Search Results

Search found 14236 results on 570 pages for 'times square'.

Page 475/570 | < Previous Page | 471 472 473 474 475 476 477 478 479 480 481 482  | Next Page >

  • controlling css with javascript works with mozilla but not with webkit based browsers

    - by GlassGhost
    Im having problems with applying css text variable in this javascript with webkit based browsers(Chrome & Safari) but it works in firefox 3.6 the function: function addGlobalStyle(sCss) { var head = document.getElementsByTagName('head')[0]; if( !head || head == null ) { return false; } var oStyle = document.createElement('style'); oStyle.type = 'text/css'; oStyle.rel = 'stylesheet'; oStyle.media = 'screen'; if ( is_gecko ) { // firefox WORKING !!! oStyle.href = 'FireFox.css'; oStyle.innerHTML = sCss; head.appendChild(oStyle); return true; } else {//nothing but firefox works oStyle.href = 'FireFox.css'; oStyle.innerHTML = sCss; head.appendChild(oStyle); return true; } } the use of the function: var NewSyleText = //The page styling "h1, h2, h3, h4, h5 {font-family: 'Verdana','Helvetica',sans-serif; font-style: normal; font-weight:normal;}" + "body, b {background: #fbfbfb; font-style: normal; font-family: 'Cochin','GaramondNo8','Garamond','Big Caslon','Georgia','Times',serif;font-size: 11pt;}" + "p { margin: 0pt; text-indent:2.5em; margin-top: 0.3em; }" + "a { text-decoration: none; color: Navy; background: none;}" + "a:visited { color: #500050;}" + "a:active { color: #faa700;}" + "a:hover { text-decoration: underline;}"; addGlobalStyle(NewSyleText);//inserts the page styling

    Read the article

  • C# Finding 2 positions 1-dimArray

    - by Chris
    Hello, In a method i am calculating the longest row of elements. The 1-dim array is filled up with random values (0 or 1). The method looks up the longest row (being 0 or 1, whatever is the longest). Meaning in for example: 1110100 --> the longest row would be 3 (3 * 1) 0110000 --> the longest row would be 4 (4 * 0) My problem is i am trying to perform some type of linear search to show the position of the row in the array. The first example has the longest row of 3 elements (3 times 1). For 1110100 the position in the array would be 0 - 2 (index) For 0110000 the position in the array would be 3 - 6 (index) I have been trying with foreaches, for loops etc..but i cannot seem to get the proper indexes of both. Cannot seem to display both positions properly. For the first example the correct output wouldbe: The largest row of same elements of the array consists of 3 elements on the position 0 - 2. The longest row of elements gets of same elements get calculated as the following: public int BerekenDeelrij (int [] table) ( int count = 0; final int value = 0; int largest = 0; foreach (int value in table) ( if (value == last value) counter + +; else ( largest = Math.Max largest (largest, counter); final value = value count = 1; ) ) Math.Max return (largest, counter); ) Best Regards.

    Read the article

  • mysql_affected_rows() returns 0 for UPDATE statement even when an update actually happens

    - by Alex Moore
    I am trying to get the number of rows affected in a simple mysql update query. However, when I run this code below, PHP's mysql_affected_rows() always equals 0. No matter if foo=1 already (in which case the function should correctly return 0, since no rows were changed), or if foo currently equals some other integer (in which case the function should return 1). $updateQuery = "UPDATE myTable SET foo=1 WHERE bar=2"; mysql_query($updateQuery); if (mysql_affected_rows() > 0) { echo "affected!"; } else { echo "not affected"; // always prints not affected } The UPDATE statement itself works. The INT gets changed in my database. I have also double-checked that the database connection isn't being closed beforehand or anything funky. Keep in mind, mysql_affected_rows doesn't necessarily require you to pass a connection link identifier, though I've tried that too. Details on the function: mysql_affected_rows Any ideas? SOLUTION The part I didn't mention turned out to be the cause of my woes here. This PHP file was being called ten times consecutively in an AJAX call, though I was only looking at the value returned on the last call, ie. a big fat 0. My apologies!

