Search Results

Search found 35094 results on 1404 pages for 'post build'.

Page 474/1404 | < Previous Page | 470 471 472 473 474 475 476 477 478 479 480 481  | Next Page >

  • Extending spring based app

    - by pitr
    I have a spring-based Web Service. I now want to build a sort of plugin for it that extends it with beans. What I have now in web.xml is: <context-param> <param-name>contextConfigLocation</param-name> <param-value>/WEB-INF/classes/*-configuration.xml</param-value> </context-param> My core app has main-configuration.xml which declares its beans. My plugin app has plugin-configuration.xml which declares additional beans. Now when I deploy, my build deploys plugin.jar into /WEB-INF/lib/ and copies plugin-configuration.xml into /WEB-INF/classes/ all under main.war. This is all fine (although I think there could be a better solution), but when I develop the plugin, I don't want to have two projects in Eclipse with dependencies. I wish to have main.jar that I include as a library. However, web.xml from main.jar isn't automatically discovered. How can I do this? Bean injection? Bean discovery of some sort? Something else? Note: I expect to have multiple different plugins in production, but development of each of them will be against pure main.jar Thank you.

    Read the article

  • What is the relationship between Turing Machine & Modern Computer ? [closed]

    - by smwikipedia
    I heard a lot that modern computers are based on Turing machine. I just cannot build a bridge between a conceptual Turing Machine and a modern computer. Could someone help me build this bridge? Below is my current understanding. I think the computer is a big general-purpose Turing machine. Each program we write is a small specific-purpose Turing machine. The classical Turing machine do its job based on the input and its current state inside and so do our programs. Let's take a running program (a process) as an example. We know that in the process's address space, there's areas for stack, heap, and code. A classical Turing machine doesn't have the ability to remember many things, so we borrow the concept of stack from the push-down automaton. The heap and stack areas contains the state of our specific-purpose Turing machine (our program). The code area represents the logic of this small Turing machine. And various I/O devices supply input to this Turing machine.

    Read the article

  • Why won't .attr('checked','checked') set?

    - by Jason
    I have the following snippet of code (I'm using jQuery 1.4.2): $.post('/Ads/GetAdStatsRow/', { 'ad_id': id }, function(result) { $('#edit_ads_form tbody').prepend(result); $(result).find('td.select-ad input').attr('checked','checked').click(); }); Assume that the post works correctly and returns a correct pre-built <tr> with some <td>s. Here's the weirdness: the $(result).find() line finds the correct input (which is a checkbox, as it's the only input in the cell) and runs the chained click() function correctly, but it REFUSES to set the box as checked, which I need to happen. Here's a crazy twist, too... when I get super specific and change the $(result).find() line to this (the id of the checkbox): $('#ad_' + id).click(); It checks the box, but doesn't run the click() function! If I set it to $('#ad_' + id).attr('checked','checked').click(); it runs the click function as though the box were checked, but the box remains unchecked, and if I do $('#ad_' + id).click().attr('checked','checked'); it does nothing at all. What in the world could be the matter with this? I'm running out of hair.... Thanks!

    Read the article

  • Globally disabling FxCop errors in TeamCity

    - by Dave
    Ok, another FxCop question for today. I've read the arguments regarding the IdentifiersShouldBeCasedCorrectly rule, and whether or not it should be "XML" or "Xml". Well, I'm an "XML" guy and I want to stay that way. Therefore, I do not want FxCop to correct me all of the time. I have been using the SuppressMessage attribute only for specific cases. I have also used FxCop to mark a ton of errors and copied them as "module" level SuppressMessage statements into assemblyinfo.cs. That works pretty well. However, now I really want to globally disable this annoying IdentifiersShouldBeCasedCorrectly rule. I'm using TeamCity 5.0.3, and am not using an FxCop project file (however, I could do this). I was hoping that I could pass a parameter to FxCopCmd to tell it to ignore this error, but it doesn't look that way from the documentation. So... is there anything I can do short of creating an FxCop project file on the TeamCity build server and using it for the FxCop build runner?

    Read the article

  • form with multiple upload but allow no upload on edit problems

    - by minus4
    hiya i have a section that when created takes in images, however when you edit this item i dont want them to re-upload none changes images just to change a description or name. i have created this that deals with uploading files: public void UploadFiles(string currentFileName, FormCollection form) { // loop through all files in form post foreach (string file in Request.Files) { HttpPostedFileBase hpf = Request.Files[file]; // if no file is uploaded, we could be editing so set to current value if (hpf.ContentLength == 0) { form[file] = currentFileName; } else { //rename the file unique so we dont clash with names var filename = hpf.FileName.Replace(" ", "_").Replace(".", DateTime.Now.Date.Ticks + "."); UploadFileName = filename; hpf.SaveAs(Server.MapPath("~/Content/custom/" + filename)); // set the name of the file in our post to the new name form[file] = UploadFileName; } } // ensure value is still sent when no files are uploaded on edit if(Request.Files.Count <= 0) { UploadFileName = currentFileName; } } all works fine when only one image is required (CurrentFileName), however there is now a new image available taking it to a total of 2 images in the database therefor currentFileName is obsolete. has anyone tackled this and how as i have hit a wall with this one. thought of string[] currentFiles but cant see how to match this into string file in Request.Files. if it helps i am also working with models for the form so i could pass over the model but i dont think your able to do model.file without some kind of reflection. help much appreciated. thanks

    Read the article

  • Ideal Multi-Developer Lamp Stack?

