Search Results

Search found 44517 results on 1781 pages for 'google desktop search'.

Page 472/1781 | < Previous Page | 468 469 470 471 472 473 474 475 476 477 478 479  | Next Page >

  • Search XDocument with LINQ with out knowing the Namespace

    - by BarDev
    Is there a way to search a XDocument without knowing the Namespace. I have a process that logs all soap requests and encrypts the sensitive data. I want to find any elements based on name. Something like, give me all elements where the name is CreditCard. I don't care what the namespace is. My problem seems to be with LINQ and requiring a xml namespace. I have other processes that retrieve values from XML, but I know the namespace for these other process. XDocument xDocument = XDocument.Load(@"C:\temp\Packet.xml"); XNamespace xNamespace = "http://CompanyName.AppName.Service.Contracts"; var elements = xDocument.Root.DescendantsAndSelf().Elements().Where(d = d.Name == xNamespace + "CreditCardNumber"); But what I really want, is to have the ability to search xml without knowing about namespaces, something like this: XDocument xDocument = XDocument.Load(@"C:\temp\Packet.xml"); var elements = xDocument.Root.DescendantsAndSelf().Elements().Where(d = d.Name == "CreditCardNumber") But of course this will not work be cause I do no have a namespace. BarDev

    Read the article

  • Sending error logs through C# desktop application

    - by Mustafa A. Jabbar
    Dear All, lately our customers are experiencing unexpected crashes. We are already logging the errors on their local machines. Is there a mechanism to enable them to "send error log" somehow when the application crashes or when unexpected behavior takes place? In other word how do I know that the application freezed or hung or crashed so I can send something, and override the normal "not responding" windows message? Regards,

    Read the article

  • multiple keys and values with google-collections

    - by flash3000
    Hello, I would like use google-collection in order to save the following file in a Hash with multiple keys and values Key1_1, Key2_1, Key3_1, data1_1, 0, 0 Key1_2, Key2_2, Key3_2, data1_2, 0, 0 Key1_3, Key2_3, Key3_3, data1_3, 0, 0 Key1_4, Key2_4, Key3_4, data1_4, 0, 0 The first three columns are the different keys and the last two integer are the two different values. I have already prepare a code which spilt the lines in chunks. import java.io.BufferedReader; import java.io.FileNotFoundException; import java.io.FileReader; import java.io.IOException; public class HashMapKey { public static void main(String[] args) throws FileNotFoundException, IOException { String inputFile = "inputData.txt"; BufferedReader br = new BufferedReader(new FileReader(inputFile)); String strLine; while ((strLine = br.readLine()) != null) { String[] line = strLine.replaceAll(" ", "").trim().split(","); for (int i = 0; i < line.length; i++) { System.out.print("[" + line[i] + "]"); } System.out.println(); } } } Unfortunately, I do not know how to save these information in google-collection? Thank you in advance. Best regards,

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Where do I define a group policy that will set a users desktop background color to green the first time they log in?

    - by Tyler
    Servers: W2k8 R2 x64 Desktops: Win7 Pro x64 Our current group policy uses a custom ADM file to define certain properties of the desktop (Background Image (centered), Background Color is green (00 74 00)). This policy works for us, but the down-side is that policies defined in our custom ADM are only applied after a GPUpdate /Force is applied. We would like these desktop theme settings to be applied the first time the user logs onto the computer. I've been working on a new policy that forces the computer to wait for the network when the user logs on to handle folder redirection. The reason for writing the new policy was to resolve the issue that a user needs to run GPupdate /Force the first time they log in, so it doesn't make sense for me to implement the new policy if there is still something that requires GPUpdate /Force to get the user in the state that we want them. I've moved the setting for background image out into Admin Templates- Desktop- Desktop- "Desktop Wallpaper" so this is now being set properly when the user first logs in. Now I'm left with a black background until I force a group policy update. I have tried to play around with setting a default "Theme" and had limited success; this was not reliable enough to call a solution. I suppose I could set the background color with a script? Any thoughts? It feels like I'm missing something obvious, or that this should be much easier than it is.