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Jquery Mobile app focus-based navigation stops working after switching between pages

    - by nawar
    As much as I would like to expand on the details here, I am not able to find relevant information about the root cause of this problem. I am having this issue with my blackberry Webapp which I built using JQM. After few times of navigation from page to page, the application becomes unresponsive on the destination page and I am not able to scroll up/down using the touchpad. If someone had this problem or some clue to the resolution, then that would be helpful. Edit: after doing some research I was able to narrow down the cause of the issue. I am having an issue with focus-based navigation. As I lose focus on the page elements (buttons, input fields, etc) after few transitions among the pages. Edit I had to switch back to the cursor based navigation as it is much faster and do not have the issue faced by focus-based navigation. I removed the entry: <rim:navigation mode=”focus”/> from the config.xml file I found this entry on the blackberry fourms but it haven't solved my problem despite the fact I upgraded my WebWorks SDK to 2.0 from 1.5 http://supportforums.blackberry.com/t5/Web-and-WebWorks-Development/Focus-based-navigation-hangs-device/td-p/455600 Thanks

    Read the article

  • Get history of file changes from TFS

    - by Andreas Zita
    I'm trying to make some way of figuring out who to "blame" when an exception is thrown in our application (at work). It could be me causing it of course but I can accept that :). But to do this I need the history of a file in TFS so I can check who last made a change at the line of the exception. Its of course not always at the row of the exception that the erroneous change was inserted, so I would probably also need to check any changes to the same file and lastly any check-ins made very recently. I'm not sure how I will work out this but I would like to check with the community first if there is any already existing solutions for this? I have no experience with the TFS API yet so I have no way of telling whats possible and whats not. I guess I would integrate this into our app in the unhandled exceptions-handler. When some candidates of the exception is found I need to inform them by email. In the process it would be nice to log how many times a certain exception has been thrown by any user on our intranet, who, when, how etc. It could save us a lot of time (and money).

    Read the article

  • How can I manage building library projects that produce both a static lib and a dll?

    - by Scott Langham
    I've got a large visual studio solution with ~50 projects. There are configurations for StaticDebug, StaticRelease, Debug and Release. Some libraries are needed in both dll and static lib form. To get them, we rebuild the solution with a different configuration. The Configuration Manager window is used to setup which projects need to build in which flavours, static lib, dynamic dll or both. This can by quite tricky to manage and it's a bit annoying to have to build the solution multiple times and select the configurations in the right order. Static versions need building before non-static versions. I'm wondering, instead of this current scheme, might it be simpler to manage if, for the projects I needed to produce both a static lib and dynamc dll, I created two projects. Eg: CoreLib CoreDll I could either make both of these projects reference all the same files and build them twice, or I'm wondering, would it be possible to build CoreLib and then get CoreDll to link it to generate the dll? I guess my question is, do you have any advice on how to structure your projects in this kind of situation? Thanks.

    Read the article

  • Creating and parsing huge strings with javascript?

    - by user246114
    Hi, I have a simple piece of data that I'm storing on a server, as a plain string. It is kind of ridiculous, but it looks like this: name|date|grade|description|name|date|grade|description|repeat for a long time this string can be up to 1.4mb in size. The idea is that it's a bunch of student records, just strung together with a simple pipe delimeter. It's a very poor serialization method. Once this massive string is pushed to the client, it is split along the pipes into student records again, using javascript. I've been timing how long it takes to create, and split, these strings on the client side. The times are actually quite good, the slowest run I've seen on a few different machines is 0.2 seconds for 10,000 'student records', which has a final string size of ~1.4mb. I realize this is quite bizarre, just wondering if there are any inherent problems with creating and splitting such large strings using javascript? I don't know how different browsers implement their javascript engines. I've tried this on the 'major' browsers, but don't know how this would perform on earlier versions of each. Yeah looking for any comments on this, this is more for fun than anything else! Thanks