    - by devians
    I would like to build an 'ideal' lamp development stack. Dual Server (Virtualised, ESX) Apache / PHP on one, Databases (MySQL, PgSQL, etc) on the other. User (Developer) Manageable mini environments, or instance. Each developer instance shares the top level config (available modules and default config etc) A developer should have control over their apache and php version for each project. A developer might be able to change minor settings, ie magicquotes on for legacy code. Each project would determine its database provider in its code The idea is that it is one administrate-able server that I can control, and provide globally configured things like APC, Memcached, XDebug etc. Then by moving into subsets for each project, i can allow my users to quickly control their environments for various projects. Essentially I'm proposing the typical system of a developer running their own stack on their own machine, but centralised. In this way I'd hope to avoid problems like Cross OS code problems, database inconsistencies, slightly different installs producing bugs etc. I'm happy to manage this in custom builds from source, but if at all possible it would be great to have a large portion of it managed with some sort of package management. We typically use CentOS, so yum? Has anyone ever built anything like this before? Is there something turnkey that is similar to what I have described? Are there any useful guides I should be reading in order to build something like this?

    Read the article

  • How to register assemblies using Windsor in ASP.NET MVC

    - by oz
    This is how my project looks: TestMvc (my web project) has a reference to the DomainModel.Core assembly where my interfaces and business objects reside. The class that implements the interfaces in DomainModel.Core is in a different assembly called DomainModel.SqlRepository; the reason behind it is that if I just want to create a repository for Oracle I just have to deploy the new dll, change the web.config and be done with it. When I build the solution, if I look at the \bin folder of my TestMvc project, there is no reference to the DomainModel.SqlRepository, which makes sense because it's not being reference anywhere. Problem arises when my windsor controller factory tries to resolve that assembly, since it's not on the \bin directory. So is there a way to point windsor to a specific location, without adding a reference to that assembly? My web.config looks like this: <component id="UserService" service="TestMvc.DomainModel.Core.Interface, TestMvc.DomainModel.Core" type="TestMvc.DomainModel.SqlRepository.Class, TestMvc.DomainModel.SqlRepository" lifestyle="PerWebRequest" /> There's many ways around this, like copying the dll as part of the build, add the reference to the project so it will get copied to the \bin folder or install it on the GAC and add an assembly reference in the web.config. I guess my question is specific to Windsor, to see if I can give the location of my assembly and it will resolve it.

    Read the article

  • Problem in creating win installer in i

    - by user356108
    Hi Everyone, I am trying to create an executable file (.exe) of iReport with my module included in it. While I run the target the create-iReport-distro-win-installer, I am getting the following error. Note: I am using netbeans 6.5.1 java.io.IOException: Cannot run program "makensis" (in directory "C:\Program Files\NetBeans 6.5.1\iReport-3.7.2-src"): CreateProcess error=2, The system cannot find the file specified at java.lang.ProcessBuilder.start(ProcessBuilder.java:459) at java.lang.Runtime.exec(Runtime.java:593) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) at org.apache.tools.ant.taskdefs.Execute$Java13CommandLauncher.exec(Execute.java:832) at org.apache.tools.ant.taskdefs.Execute.launch(Execute.java:447) at org.apache.tools.ant.taskdefs.Execute.execute(Execute.java:461) at net.sf.nsisant.Task.execute(Task.java:205) at org.apache.tools.ant.UnknownElement.execute(UnknownElement.java:288) at sun.reflect.GeneratedMethodAccessor97.invoke(Unknown Source) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) at org.apache.tools.ant.dispatch.DispatchUtils.execute(DispatchUtils.java:106) at org.apache.tools.ant.Task.perform(Task.java:348) at org.apache.tools.ant.Target.execute(Target.java:357) at org.apache.tools.ant.Target.performTasks(Target.java:385) at org.apache.tools.ant.Project.executeSortedTargets(Project.java:1337) at org.apache.tools.ant.Project.executeTarget(Project.java:1306) at org.apache.tools.ant.helper.DefaultExecutor.executeTargets(DefaultExecutor.java:41) at org.apache.tools.ant.Project.executeTargets(Project.java:1189) at org.apache.tools.ant.module.bridge.impl.BridgeImpl.run(BridgeImpl.java:273) at org.apache.tools.ant.module.run.TargetExecutor.run(TargetExecutor.java:499) at org.netbeans.core.execution.RunClassThread.run(RunClassThread.java:151) Caused by: java.io.IOException: CreateProcess error=2, The system cannot find the file specified at java.lang.ProcessImpl.create(Native Method) at java.lang.ProcessImpl.<init>(ProcessImpl.java:81) at java.lang.ProcessImpl.start(ProcessImpl.java:30) at java.lang.ProcessBuilder.start(ProcessBuilder.java:452) ... 24 more C:\Program Files\NetBeans 6.5.1\iReport-3.7.2-src\build.xml:327: Command failed: 'makensis /DPRODUCT_VERSION=3.7.2 /DPRODUCT_NAME=iReport /DPRODUCT_WEB_SITE=http://ireport.sourceforge.net "C:\Program Files\NetBeans 6.5.1\iReport-3.7.2-src\etc\iReportInstaller.nsi"' BUILD FAILED (total time: 1 minute 22 seconds)

