten with jumps to new code. the original code sections in the file is marked non-executible. STIR has better entropy than ASLR in location of code. Makes brute force attacks much harder. STIR runs on MS Windows (PEM) and Linux (ELF). It eliminated 99.96% or more "gadgets" (i.e., moved the address). Overhead usually 5-10% on MS Windows, about 1.5-4% on Linux (but some code actually runs faster!). The unique thing about STIR is it requires no source access and the modified binary fully works! Current work is to rewrite code to enforce security policies. For example, don't create a *.{exe,msi,bat} file. Or don't connect to the network after reading from the disk. Clowntown Express: interesting bugs and running a bug bounty program Collin Greene Collin Greene, Facebook Collin talked about Facebook's bug bounty program. Background at FB: FB has good security frameworks, such as security teams, external audits, and cc'ing on diffs. But there's lots of "deep, dark, forgotten" parts of legacy FB code. Collin gave several examples of bountied bugs. Some bounty submissions were on software purchased from a third-party (but bounty claimers don't know and don't care). We use security questions, as does everyone else, but they are basically insecure (often easily discoverable). Collin didn't expect many bugs from the bounty program, but they ended getting 20+ good bugs in first 24 hours and good submissions continue to come in. Bug bounties bring people in with different perspectives, and are paid only for success. Bug bounty is a better use of a fixed amount of time and money versus just code review or static code analysis. The Bounty program started July 2011 and paid out $1.5 million to date. 14% of the submissions have been high priority problems that needed to be fixed immediately. The best bugs come from a small % of submitters (as with everything else)—the top paid submitters are paid 6 figures a year. Spammers like to backstab competitors. The youngest sumitter was 13. Some submitters have been hired. Bug bounties also allows to see bugs that were missed by tools or reviews, allowing improvement in the process. Bug bounties might not work for traditional software companies where the product has release cycle or is not on Internet. Active Fingerprinting of Encrypted VPNs Anna Shubina Anna Shubina, Dartmouth Institute for Security, Technology, and Society (I missed the start of her talk because another track went overtime. But I have the DVD of the talk, so I'll expand later) IPsec leaves fingerprints. Using netcat, one can easily visually distinguish various crypto chaining modes just from packet timing on a chart (example, DES-CBC versus AES-CBC) One can tell a lot about VPNs just from ping roundtrips (such as what router is used) Delayed packets are not informative about a network, especially if far away from the network More needed to explore about how TCP works in real life with respect to timing Making Attacks Go Backwards Fuzzynop FuzzyNop, Mandiant This talk is not about threat attribution (finding who), product solutions, politics, or sales pitches. But who are making these malware threats? It's not a single person or group—they have diverse skill levels. There's a lot of fat-fingered fumblers out there. Always look for low-hanging fruit first: "hiding" malware in the temp, recycle, or root directories creation of unnamed scheduled tasks obvious names of files and syscalls ("ClearEventLog") uncleared event logs. Clearing event log in itself, and time of clearing, is a red flag and good first clue to look for on a suspect system Reverse engineering is hard. Disassembler use takes practice and skill. A popular tool is IDA Pro, but it takes multiple interactive iterations to get a clean disassembly. Key loggers are used a lot in targeted attacks. They are typically custom code or built in a backdoor. A big tip-off is that non-printable characters need to be printed out (such as "[Ctrl]" "[RightShift]") or time stamp printf strings. Look for these in files. Presence is not proof they are used. Absence is not proof they are not used. Java exploits. Can parse jar file with idxparser.py and decomile Java file. Java typially used to target tech companies. Backdoors are the main persistence mechanism (provided externally) for malware. Also malware typically needs command and control. Application of Artificial Intelligence in Ad-Hoc Static Code Analysis John Ashaman John Ashaman, Security Innovation Initially John tried to analyze open source files with open source static analysis tools, but these showed thousands of false positives. Also tried using grep, but tis fails to find anything even mildly complex. So next John decided to write his own tool. His approach was to first generate a call graph then analyze the graph. However, the problem is that making a call graph is really hard. For example, one problem is "evil" coding techniques, such as passing function pointer. First the tool generated an Abstract Syntax Tree (AST) with the nodes created from method declarations and edges created from method use. Then the tool generated a control flow graph with the goal to find a path through the AST (a maze) from source to sink. The algorithm is to look at adjacent nodes to see if any are "scary" (a vulnerability), using heuristics for search order. The tool, called "Scat" (Static Code Analysis Tool), currently looks for C# vulnerabilities and some simple PHP. Later, he plans to add more PHP, then JSP and Java. For more information see his posts in Security Innovation blog and NRefactory on GitHub. Mask Your Checksums—The Gorry Details Eric (XlogicX) Davisson Eric (XlogicX) Davisson Sometimes in emailing or posting TCP/IP packets to analyze problems, you may want to mask the IP address. But to do this correctly, you need to mask the checksum too, or you'll leak information about the IP. Problem reports found in stackoverflow.com, sans.org, and pastebin.org are usually not masked, but a few companies do care. If only the IP is masked, the IP may be guessed from checksum (that is, it leaks data). Other parts of packet may leak more data about the IP. TCP and IP checksums both refer to the same data, so can get more bits of information out of using both checksums than just using one checksum. Also, one can usually determine the OS from the TTL field and ports in a packet header. If we get hundreds of possible results (16x each masked nibble that is unknown), one can do other things to narrow the results, such as look at packet contents for domain or geo information. With hundreds of results, can import as CSV format into a spreadsheet. Can corelate with geo data and see where each possibility is located. Eric then demoed a real email report with a masked IP packet attached. Was able to find the exact IP address, given the geo and university of the sender. Point is if you're going to mask a packet, do it right. Eric wouldn't usually bother, but do it correctly if at all, to not create a false impression of security. Adventures with weird machines thirty years after "Reflections on Trusting Trust" Sergey Bratus Sergey Bratus, Dartmouth College (and Julian Bangert and Rebecca Shapiro, not present) "Reflections on Trusting Trust" refers to Ken Thompson's classic 1984 paper. "You can't trust code that you did not totally create yourself." There's invisible links in the chain-of-trust, such as "well-installed microcode bugs" or in the compiler, and other planted bugs. Thompson showed how a compiler can introduce and propagate bugs in unmodified source. But suppose if there's no bugs and you trust the author, can you trust the code? Hell No! There's too many factors—it's Babylonian in nature. Why not? Well, Input is not well-defined/recognized (code's assumptions about "checked" input will be violated (bug/vunerabiliy). For example, HTML is recursive, but Regex checking is not recursive. Input well-formed but so complex there's no telling what it does For example, ELF file parsing is complex and has multiple ways of parsing. Input is seen differently by different pieces of program or toolchain Any Input is a program input executes on input handlers (drives state changes & transitions) only a well-defined execution model can be trusted (regex/DFA, PDA, CFG) Input handler either is a "recognizer" for the inputs as a well-defined language (see langsec.org) or it's a "virtual machine" for inputs to drive into pwn-age ELF ABI (UNIX/Linux executible file format) case study. Problems can arise from these steps (without planting bugs): compiler linker loader ld.so/rtld relocator DWARF (debugger info) exceptions The problem is you can't really automatically analyze code (it's the "halting problem" and undecidable). Only solution is to freeze code and sign it. But you can't freeze everything! Can't freeze ASLR or loading—must have tables and metadata. Any sufficiently complex input data is the same as VM byte code Example, ELF relocation entries + dynamic symbols == a Turing Complete Machine (TM). @bxsays created a Turing machine in Linux from relocation data (not code) in an ELF file. For more information, see Rebecca "bx" Shapiro's presentation from last year's Toorcon, "Programming Weird Machines with ELF Metadata" @bxsays did same thing with Mach-O bytecode Or a DWARF exception handling data .eh_frame + glibc == Turning Machine X86 MMU (IDT, GDT, TSS): used address translation to create a Turning Machine. Page handler reads and writes (on page fault) memory. Uses a page table, which can be used as Turning Machine byte code. Example on Github using this TM that will fly a glider across the screen Next Sergey talked about "Parser Differentials". That having one input format, but two parsers, will create confusion and opportunity for exploitation. For example, CSRs are parsed during creation by cert requestor and again by another parser at the CA. Another example is ELF—several parsers in OS tool chain, which are all different. Can have two different Program Headers (PHDRs) because ld.so parses multiple PHDRs. The second PHDR can completely transform the executable. This is described in paper in the first issue of International Journal of PoC. Conclusions trusting computers not only about bugs! Bugs are part of a problem, but no by far all of it complex data formats means bugs no "chain of trust" in Babylon! (that is, with parser differentials) we need to squeeze complexity out of data until data stops being "code equivalent" Further information See and langsec.org. USENIX WOOT 2013 (Workshop on Offensive Technologies) for "weird machines" papers and videos.

    Read the article

< Previous Page | 43 44 45 46 47 48 49 50 51 52 53 54  | Next Page >