    Read the article

  • How to hadle a tags inside another tags in NSXMLParser

    - by SimpleMan
    I have a file: <xml> <component>something <system>somethingDeeper <value>somethingDeepest</value> </system> </component> <component>somethinfDifferent <value>somethingDifferentDeeper</value> </component> <value>somethingNew</value> </xml> So i want to distinguish what is inside another tag (ex. <system>) what is not. How to do this with NSXMLParser ? I currently use BOOL ivar's but this is a lot of tags and this is not as elegant as i want it to be. I know that NSXMLParser is a SAX parser and i understand that. In above example I will be enter to didEndElement method three times with: elementName equal value Is there a more elegant way to distinguish what entry was from <component> tag above what not?

    Read the article

  • Parallel doseq for Clojure

    - by andrew cooke
    I haven't used multithreading in Clojure at all so am unsure where to start. I have a doseq whose body can run in parallel. What I'd like is for there always to be 3 threads running (leaving 1 core free) that evaluate the body in parallel until the range is exhausted. There's no shared state, nothing complicated - the equivalent of Python's multiprocessing would be just fine. So something like: (dopar 3 [i (range 100)] ; repeated 100 times in 3 parallel threads... ...) Where should I start looking? Is there a command for this? A standard package? A good reference? So far I have found pmap, and could use that (how do I restrict to 3 at a time? looks like it uses 32 at a time - no, source says 2 + number of processors), but it seems like this is a basic primitive that should already exist somewhere. clarification: I really would like to control the number of threads. I have processes that are long-running and use a fair amount of memory, so creating a large number and hoping things work out OK isn't a good approach (example which uses a significant chunk available mem). update: Starting to write a macro that does this, and I need a semaphore (or a mutex, or an atom i can wait on). Do semaphores exist in Clojure? Or should I use a ThreadPoolExecutor? It seems odd to have to pull so much in from Java - I thought parallel programming in Clojure was supposed to be easy... Maybe I am thinking about this completely the wrong way? Hmmm. Agents?

    Read the article

  • Link Button on asp.net user control not firing

    - by andyriome
    Hi I have a user control, which is added to another user control. The nested user control is built up of a gridview, an image button and a link button. The nested user control is added to the outer control as a collection object based upon the results bound to the gridview. The problem that I have is that my link button doesn't work. I click on it and the event doesn't fire. Even adding a break point was not reached. As the nested user control is added a number of times, I have set image button to have unique ids and also the link button. Whilst image button works correctly with its java script. The link button needs to fire an event in the code behind, but despite all my efforts, I can't make it work. I am adding the link button to the control dynamically. Below is the relevant code that I am using: public partial class ucCustomerDetails : System.Web.UI.UserControl { protected override void CreateChildControls( ) { base.CreateChildControls( ); string strUniqueID = lnkShowAllCust.UniqueID; strUniqueID = strUniqueID.Replace('$','_'); this.lnkShowAllCust.ID = strUniqueID; this.lnkShowAllCust.Click += new EventHandler(this.lnkShowAllCust_Click); this.Controls.Add(lnkShowAllCust); } protected override void OnInit (EventArgs e) { CreateChildControls( ); base.OnInit(e); } protected override void OnLoad(EventArgs e) { base.EnsureChildControls( ); } protected void Page_Load(object sender, EventArgs e) { if (IsPostBack) { CreateChildControls( ); } } protected void lnkShowAllCust_Click(object sender, EventArgs e) { this.OnCustShowAllClicked(new EventArgs ( )); } protected virtual void OnCustShowAllClicked(EventArgs args) { if (this.ViewAllClicked != null) { this.ViewAllClicked(this, args); } } public event EventHandler ViewAllClicked; } I have been stuggling with this problem for the last 3 days and have had no success with it, and I really do need some help. Can anyone please help me?