    Read the article

  • ManyToManyField "table exist" error on syncdb

    - by Derek Reynolds
    When I include a ModelToModelField to one of my models the following error is thrown. Traceback (most recent call last): File "manage.py", line 11, in <module> execute_manager(settings) File "/Library/Python/2.6/site-packages/django/core/management/__init__.py", line 362, in execute_manager utility.execute() File "/Library/Python/2.6/site-packages/django/core/management/__init__.py", line 303, in execute self.fetch_command(subcommand).run_from_argv(self.argv) File "/Library/Python/2.6/site-packages/django/core/management/base.py", line 195, in run_from_argv self.execute(*args, **options.__dict__) File "/Library/Python/2.6/site-packages/django/core/management/base.py", line 222, in execute output = self.handle(*args, **options) File "/Library/Python/2.6/site-packages/django/core/management/base.py", line 351, in handle return self.handle_noargs(**options) File "/Library/Python/2.6/site-packages/django/core/management/commands/syncdb.py", line 93, in handle_noargs cursor.execute(statement) File "/Library/Python/2.6/site-packages/django/db/backends/util.py", line 19, in execute return self.cursor.execute(sql, params) File "/Library/Python/2.6/site-packages/django/db/backends/mysql/base.py", line 84, in execute return self.cursor.execute(query, args) File "build/bdist.macosx-10.6-universal/egg/MySQLdb/cursors.py", line 173, in execute File "build/bdist.macosx-10.6-universal/egg/MySQLdb/connections.py", line 36, in defaulterrorhandler _mysql_exceptions.OperationalError: (1050, "Table 'orders_proof_approved_associations' already exists") Field definition: approved_associations = models.ManyToManyField(Association) Everything works fine when I remove the field, and the table is no where in site. Any thoughts as to why this would happen?

    Read the article

  • Using embedded standard HTML forms with ASP.NET

    - by RM
    I have a standard aspx page with which I need to add another standard HTML form into and have it submit to another location (external site), however whenever I press the submit button the page seems to do a post back rather than using the sub-forms action url. A mock up of what the form relationships is below. Note in the real deployment the form will be part of a content area of a master page layout, so the form needs to submit independantly from the master page form. <html xmlns="http://www.w3.org/1999/xhtml" > <head runat="server"> <title>Untitled Page</title> </head> <body> <form id="form1" runat="server"> <div> <form id="subscribe_form" method="post" action="https://someothersite.com" name="em_subscribe_form" > <input type="text" id="field1" name="field1" /> <input id="submitsubform" type="submit" value="Submit" /> </form> </div> </form> </body> </html>

    Read the article

  • Why do I get Detached Entity exception when upgrading Spring Boot 1.1.4 to 1.1.5