    Read the article

  • Scribe-LinkedIn Search API

    - by Rupeshit
    Hi folks, I want to fetch data from the LinkedIn API for that I am using the Scribe library.All requests are giving me data as expected but when I tried two facet in the url then scribe is not able to get data from LinkedIn API. If I gave this URL : http://api.linkedin.com/v1/people-search?facets=location,network&facet=location,in:0 then it gives me proper result but if I entered this URL: http://api.linkedin.com/v1/people-search?facets=location,network&facet=location,in:0&facet=network,F i.e. URL containing multiple facets then it gives me this output: <?xml version="1.0" encoding="UTF-8" standalone="yes"?> <error> <status>401</status> <timestamp>1292487039516</timestamp> <error-code>0</error-code> <message> [unauthorized].OAU:CiEgwWDkA5BFpNrc0RfGyVuSlOh4tig5kOTZ9q97qcXNrFl7zqk- Ts7DqRGaKDCV|94f13544-9844-41eb-9d53-8fe36535bbc3|*01|*01:1292487039:VseHXaJXM2gerxJyn6kHhIka7zw=</message> </error> Any kind of help to solve this will be appreciated.Thanks.

    Read the article

  • Explaining verity index and document search limits

    - by Ahmad
    As present, we currently have a CF8 standard edition server which have some limitations around verity indexing. According to Adobe Verity Server has the following document search limits (limits are for all collections registered to Verity Server): - 10,000 documents for ColdFusion Developer Edition - 125,000 documents for ColdFusion Standard Edition - 250,000 documents for ColdFusion Enterprise Edition We have now reached a stage where the server wide number of documents indexed exceed 125k. However, the largest verity collection consists of about 25k documents(and this is expected to grow). Only one collection is ever searched at a time. In my understanding, this means that I can still search an entire collection with no restrictions. Is this correct? Or does it mean that only documents that were indexed across all collection prior to reaching the limit are actually searchable? We are considering moving to CF9 standard as a solution to this and to use the Solr solution which has no restrictions. The coldfusionjedi highlights some differences between Verity and Solr. However, before we upgrade I am trying to gain a clearer understanding of this before we commit to an upgrade. Can someone provide me a clear explanation as to what this means and how it actually affects verity searching and indexing?

    Read the article

  • Configuring terminal server and Remote desktop

    - by user311130
    I have a WinServer 2008 machine with 8 local users on it. Basically I want to connect all of them remotely and simultaneously. I read that I should use Terminal server. I want to write a c# code (or use some code from the net) that configures the number of possible remotely and simultaneously connected local users to TS to be some N. Is it even possible? Is it limited from the first place to some value? connects the N local users simultaneously to the TS.

    Read the article

  • really weird DNS problem in Ubuntu {after one month, seems like ISP problem}

    - by OmniWired
    Hello everyone. I been having this random dns problem, in Ubuntu 10.04 and in 10.10 it started about 2 weeks ago after (I believe) an update. Basically when I go to a website randomly I get that the website I'm visiting is not available ("Oops! Google Chrome could not connect to ..." & "This webpage is not available."). I tested with Chromium "7.0.515.0 (58587)" and Firefox minefield (4.0ish) and 3.6.9. I did these 4 things already: /etc/default/grub GRUB_CMDLINE_LINUX="ipv6.disable=1" and this: /etc/sysctl.conf net.ipv6.conf.all.disable_ipv6 = 1 net.ipv6.conf.default.disable_ipv6 = 1 net.ipv6.conf.lo.disable_ipv6 = 1 *disabling Chromium DNS pre-fetching *using Google and OpenDNS servers as well as ISP DNS servers. But didn't improve, also no other computers in my network have the same problem. All computer wired to the same router. I'm a software engineer that run out of ideas, please help me. Thanks in advance. UPDATE: some programs (synaptic / firefox update/ vuze(azureus)) say connection refused for the error. Most of the time a second try will fix the "refusal". UPDATE2: I found out with Wireshark, that everytime I have this problem i've got this 192.168.0.10 8.8.8.8 ICMP Destination unreachable (Port unreachable) Confirmed an ISP error. ISP;Speedy Location: Argentina, Buenos Aires (capital Federal) Area.