    Read the article

  • Python lists/arrays: disable negative indexing wrap-around

    - by wim
    While I find the negative number wraparound (i.e. A[-2] indexing the second-to-last element) extremely useful in many cases, there are often use cases I come across where it is more of an annoyance than helpful, and I find myself wishing for an alternate syntax to use when I would rather disable that particular behaviour. Here is a canned 2D example below, but I have had the same peeve a few times with other data structures and in other numbers of dimensions. import numpy as np A = np.random.randint(0, 2, (5, 10)) def foo(i, j, r=2): '''sum of neighbours within r steps of A[i,j]''' return A[i-r:i+r+1, j-r:j+r+1].sum() In the slice above I would rather that any negative number to the slice would be treated the same as None is, rather than wrapping to the other end of the array. Because of the wrapping, the otherwise nice implementation above gives incorrect results at boundary conditions and requires some sort of patch like: def ugly_foo(i, j, r=2): def thing(n): return None if n < 0 else n return A[thing(i-r):i+r+1, thing(j-r):j+r+1].sum() I have also tried zero-padding the array or list, but it is still inelegant (requires adjusting the lookup locations indices accordingly) and inefficient (requires copying the array). Am I missing some standard trick or elegant solution for slicing like this? I noticed that python and numpy already handle the case where you specify too large a number nicely - that is, if the index is greater than the shape of the array it behaves the same as if it were None.

    Read the article

  • Issue selenium code maintenance

    - by Rajasankar
    I want to group the common methods in one file and use it. For example, login to a page using selenium may be used in multiple times. Define that in class A and call it in class B. However, it throws null pointer exception. class A has public void test_Login() throws Exception { try{ selenium.setTimeout("60000"); selenium.open("http://localhost"); selenium.windowFocus(); selenium.windowMaximize(); selenium.windowFocus(); selenium.type("userName", "admin"); selenium.type("password", "admin"); Result=selenium.isElementPresent("//input[@type='image']"); selenium.click("//input[@type='image']"); selenium.waitForPageToLoad(Timeout); } catch(Exception ex) { System.out.println(ex); ex.printStackTrace(); } } with all other java syntax in class B public void test_kk() throws Exception { try { a.test_Login(); } catch(Exception ex) { System.out.println(ex); ex.printStackTrace(); } } with all syntax. When I execute class B, I got this error, java.lang.NullPointerException at A.test_Login(A.java:32) at B.test_kk(savefile.java:58) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(Unknown Source) at sun.reflect.DelegatingMethodAccessorImpl.invoke(Unknown Source) at java.lang.reflect.Method.invoke(Unknown Source) at junit.framework.TestCase.runTest(TestCase.java:168) at junit.framework.TestCase.runBare(TestCase.java:134) at com.thoughtworks.selenium.SeleneseTestCase.runBare(SeleneseTestCase.j ava:212) at junit.framework.TestResult$1.protect(TestResult.java:110) at junit.framework.TestResult.runProtected(TestResult.java:128) at junit.framework.TestResult.run(TestResult.java:113) at junit.framework.TestCase.run(TestCase.java:124) at junit.framework.TestSuite.runTest(TestSuite.java:232) at junit.framework.TestSuite.run(TestSuite.java:227) at junit.textui.TestRunner.doRun(TestRunner.java:116) at junit.textui.TestRunner.doRun(TestRunner.java:109) at junit.textui.TestRunner.run(TestRunner.java:77) at B.main(B.java:77) I hope someone must have tried this before. I may miss something here.

    Read the article

  • Effective communication in a component-based system

    - by Tesserex
    Yes, this is another question about my game engine, which is coming along very nicely, with much thanks to you guys. So, if you watched the video (or didn't), the objects in the game are composed of various components for things like position, sprites, movement, collision, sounds, health, etc. I have several message types defined for "tell" type communication between entities and components, but this only goes so far. There are plenty of times when I just need to ask for something, for example an entity's position. There are dozens of lines in my code that look like this: SomeComponent comp = (SomeComponent)entity.GetComponent(typeof(SomeComponent)); if (comp != null) comp.GetSomething(); I know this is very ugly, and I know that casting smells of improper OO design. But as complex as things are, there doesn't seem to be a better way. I could of course "hard-code" my component types and just have SomeComponent comp = entity.GetSomeComponent(); but that seems like a cop-out, and a bad one. I literally JUST REALIZED, while writing this, after having my code this way for months with no solution, that a generic will help me. SomeComponent comp = entity.GetComponent<SomeComponent>(); Amazing how that works. Anyway, this is still only a semantic improvement. My questions remain. Is this actually that bad? What's a better alternative?