    - by mmeany
    On updating Spring Boot from 1.1.4 to 1.1.5 a simple web application started generating detached entity exceptions. Specifically, a post authentication inteceptor that bumped number of visits was causing the problem. A quick check of loaded dependencies showed that Spring Data has been updated from 1.6.1 to 1.6.2 and a further check of the change log shows a couple of issues relating to optimistic locking, version fields and JPA issues that have been fixed. Well I am using a version field and it starts out as Null following recommendation to not set in the specification. I have produced a very simple test scenario where I get detached entity exceptions if the version field starts as null or zero. If I create an entity with version 1 however then I do not get these exceptions. Is this expected behaviour or is there still something amiss? Below is the test scenario I have for this condition. In the scenario the service layer that has been annotated @Transactional. Each test case makes multiple calls to the service layer - the tests are working with detached entities as this is the scenario I am working with in the full blown application. The test case comprises four tests: Test 1 - versionNullCausesAnExceptionOnUpdate() In this test the version field in the detached object is Null. This is how I would usually create the object prior to passing to the service. This test fails with a Detached Entity exception. I would have expected this test to pass. If there is a flaw in the test then the rest of the scenario is probably moot. Test 2 - versionZeroCausesExceptionOnUpdate() In this test I have set the version to value Long(0L). This is an edge case test and included because I found reference to Zero values being used for version field in the Spring Data change log. This test fails with a Detached Entity exception. Of interest simply because the following two tests pass leaving this as an anomaly. Test 3 - versionOneDoesNotCausesExceptionOnUpdate() In this test the version field is set to value Long(1L). Not something I would usually do, but considering the notes in the Spring Data change log I decided to give it a go. This test passes. Would not usually set the version field, but this looks like a work-around until I figure out why the first test is failing. Test 4 - versionOneDoesNotCausesExceptionWithMultipleUpdates() Encouraged by the result of test 3 I pushed the scenario a step further and perform multiple updates on the entity that started life with a version of Long(1L). This test passes. Reinforcement that this may be a useable work-around. The entity: package com.mvmlabs.domain; import javax.persistence.Column; import javax.persistence.Entity; import javax.persistence.GeneratedValue; import javax.persistence.GenerationType; import javax.persistence.Id; import javax.persistence.Table; import javax.persistence.Version; @Entity @Table(name="user_details") public class User { @Id @GeneratedValue(strategy=GenerationType.AUTO) private Long id; @Version private Long version; @Column(nullable = false, unique = true) private String username; @Column(nullable = false) private Integer numberOfVisits; public Long getId() { return id; } public void setId(Long id) { this.id = id; } public Long getVersion() { return version; } public void setVersion(Long version) { this.version = version; } public Integer getNumberOfVisits() { return numberOfVisits == null ? 0 : numberOfVisits; } public void setNumberOfVisits(Integer numberOfVisits) { this.numberOfVisits = numberOfVisits; } public String getUsername() { return username; } public void setUsername(String username) { this.username = username; } } The repository: package com.mvmlabs.dao; import org.springframework.data.repository.CrudRepository; import com.mvmlabs.domain.User; public interface UserDao extends CrudRepository<User, Long>{ } The service interface: package com.mvmlabs.service; import com.mvmlabs.domain.User; public interface UserService { User save(User user); User loadUser(Long id); User registerVisit(User user); } The service implementation: package com.mvmlabs.service; import org.springframework.beans.factory.annotation.Autowired; import org.springframework.stereotype.Service; import org.springframework.transaction.annotation.Propagation; import org.springframework.transaction.annotation.Transactional; import org.springframework.transaction.support.TransactionSynchronizationManager; import com.mvmlabs.dao.UserDao; import com.mvmlabs.domain.User; @Service @Transactional(propagation=Propagation.REQUIRED, readOnly=false) public class UserServiceJpaImpl implements UserService { @Autowired private UserDao userDao; @Transactional(readOnly=true) @Override public User loadUser(Long id) { return userDao.findOne(id); } @Override public User registerVisit(User user) { user.setNumberOfVisits(user.getNumberOfVisits() + 1); return userDao.save(user); } @Override public User save(User user) { return userDao.save(user); } } The application class: package com.mvmlabs; import org.springframework.boot.SpringApplication; import org.springframework.boot.autoconfigure.EnableAutoConfiguration; import org.springframework.context.annotation.ComponentScan; import org.springframework.context.annotation.Configuration; @Configuration @ComponentScan @EnableAutoConfiguration public class Application { public static void main(String[] args) { SpringApplication.run(Application.class, args); } } The POM: <?xml version="1.0" encoding="UTF-8"?> <project xmlns="http://maven.apache.org/POM/4.0.0" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://maven.apache.org/POM/4.0.0 http://maven.apache.org/xsd/maven-4.0.0.xsd"> <modelVersion>4.0.0</modelVersion> <groupId>com.mvmlabs</groupId> <artifactId>jpa-issue</artifactId> <version>0.0.1-SNAPSHOT</version> <packaging>jar</packaging> <name>spring-boot-jpa-issue</name> <description>JPA Issue between spring boot 1.1.4 and 1.1.5</description> <parent> <groupId>org.springframework.boot</groupId> <artifactId>spring-boot-starter-parent</artifactId> <version>1.1.5.RELEASE</version> <relativePath /> <!-- lookup parent from repository --> </parent> <dependencies> <dependency> <groupId>org.springframework.boot</groupId> <artifactId>spring-boot-starter-data-jpa</artifactId> </dependency> <dependency> <groupId>org.hsqldb</groupId> <artifactId>hsqldb</artifactId> <scope>runtime</scope> </dependency> <dependency> <groupId>org.springframework.boot</groupId> <artifactId>spring-boot-starter-test</artifactId> <scope>test</scope> </dependency> </dependencies> <properties> <project.build.sourceEncoding>UTF-8</project.build.sourceEncoding> <start-class>com.mvmlabs.Application</start-class> <java.version>1.7</java.version> </properties> <build> <plugins> <plugin> <groupId>org.springframework.boot</groupId> <artifactId>spring-boot-maven-plugin</artifactId> </plugin> </plugins> </build> </project> The application properties: spring.jpa.hibernate.ddl-auto: create spring.jpa.hibernate.naming_strategy: org.hibernate.cfg.ImprovedNamingStrategy spring.jpa.database: HSQL spring.jpa.show-sql: true spring.datasource.url=jdbc:hsqldb:file:./target/testdb spring.datasource.username=sa spring.datasource.password= spring.datasource.driverClassName=org.hsqldb.jdbcDriver The test case: package com.mvmlabs; import org.junit.Assert; import org.junit.Test; import org.junit.runner.RunWith; import org.springframework.beans.factory.annotation.Autowired; import org.springframework.boot.test.SpringApplicationConfiguration; import org.springframework.test.context.junit4.SpringJUnit4ClassRunner; import com.mvmlabs.domain.User; import com.mvmlabs.service.UserService; @RunWith(SpringJUnit4ClassRunner.class) @SpringApplicationConfiguration(classes = Application.class) public class ApplicationTests { @Autowired UserService userService; @Test public void versionNullCausesAnExceptionOnUpdate() throws Exception { User user = new User(); user.setUsername("Version Null"); user.setNumberOfVisits(0); user.setVersion(null); user = userService.save(user); user = userService.registerVisit(user); Assert.assertEquals(new Integer(1), user.getNumberOfVisits()); Assert.assertEquals(new Long(1L), user.getVersion()); } @Test public void versionZeroCausesExceptionOnUpdate() throws Exception { User user = new User(); user.setUsername("Version Zero"); user.setNumberOfVisits(0); user.setVersion(0L); user = userService.save(user); user = userService.registerVisit(user); Assert.assertEquals(new Integer(1), user.getNumberOfVisits()); Assert.assertEquals(new Long(1L), user.getVersion()); } @Test public void versionOneDoesNotCausesExceptionOnUpdate() throws Exception { User user = new User(); user.setUsername("Version One"); user.setNumberOfVisits(0); user.setVersion(1L); user = userService.save(user); user = userService.registerVisit(user); Assert.assertEquals(new Integer(1), user.getNumberOfVisits()); Assert.assertEquals(new Long(2L), user.getVersion()); } @Test public void versionOneDoesNotCausesExceptionWithMultipleUpdates() throws Exception { User user = new User(); user.setUsername("Version One Multiple"); user.setNumberOfVisits(0); user.setVersion(1L); user = userService.save(user); user = userService.registerVisit(user); user = userService.registerVisit(user); user = userService.registerVisit(user); Assert.assertEquals(new Integer(3), user.getNumberOfVisits()); Assert.assertEquals(new Long(4L), user.getVersion()); } } The first two tests fail with detached entity exception. The last two tests pass as expected. Now change Spring Boot version to 1.1.4 and rerun, all tests pass. Are my expectations wrong? Edit: This code saved to GitHub at https://github.com/mmeany/spring-boot-detached-entity-issue