    Read the article

  • Creating stored procedure having different WHERE clause on different search criteria without putting

    - by Muhammad Kashif Nadeem
    Is there any alternate way to create stored procedure without putting all query in one long string if criteria of WWHERE clause can be different. Suppose I have Orders table I want to create stored procedure on this table and there are three column on which I wnat to filter records. 1- CustomerId, 2- SupplierId, 3- ProductId. If user only give CustomerId in search criteria then query should be like following SELECT * FROM Orders WHERE Orders.CustomerId = @customerId And if user only give ProductId in search criteria then query should be like following SELECT * FROM Orders WHERE Orders.ProductId = @productId And if user only all three CustomerId, ProductId, and SupplierId is given then all three Ids will be used in WHERE to filter. There is also chance that user don't want to filter record then query should be like following SELCT * FROM Orders Whenever I have to create this kind of procedure I put all this in string and use IF conditions to check if arguments (@customeId or @supplierId etc) has values. I use following method to create procedure DECLARE @query VARCHAR(MAX) DECLARE @queryWhere VARCHAR(MAX) SET @query = @query + 'SELECT * FROM Orders ' IF (@originationNumber IS NOT NULL) BEGIN BEGIN SET @queryWhere =@queryWhere + ' Orders.CustomerId = ' + CONVERT(VARCHAR(100),@customerId) END END IF(@queryWhere <> '') BEGIN SET @query = @query+' WHERE ' + @queryWhere END EXEC (@query) Thanks.

    Read the article

  • C# configuring terminal server and Remote desktop

    - by user311130
    hello everybody, I have a WinServer 2008 machine with 8 local users on it. Basically I want to connect all of them remotely and simultaneously. I read that I should use Terminal server. I want to write a c# code (or use some code from the net) that configures the number of possible remotely and simultaneously connected local users to TS to be some N. Is it even possible? Is it limited from the first place to some value? connects the N local users simultaneously to the TS. Could someone please help me out? cheers to all,

    Read the article

  • Content search through source code in finder

    - by gf
    I am using OSX 10.6 and want to have content searches in finder for the source code types i use. This suggests a (10.4 only?) solution, but although i have the developer tools installed i don't have /Library/Spotlight/SourceCode.mdimporter. Is there a different procedure for Snow Leopard or did i miss something?

    Read the article

  • Search for index.php and index.html and replace string

    - by Jonas
    Hello. I recently had some sort of Malware on my computer that added to all index.php and index.html ON THE WEBSERVER! the following string(s): echo "<iframe src=\"http://fabujob.com/?click=AD4A4\" width=1 height=1 style=\"visibility:hidden;position:absolute\"></iframe>"; echo "<iframe src=\"http://fabujob.com/?click=AC785\" width=1 height=1 style=\"visibility:hidden;position:absolute\"></iframe>"; So the parameter after "click=" always changes. These two were only examples. Is there a way to do that quick and fast? . . EDIT: It is on my webserver, so no use of find...

    Read the article

  • php scandir --> search for files/directories

    - by Peter
    Hi! I searched before I ask, without lucky.. I looking for a simple script for myself, which I can search for files/folders. Found this code snippet in the php manual (I think I need this), but it is not work for me. "Was looking for a simple way to search for a file/directory using a mask. Here is such a function. By default, this function will keep in memory the scandir() result, to avoid scaning multiple time for the same directory." <?php function sdir( $path='.', $mask='*', $nocache=0 ){ static $dir = array(); // cache result in memory if ( !isset($dir[$path]) || $nocache) { $dir[$path] = scandir($path); } foreach ($dir[$path] as $i=>$entry) { if ($entry!='.' && $entry!='..' && fnmatch($mask, $entry) ) { $sdir[] = $entry; } } return ($sdir); } ?> Thank you for any help, Peter

    Read the article

  • OS X, Chrome, and Spaces annoyance

    - by David Hollman
    Here's my problem: I use Google Chrome as my web browser on MacOS X Snow Leopard. I am a keyboard shortcut addict, and I use QuickSilver to create keyboard shortcuts for anything I can. One of the most common things that I do is to open a new web browser window. But I use Spaces frequently to partition my tasks that I am currently working on, and when I open a web browser or web page with a QuickSilver trigger, spaces switches to the last space that I used Chrome on and opens a new tab, which often distracts me for hours because it brings me to a different space and thus a different task. I can fix this by right-clicking on the Google Chrome icon and clicking the "New Window" option, which opens a new window on the current space. I have tried to compose an AppleScript to do something like this, with no success. It has become a serious problem. Back when I used Firefox, I solved the problem by changing a preference item that says "Always open pop-up links in a new window" or something like that, which was kind of a sledge hammer approach, but it worked. I can always go back to Firefox, but I thought I'd ask my question here first. Anyone with any ideas?