    Read the article

  • nservicebus deleting subscription record after inserting it?

    - by Justin Holbrook
    I have been playing with nservicebus for a few weeks now and since everything was going well on my local machine I decided to try to set up a test environment and work on deployment. I am using the generic host that comes with nservicebus and was using the nservicebus.Integration profile when running locally, but would like to use Nservicebus.Production in the test environment. I set up a sql server 2008 database, made changes to my app.config and everything seemed to work fine. But after a few attempts, I noticed messages were not being picked up by my subscriber. I checked the subscription table and it was empty. Upon examination of the logs I noticed the following: 2010-05-06 15:07:57,416 [1] DEBUG NHibernate.Persister.Entity.AbstractEntityPers ister [(null)] <(null) - Insert 0: INSERT INTO [Subscription] (SubscriberEndpo int, MessageType) VALUES (?, ?) 2010-05-06 15:07:57,416 [1] DEBUG NHibernate.Persister.Entity.AbstractEntityPers ister [(null)] <(null) - Update 0: 2010-05-06 15:07:57,416 [1] DEBUG NHibernate.Persister.Entity.AbstractEntityPers ister [(null)] <(null) - Delete 0: DELETE FROM [Subscription] WHERE Subscriber Endpoint = ? AND MessageType = ? Why would it insert then delete my subscription right afterwards? To try to rule out a nhibernate dialect issue I tried switching my subscription storage to an oracle 10g database. It behaved exactly the same, it worked the first 2 times, then I started seeing my subscriptions being deleted right after they were inserted. Any ideas what is causing this behavior?

    Read the article

  • Finding comma separated values with a colon delimiter

    - by iconMatrix
    I am setting values in my database for tourneyID,Selected,Paid,Entered,date then separating each selection with a colon So I have a string that may look like this 187,S,,,09-21-2013:141,S,,,06-21-2013:144,S,,,05-24-2013 but it also could look like this 145,S,,,07-12-2013:142,S,,,05-24-2013:187,S,,,09-21-2013 and some times is looks like this 87,S,,,07-11-2013:125,S,,,06-14-2013 I am trying to find this sequence: 187,S,,,09-21-2013 I have data stored like that because I paid a programmer to code it for me. Now, as I learn, I see it was not the best solution, but it is what I have till I learn more and it is working. My problem is when using LIKE it returns both the 187 and 87 values $getTeams = mysql_query("SELECT * FROM teams WHERE (team_tourney_vector LIKE '%$tid,S,P,,$tourney_start_date%' OR team_tourney_vector LIKE '%$tid,S,,,$tourney_start_date%') AND division='$division'"); I tried this using FIND_IN_SET() but it would only return the the team id for this string 187,S,,,09-21-2013:141,S,,,06-21-2013:144,S,,,05-24-2013 and does not find the team id for this string 145,S,,,07-12-2013:142,S,,,05-24-2013:187,S,,,09-21-2013 SELECT * FROM teams WHERE FIND_IN_SET('187',team_tourney_vector) AND (team_tourney_vector LIKE '%S,,,09-21-2013%') Any thoughts on how to achieve this?

    Read the article

  • Javascript Anonymous Functions and Global Variables

    - by Jonathan Swift
    I thought I would try and be clever and create a Wait function of my own (I realise there are other ways to do this). So I wrote: var interval_id; var countdowntimer = 0; function Wait(wait_interval) { countdowntimer = wait_interval; interval_id = setInterval(function() { --countdowntimer <=0 ? clearInterval(interval_id) : null; }, 1000); do {} while (countdowntimer >= 0); } // Wait a bit: 5 secs Wait(5); This all works, except for the infinite looping. Upon inspection, if I take the While loop out, the anonymous function is entered 5 times, as expected. So clearly the global variable countdowntimer is decremented. However, if I check the value of countdowntimer, in the While loop, it never goes down. This is despite the fact that the anonymous function is being called whilst in the While loop! Clearly, somehow, there are two values of countdowntimer floating around, but why?