    Read the article

  • Question about registering COM server and Add Reference to it in a C# project

    - by smwikipedia
    I build a COM server in raw C++, here is the procedure: (1) write an IDL file to define the interface and library. (2) use msidl.exe to compile the IDL file to necessary .h, .c, .tlb files. (3) implement the COM server in C++ and build a .dll file. (4) add the following registry entris: [HKEY_CLASSES_ROOT\RawComCarLib.ComCar.1\CurVer] @="RawComCarLib.ComCar.1" ;CLSID [HKEY_CLASSES_ROOT\CLSID{6CC26343-167B-4CF2-9EDF-99368A62E91C}] @="RawComCarLib.ComCar.1" [HKEY_CLASSES_ROOT\CLSID{6CC26343-167B-4CF2-9EDF-99368A62E91C}\InprocServer32] @="D:\com\Project01.dll" [HKEY_CLASSES_ROOT\CLSID{6CC26343-167B-4CF2-9EDF-99368A62E91C}\ProgID] @="RawComCarLib.ComCar.1" [HKEY_CLASSES_ROOT\CLSID{6CC26343-167B-4CF2-9EDF-99368A62E91C}\TypeLib] @="{E5C0EE8F-8806-4FE3-BC0E-3A56CFB38BEE}" ;TypeLib [HKEY_CLASSES_ROOT\TypeLib{E5C0EE8F-8806-4FE3-BC0E-3A56CFB38BEE}] [HKEY_CLASSES_ROOT\TypeLib{E5C0EE8F-8806-4FE3-BC0E-3A56CFB38BEE}\1.0] @="Car Server Type Lib" [HKEY_CLASSES_ROOT\TypeLib{E5C0EE8F-8806-4FE3-BC0E-3A56CFB38BEE}\1.0\0] [HKEY_CLASSES_ROOT\TypeLib{E5C0EE8F-8806-4FE3-BC0E-3A56CFB38BEE}\1.0\0\win32] @="D:\com\Project01.tlb" [HKEY_CLASSES_ROOT\TypeLib{E5C0EE8F-8806-4FE3-BC0E-3A56CFB38BEE}\1.0\FLAGS] @="0" [HKEY_LOCAL_MACHINE\SOFTWARE\Classes\TypeLib{E5C0EE8F-8806-4FE3-BC0E-3A56CFB38BEE}\1.0\0\win32] @="C:\Windows\System32\msdatsrc.tlb" (5) I try to add reference to the COM by click the Add Reference in the C# project. (6) In the COM tab, I saw my "Car Server Type Lib", it's ok until now. I try to use the Object Browser to browse my COM lib, but the Visual Studio said "the following components could not be browsed", and I noticed that there's no new reference added to the list in the C# project Reference. I can use the tlbimp.exe to generate a interop.CarCom.dll, and then use the COM through this interop dll, but I want this interop assembly to be generated automatically when I just add reference to the COM. Could someone tell me what's wrong? Many thanks.

    Read the article

  • jQuery - Not sure which method to use, closest() and parent() don't work.

    - by Nike
    Hello, again. :) God i feel like i'm spamming stackoverflow, this is my 3rd post for today. Sorry, heh. I even posted a question regarding this before, kind of, but i've changed the code a bit since so i thought it was better to post a new question. $('.pmlist ul li h4 .toggle').click(function() { $(this).closest('.meddel').toggle(250); }); That's what i've got now. The reason why the closest() method isn't working is because the div .meddel is just next to the h4 element. And closest() only crawls right up the DOM tree, ignoring other child elements. Right? parent() works almost the same and doesn't work either. And as i only want to toggle the closest .meddel div in the element, i need something that, yeah justs grabs the nearest one, and not all of them. To clear it up a bit, here's the HTML for one list item: <li class="item"> <h4><a class="toggle">ämne</a><small>2010-04-17 kl 12:54 by <u>nike1</u></small></h4> <div class="meddel"> <span> <img style="max-width: 70%; min-height: 70%;" src="profile-images/nike1.jpg" alt="" /> <a href="account.php?usr=47">nike1</a> </span> <p>text</p> </div> </li> I have several items like that, and if i click one toggle link, i just want the nearest .meddel to be toggled, as mentioned before. Thanks. -Nike

    Read the article

  • How do I read the manifest file for a webapp running in apache tomcat?