    Read the article

  • Program for remove exact duplicate files while caching search results

    - by John Thomas
    We need a Windows 7 program to remove/check the duplicates but our situation is somewhat different than the standard one for which there are enough programs. We have a fairly large static archive (collection) of photos spread on several disks. Let's call them Disk A..M. We have also some disks (let's call them Disk 1..9) which contain some duplicates which are to be found on disks A..M. We want to add to our collection new disks (N, O, P... aso.) which will contain the photos from disks 1..9 but, of course, we don't want to have any photos two (or more) times. Of course, theoretically, the task can be solved with a regular file duplicate remover but the time needed will be very big. Ideally, AFAIS now, the real solution would be a program which will scan the disks A..M, store the file sizes/hashes of the photos in an indexed database/file(s) and will check the new disks (1..9) against this database. However I have hard time to find such a program (if exists). Other things to note: we consider that the Disks A..M (the collection) doesn't have any duplicates on them the file names might be changed we aren't interested in approximated (fuzzy) comparison which can be found in some photo comparing programs. We hunt for exact duplicate files. we aren't afraid of command line. :-) we need to work on Win7/XP we prefer (of course) to be freeware TIA for any suggestions, John Th.

    Read the article

  • Match entities fulfilling filter (strict superset of search)

    - by Jon
    I have an entity (let's say Person) with a set of arbitrary attributes with a known subset of values. I need to search for all of these entities that match all my filter conditions. That is, given a set of Attributes A, I need to find all people that have a set of Attributes that are a superset of A. For example, my table structures look like this: Person: id | name 1 | John Doe 2 | Jane Roe 3 | John Smith Attribute: id | attr_name 1 | Sex 2 | Eye Color ValidValue: id | attr_id | value_name 1 | 1 | Male 2 | 1 | Female 3 | 2 | Blue 4 | 2 | Green 5 | 2 | Brown PersonAttributes id | person_id | attr_id | value_id 1 | 1 | 1 | 1 2 | 1 | 2 | 3 3 | 2 | 1 | 2 4 | 2 | 2 | 4 5 | 3 | 1 | 1 6 | 3 | 2 | 4 In JPA, I have entities built for all of these tables. What I'd like to do is perform a search for all entities matching a given set of attribute-value pairs. For instance, I'd like to be able to find all males (John Doe and John Smith), all people with green eyes (Jane Roe or John Smith), or all females with green eyes (Jane Roe). I see that I can already take advantage of the fact that I only really need to match on value_id, since that's already unique and tied to the attr_id. But where can I go from there? I've been trying to do something like the following, given that the ValidValue is unique in all cases: select distinct p from Person p join p.personAttributes a where a.value IN (:values) Then I've tried putting my set of required values in as "values", but that gives me errors no matter how I try to structure that. I also have to get a little more complicated, as follows, but at this point I'd be happy with solving the first problem cleanly. However, if it's possible, the Attribute table actually has a field for default value: id | attr_name | default_value 1 | Sex | 1 2 | Eye Color | 5 If the value you're searching on happens to be the default value, I want it to return any people that have no explicit value set for that attribute, because in the application logic, that means they inherit the default value. Again, I'm more concerned about the primary question, but if someone who can help with that also has some idea of how to do this one, I'd be extremely grateful.