    Read the article

  • SWIG: From Plain C++ to working Wrapper

    - by duckworthd
    Hi everyone. I've been trying to create a SWIG wrapper for this tiny little C++ class for the better part of 3 hours with no success, so I was hoping one of you out there could lend me a small hand. I have the following class: #include <stdio.h> class Example { public: Example(); ~Example(); int test(); }; #include "example.h" Along with the implementation: Example::Example() { printf("Example constructor called\n"); } Example::~Example() { printf("Example destructor called\n"); } int Example::test() { printf("Holy shit, I work!\n"); return 42; } I've read through the introduction page ( www.swig.org/Doc1.3/Java.html ) a few times without gaining a whole lot of insight into the situation. My steps were Create an example.i file Compile original alongside example_wrap.cxx (no linking) link resulting object files together Create a little java test file (see below) javac all .java files there and run Well steps 4 and 5 have created a host of problems for me, starting with the basic ( library 'example' not found due to not being in java's path ) to the weird ( library not found even unless LD_LIBRARY_PATH is set to something, even if it's nothing at all). I've included my little testing code below public class test2 { static { String libpath = System.getProperty("java.library.path"); String currentDir = System.getProperty("user.dir"); System.setProperty("java.library.path", currentDir + ":" + libpath); System.out.println(System.getProperty("java.library.path")); System.loadLibrary("example"); } public static void main(String[] args){ System.out.println("It loads!"); } } Well, if anyone has navigated these murky waters of wrapping, I could not be happier than if you could light the way, particularly if you could provide the example.i and bash commands to go along with it.

    Read the article

  • Adding and sorting a linked list in C

    - by user1202963
    In my assignment, I have to write a function that takes as arguments a pointer to a "LNode" structure and an integer argument. Then, I have to not only add that integer into the linked list, but also put place it so that the list is in proper ascending order. I've tried several various attempts at this, and this is my code as of posting. LNode* AddItem(LNode *headPtr, int newItem) { auto LNode *ptr = headPtr; ptr = malloc(sizeof(LNode)); if (headPtr == NULL) { ptr->value = newItem; ptr->next = headPtr; return ptr; } else { while (headPtr->value > newItem || ptr->next != NULL) { printf("While\n"); // This is simply to let me know how many times the loop runs headPtr = headPtr->next; } ptr->value = newItem; ptr->next = headPtr; return ptr; } } // end of "AddItem" When I run it, and try to insert say a 5 and then a 3, the 5 gets inserted, but then the while loop runs once and I get a segmentation fault. Also I cannot change the arguments as it's part of a skeletal code for this project. Thanks to anyone who can help. If it helps this is what the structure looks like typedef struct LNode { int value; struct LNode *next; } LNode;

    Read the article

  • Modal QMessageBox does not behave like native Windows dialogs

    - by Philip Daubmeier
    My application has a dialog that asks the user via a QMessageBox whether he wants to discard all changes he made or wants to keep editing. I want this dialog to be modal to the whole application. I read somewhere that this is the standard behavior for a QMessageBox, so I dont have to set it explicitly with something like: mbox.setWindowModality(Qt::ApplicationModal); I wonder why it behaves differently from other modal dialogs in the OS (Windows 7 in my case). On the one hand it functions like it should, i.e. all other input methods in the application are blocked until the user answeres the dialog. However, it doesn't 'blink'* if the user clicks any other window of the application. Is there any way to get Qt to behave like a native Windows dialog? Thanks in advance! *If you don't know what I mean with this 'blinking': Just open notepad on a Windows OS, type some text and try to close it. A dialog pops up that asks to save, discard or keep editing. Now click somewhere on the editor window - the border and titlebar of the dialog flashes/blinks a few times.