    - by Nik Reiman
    I have a webapp which contains a manifest file, in which I write the current version of my application during an ant build task. The manifest file is created correctly, but when I try to read it in during runtime, I get some strange side-effects. My code for reading in the manifest is something like this: InputStream manifestStream = Thread.currentThread() .getContextClassLoader() .getResourceAsStream("META-INFFFF/MANIFEST.MF"); try { Manifest manifest = new Manifest(manifestStream); Attributes attributes = manifest.getMainAttributes(); String impVersion = attributes.getValue("Implementation-Version"); mVersionString = impVersion; } catch(IOException ex) { logger.warn("Error while reading version: " + ex.getMessage()); } When I attach eclipse to tomcat, I see that the above code works, but it seems to get a different manifest file than the one I expected, which I can tell because the ant version and build timestamp are both different. Then, I put "META-INFFFF" in there, and the above code still works! This means that I'm reading some other manifest, not mine. I also tried this.getClass().getClassLoader().getResourceAsStream(...) But the result was the same. What's the proper way to read the manifest file from inside of a webapp running in tomcat? Edit: Thanks for the suggestions so far. Also, I should note that I am running tomcat standalone; I launch it from the command line, and then attach to the running instance in Eclipse's debugger. That shouldn't make a difference, should it?

    Read the article

  • How can I setup Hudson to use the same repository for different projects and maintain separate chang

    - by Allen
    I typically setup SVN to host 1 big project per repository but a lot of our infrastructure has changed and we now have one main SVN server that has a hierarchy like so Branches Tags Trunk Project1 files & folders Project2 files & folders Project3 files & folders Projects1,2, and 3 do not share anything amongst themselves, they are independent projects each with their own solution file to be built. I can setup projects in Hudson like so Repository Url: http://server/svn/MainRepository Local module directory (optional): /Trunk/Project1 And that will maintain a separate workspace for each project, but every time you commit to Project 2 or Project 3, a build gets kicked off in Hudson for every project based in that repository. Also, any commit made anywhere in the repository is pulled down and inserted into the Hudson changelog for all of them. I know the easiest solution would be to simply separate every project into its own repository. However, if I couldn't do that due to various reasons, is there a feasible way to achieve the functionality that having separate repositories gets me? I want commits to the sub folder of project 1 to only affect project 1. No other project's commits should cause project 1 to build and project 1's changelog in Hudson should only have commit notes from project 1.

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Cannot get a session with Facebook app? (using its Graph API)

    - by Jian Lin
    I have really simple few lines of Facebook app, using the new Facebook API: <pre> <?php require 'facebook.php'; // Create our Application instance. $facebook = new Facebook(array( 'appId' => '117676584930569', 'secret' => '**********', // hidden here on the post... 'cookie' => true, )); var_dump($facebook); ?> but it is giving me the following output: http://apps.facebook.com/woolaladev/i2.php would give out object(Facebook)#1 (6) { ["appId:protected"]=> string(15) "117676584930569" ["apiSecret:protected"]=> string(32) "**********" <--- just hidden on this post ["session:protected"]=> NULL <--- Session is NULL for some reason ["sessionLoaded:protected"]=> bool(false) ["cookieSupport:protected"]=> bool(true) ["baseDomain:protected"]=> string(0) "" } Session is NULL for some reason, but I am logged in and can access my home and profile and run other apps on Facebook (to see that I am logged on). I am following the sample on: http://github.com/facebook/php-sdk/blob/master/examples/example.php http://github.com/facebook/php-sdk/blob/master/src/facebook.php (download using raw URL: wget http://github.com/facebook/php-sdk/raw/master/src/facebook.php ) Trying on both hosting companies at dreamhost.com and netfirms.com, and the results are the same.

    Read the article

  • Website (jQuery) consistently crashes Internet Explorer (REALLY STUCK!)

    - by Bradley Bell
    Hey Guys. I posted this question yesterday, but haven't had a response. Basically, I'm totally stuck and clueless over crashing in Internet Explorer. The website now works fine in all browsers except internet explorer. The website is heavily reliant on jQuery and as far as I'm aware, I cant spot anything wrong with the script. Internet Explorer displays no errors and I don't know what I can possibly change. It displays fine, which would suggest that its nothing up with the CSS or HTML? I'm fairly sure it has to be the script, because it only crashes when you hover over one of the mouseover links. I'm already over the deadline and time is ticking! Its driving me crazy. I've uploaded it onto a test directory here: www.openyourheart.org.uk/test/index.html (I'll add the script/css links below as a comment, It wont let me post more than one here!) I would reaaly, really appreciate any help on this. I can also send the website compressed and post scripts here if required/preferred. Thanks in advance, Bradley