    Read the article

  • Sharepoint-Log on to Remote Desktop-Webpart

    - by Hari Gillala
    Hi, I have to develop a webpart which will be deployed in the live Environment. I have to login to a remote server(windows 2003) and open up Sql Management Studio and Log on to the another server(SQL server using the IP address). I have to open a specific store procedure and change one of the parameter to true and exceute the stored Procedure. I know it is very easy to accomplish but, where do I start? Could anybody direct me in right direction Please? I will be using c#.net and VS 2008 to develop this custom webpart. Many Thanks Hari Gillala

    Read the article

  • Remove undesired indexed keywords from Sql Server FTS Index

    - by Scott
    Could anyone tell me if SQL Server 2008 has a way to prevent keywords from being indexed that aren't really relevant to the types of searches that will be performed? For example, we have the IFilters for PDF and Word hooked in and our documents are being indexed properly as far as I can tell. These documents, however, have lots of numeric values in them that people won't really be searching for or bring back meaningful results. These are still being indexed and creating lots of entries in the full text catalog. Basically we are trying to optimize our search engine in any way we can and assumed all these unnecessary entries couldn't be helping performance. I want my catalog to consist of alphabetic keywords only. The current iFilters work better than I would be able to write in the time I have but it just has more than I need. This is an example of some of the terms from sys.dm_fts_index_keywords_by_document that I want out: $1,000, $100, $250, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 129, 13.1, 14, 14.12, 145, 15, 16.2, 16.4, 18, 18.1, 18.2, 18.3, 18.4, 18.5 These are some examples from the same management view that I think are desirable for keeping and searching on: above, accordingly, accounts, add, addition, additional, additive Any help would be greatly appreciated!

    Read the article

  • PubSubHubBub Hubs

    - by PartlyCloudy
    Hi, I'm currently building a live web application based upon the PubSubHubBub protocol. However, I encountered several issues. First, I'm in search of a hub application that I can run on my server. There are several applications, but most of them are not mature yet, or they don't support the 0.3 spec. The official google hub runs on the Google App Engine and can even be executed locally. Unfortunately, "Tasks will not run automatically. Push the 'Run' button to execute each task." This behaviour is useful for debugging and understanding the workflow, but in some live tests, it would be nice not to invoke all tasks manually. Is there a way to tweak the local app engine due automatically run tasks? Next, I have a question concerning the spec itself. The Google reference implementation provides the initial publish method bound to the outpoint uri + /publish. But this is not reflected in the specs. So are there any mature hubs that can be run locally for debugging? Or are there ways to configure the offical google app engine hub to run locally and to execute tasks directly? Thanks in advance

    Read the article

  • make desktop sms application using windows mobile 6.1

    - by Amit Kumar Jha
    hey all, I have to make a SMS sending application in .NET which uses a connected CDMA based Windows mobile 6.1 device to send sms. The problem is I have never worked on smartphone app development so don't have any idea about how should i go about it. Couldn't find anything useful on SO or elsewhere, so please guide me in the right direction. Thanks in advance to all those who reply. P.S.:I posted a similar question regarding blackberry here

    Read the article

  • Text box creates gap when floated left in IE7

    - by Sixfoot Studio
    Hi, I've got a left rounded corner box - textbox - right rounded corner box which all make up part of a search box. All's well in FF, Chrome, IE8 but not IE7. I've checked it using the debug tool and and I have tried a number of options, none of which want to work at the moment, so I am hoping someone might know what this issue (bug) might be please? Here's a snippet of my code: <div class="roundBox4"> <img src="../App_Themes/MyChoice2010/Images/reality-box-top.gif" width="228" height="8" /><img src="../App_Themes/MyChoice2010/Images/reality-box-locate.gif" width="228" height="49" /> <asp:ContentPlaceHolder ID="Box4Content" runat="server"> </asp:ContentPlaceHolder> <div class="locateABroker"> <img src="../App_Themes/MyChoice2010/Images/locate-broker-left.gif" class="locateBrokerLeft" height="19" width="3" /><asp:TextBox ID="TextBox1" CssClass="locateBrokerCenter" runat="server"></asp:TextBox><img src="../App_Themes/MyChoice2010/Images/locate-broker-right.gif" height="19" width="3" class="locateBrokerRight" /> <a href="" class="locateBrokerSubmit">Submit</a><img src="../App_Themes/MyChoice2010/Images/box-arrow.gif" class="linkArrow" width="8" height="14" /> </div>

    Read the article

< Previous Page | 468 469 470 471 472 473 474 475 476 477 478 479  | Next Page >