    Read the article

  • ASP.net AppendHeader not working in ASP MVC

    - by Chao
    I'm having problems getting AppendHeader to work properly if I am also using an authorize filter. I'm using an actionfilter for my AJAX actions that applies Expires, Last-Modified, Cache-Control and Pragma (though while testing I have tried including it in the action method itself with no change in results). If I don't have an authorize filter the headers work fine. Once I add the filter the headers I tried to add get stripped. The headers I want to add Response.AppendHeader("Expires", "Sun, 19 Nov 1978 05:00:00 GMT"); Response.AppendHeader("Last-Modified", String.Format("{0:r}", DateTime.Now)); Response.AppendHeader("Cache-Control", "no-store, no-cache, must-revalidate"); Response.AppendHeader("Cache-Control", "post-check=0, pre-check=0"); Response.AppendHeader("Pragma", "no-cache"); An example of the headers from a correct page: Server ASP.NET Development Server/9.0.0.0 Date Mon, 14 Jun 2010 17:22:24 GMT X-AspNet-Version 2.0.50727 X-AspNetMvc-Version 2.0 Pragma no-cache Expires Sun, 19 Nov 1978 05:00:00 GMT Last-Modified Mon, 14 Jun 2010 18:22:24 GMT Cache-Control no-store, no-cache, must-revalidate, post-check=0, pre-check=0 Content-Type text/html; charset=utf-8 Content-Length 352 Connection Close And from an incorrect page: Server ASP.NET Development Server/9.0.0.0 Date Mon, 14 Jun 2010 17:27:34 GMT X-AspNet-Version 2.0.50727 X-AspNetMvc-Version 2.0 Pragma no-cache, no-cache Cache-Control private, s-maxage=0 Content-Type text/html; charset=utf-8 Content-Length 4937 Connection Close

    Read the article

  • How do I get the Silverlight Add-On for Visual Studio 2010 and some example code?

    - by xarzu
    How do I get the Silverlight Add-On for Visual Studio 2010? And where can I find lots of example code? When the interent and html was new, one could find examples of how to build a website on a few trusted web sites. The same web sites might not be the best choice for looking for examples for Silverlight, I guess. What are the best web sites where you can look at examples -- and most importantly -- look at the source code of some examples of Silverlight? Back when MFC existed as a option that programmers might use to develop windows applications, a coder could look at a huge list of sample code and step through that code to find something that somewhat did what he was looking for and use that example code to build his own app. Is there anything like that for Silverlight? I have found the http://gallery.expression.microsoft.com/ Expression Blend Gallery and I have found the http://www.silverlight.net/community/samples/silverlight-samples/ Silverlight dot net community samples. I guess that will keep me busy for a while. Are there other sites? There are video instructions on MSDN's Channel9: http://channel9.msdn.com/tags/curso-silverlight-4/ Are there any videos in English? The video instructions look very good. Where is the links to the English versions? I was suggested this site for learning silverlight: http://channel9.msdn.com/learn/courses/Silverlight4/ This online documentation mentions "The Silverlight 4 Tools for Visual Studio 2010" which "is an add-on for Visual Studio 2010 that provides tooling for Microsoft Silverlight 4 and WCF RIA Services. It can be installed on top of either Visual Studio 2010 or Visual Web Developer 2010 Express" where can I find this? Is it shipped with Visual Studio 2010?

    Read the article

  • Use localeURL middleware with apache prefix

    - by Olivier R.
    Good morning everyone, I Got a question about localeURL usage. Everything works great for me with url like this : www.mysite.com/ If I type www.mysite.com/ in adress bar, it turns correctly in www.mysite.com/en/ for example. If I use the view change_locale, it's also all right (ie change www.mysite.com/en/ in www.mysite.com/fr/). But my application use apache as server, and use a prefix for the site, that gives url like this : www.mysite.com/prefix/ If I type www.mysite.com/prefix/ in the adress bar, the adress turns into www.mysite.com/en/ without prefix (so 404) I change code of view to manage our settings.SERVER_PREFIX value : def change_locale(request) : """ Redirect to a given url while changing the locale in the path The url and the locale code need to be specified in the request parameters. O. Rochaix; Taken from localeURL view, and tuned to manage : - SERVER_PREFIX from settings.py """ next = request.REQUEST.get('next', None) if not next: next = request.META.get('HTTP_REFERER', None) if not next: next = settings.SERVER_PREFIX + '/' next = urlsplit(next).path prefix = False if settings.SERVER_PREFIX!="" and next.startswith(settings.SERVER_PREFIX) : prefix = True next = "/" + next.lstrip(settings.SERVER_PREFIX) _, path = utils.strip_path (next) if request.method == 'POST': locale = request.POST.get('locale', None) if locale and check_for_language(locale): path = utils.locale_path(path, locale) if prefix : path = settings.SERVER_PREFIX + path response = http.HttpResponseRedirect(path) return response with this customized view, i'm able to correctly change language, but i'm not sure that's the right way of doing stuff. Is there any option on localeURL to manage prefix of apache ?

    Read the article

  • How does overlayViewTouched notification work in the MoviePlayer sample code

    - by Jonathan
    Hi, I have a question regarding the MoviePlayer sample code provided by apple. I don't understand how the overlayViewTouch notification works. The NSlog message I added to it does not get sent when I touch the view (not button). // post the "overlayViewTouch" notification and will send // the overlayViewTouches: message - (void)overlayViewTouches:(NSNotification *)notification { NSLog(@"overlay view touched"); // Handle touches to the overlay view (MyOverlayView) here... } I can, however, get the NSlog notification if I place it in -(void)touchesBegan in "MyOverlayView.m". Which makes me think it is recognizing touches but not sending a notification. // Handle any touches to the overlay view - (void)touchesBegan:(NSSet *)touches withEvent:(UIEvent *)event { UITouch* touch = [touches anyObject]; if (touch.phase == UITouchPhaseBegan) { NSLog(@"overlay touched(from touchesBegan") // IMPORTANT: // Touches to the overlay view are being handled using // two different techniques as described here: // // 1. Touches to the overlay view (not in the button) // // On touches to the view we will post a notification // "overlayViewTouch". MyMovieViewController is registered // as an observer for this notification, and the // overlayViewTouches: method in MyMovieViewController // will be called. // // 2. Touches to the button // // Touches to the button in this same view will // trigger the MyMovieViewController overlayViewButtonPress: // action method instead. NSNotificationCenter *nc = [NSNotificationCenter defaultCenter]; [nc postNotificationName:OverlayViewTouchNotification object:nil]; } } Can anyone shed light on what I am missing or doing wrong? Thank you.

    Read the article

  • regular expression to remove original message from reply mail using in java ?

    - by ravi ravi
    In my forum, users can reply through email. I am handling mails from their reply. When they are replying the original message getting appended. I want to get only the reply message not the original message. I have to write regular expression for gmail & hotmail. I written regex for gmail as follows : \n.wrote:(?s).--End of Post-- It is removing the original message except date. I want to remove the date also. before removing the original message : " hi 33 On Tue, May 11, 2010 at 4:18 PM, Mmmmm, Rrrrr wrote: The following update has been posted to this discussion: test as user 222 [$MESSAGE_SIGNATURE_HEADER$] --End of Post-- " When I use the above regex it is filtering as follows : " hi 33 On Tue, May 11, 2010 at 4:18 PM, Mmmmm, Rrrrr " Here i want only the actual message 'hi 33' not that date. How can I filter the date using above regex? Also I need regex for Hotmail also. I appreciate for any reply. Thanks in advance.

    Read the article

  • forward/strong enum in VS2010

    - by Noah Roberts
    At http://blogs.msdn.com/vcblog/archive/2010/04/06/c-0x-core-language-features-in-vc10-the-table.aspx there is a table showing C++0x features that are implemented in 2010 RC. Among them are listed forwarding enums and strongly typed enums but they are listed as "partial". The main text of the article says that this means they are either incomplete or implemented in some non-standard way. So I've got VS2010RC and am playing around with the C++0x features. I can't figure these ones out and can't find any documentation on these two features. Not even the simplest attempts compile. enum class E { test }; int main() {} fails with: 1e:\dev_workspace\experimental\2010_feature_assessment\2010_feature_assessment\main.cpp(518): error C2332: 'enum' : missing tag name 1e:\dev_workspace\experimental\2010_feature_assessment\2010_feature_assessment\main.cpp(518): error C2236: unexpected 'class' 'E'. Did you forget a ';'? 1e:\dev_workspace\experimental\2010_feature_assessment\2010_feature_assessment\main.cpp(518): error C3381: 'E' : assembly access specifiers are only available in code compiled with a /clr option 1e:\dev_workspace\experimental\2010_feature_assessment\2010_feature_assessment\main.cpp(518): error C2143: syntax error : missing ';' before '}' 1e:\dev_workspace\experimental\2010_feature_assessment\2010_feature_assessment\main.cpp(518): error C4430: missing type specifier - int assumed. Note: C++ does not support default-int ========== Build: 0 succeeded, 1 failed, 0 up-to-date, 0 skipped ========== int main() { enum E : short; } Fails with: 1e:\dev_workspace\experimental\2010_feature_assessment\2010_feature_assessment\main.cpp(513): warning C4480: nonstandard extension used: specifying underlying type for enum 'main::E' 1e:\dev_workspace\experimental\2010_feature_assessment\2010_feature_assessment\main.cpp(513): error C2059: syntax error : ';' ========== Build: 0 succeeded, 1 failed, 0 up-to-date, 0 skipped ========== So it seems it must be some totally non-standard implementation that has allowed them to justify calling this feature "partially" done. How would I rewrite that code to access the forwarding and strong type feature?

    Read the article

  • Fork or copy a users browser session in IE

    - by jmoeller
    Is it possible to fork a users session (or do something similar) in a Internet Explorer plugin? I want to process the page the user is on when they click a button in the toolbar. To avoid interrupting the users browsing, I'd like to "copy" everything so I can parse and process the page in the background. The processing can involve things such as loading the content of the result links on a Google search, if that's where the button was clicked. So - what I basically want is to imitate "Ctrl+N" but hide the window from the user, so they won't be interrupted. As you can see, if you fill out and submit the form on http://www.snee.com/xml/crud/posttest.html and press "Ctrl+N", everything posted will still appear in the new window, but it won't post the data twice. I was thinking of somehow copying the IWebBrowser2, but: I'm not sure if that's possible (I haven't been able to find any information on MSDN) I don't know if it copies the sessions as well. Creating a new instance of the IWebBrowser2 and simply navigating to the current URL isn't a valid solution as POST-variables of course doesn't get carried over.

    Read the article

< Previous Page | 470 471 472 473 474 475 476 477 478 479 480 481  | Next Page >