    Read the article

  • joomla! migration

    - by tim
    I have a Joomla! installation on a remote site and I want to run it locally. I'm running Joomla! locally on a Mac through a standard MAMP installation: Joomla 1.5.12 PHP 5.2.6 MySQL 5.0.41 Apache 2.0.59 OS X 10.5.8 I've added a configuration file to the local Joomla! directory with all the correct local settings, database name, database user-name, database password etc. etc. I've tried a lot of different settings. I've also recreated the remote database locally, ensuring everything copied correctly. I followed a few different sets of instructions with roughly the same steps on how to do the migration. All of the above has not worked for me; at best I get bits of text from the site rendered in the browser. Other times I get SQL errors. What I want is for an already set up remote Joomla! installation to run on my own local machine. Does anyone have any advice as to how to get this working, it'd be very much appreciated? Thanks.

    Read the article

  • App Crashing Inspite of Being ARC Enabled

    - by proctr
    I have been working on an iOS App for sometime now and its almost ready to submit. However, when I gave it to few people for testing purposes (running iOS 5)..they reported cases where the app crashes and the home screen is displayed on the phone OR a frozen app screen appears with no response whatsoever The app is ARC enabled and Xcode shows no warnings. So, I'm relli tensed about what's going wrong. I have declared properties in the following fashion: @property (nonatomic) IBOutlet UILabel *devCountLabel; @property (nonatomic) IBOutlet UIView *splashView; Likewise other properties are declared. Could anyone provide a solution ASAP. It is mainly a network based app and thus, CoreData usage is minimum.. Anyway, I'm running out of time..So Please provide a fix asap..oh and thanks a ton for it. PS: The App doesn't crash in the simulator, so I'm guessing it has something related to memory. And the crashes are random. So, repeating a set of steps to reproduce the crash doesn't help either. For Eg. When I click a button, modalViewControllerAnimation results in normal case. Now this occurs as expected most of the time and freezes the app other times.

    Read the article

  • Game Development: How do you make a story game?

    - by Martijn Courteaux
    Hi, I made already a few simple games: enter a level, get up to the end, continue to the next level. But I'm still wondering how "real" game developers create games with a story. Here are a few things what a story game has (and where I'm wondering about how they make it) : A sequence of places the player have to visit and do there that, that and that. The first time you see a guy, he says just hello. After a few hours game progress, he gives you a hint to go to a specific place. The first time you walk over a bridge nothing happens, a second time: the bridge falls and you will enter a new location under the bridge. The first time you enter a new location, you will get a lot of information from e.g. villagers, etc. Next time nothing happens The last points are a bit three times the same. But, I don't think they have a save-file with a lot of booleans and integers for holding things like: Player did the first time .... Player enters the tenth time that location Player talked for the ###th time to that person etc When I talk about story games, I'm thinking to: The Legend of Zelda (all games of the serie) Okami And this are a few examples of level-in-level-out games: Mario Braid Crayon Physics Thanks

    Read the article

  • How would I compare two Lists(Of <CustomClass>) in VB?

    - by Kumba
    I'm working on implementing the equality operator = for a custom class of mine. The class has one property, Value, which is itself a List(Of OtherClass), where OtherClass is yet another custom class in my project. I've already implemented the IComparer, IComparable, IEqualityComparer, and IEquatable interfaces, the operators =, <>, bool and not, and overriden Equals and GetHashCode for OtherClass. This should give me all the tools I need to compare these objects, and various tests comparing two singular instances of these objects so far checks out. However, I'm not sure how to approach this when they are in a List. I don't care about the list order. Given: Dim x As New List(Of OtherClass) From {New OtherClass("foo"), New OtherClass("bar"), New OtherClass("baz")} Dim y As New List(Of OtherClass) From {New OtherClass("baz"), New OtherClass("foo"), New OtherClass("bar")} Then (x = y).ToString should print out True. I need to compare the same (not distinct) set of objects in this list. The list shouldn't support dupes of OtherClass, but I'll have to figure out how to add that in later as an exception. Not interested in using LINQ. It looks nice, but in the few examples I've played with, adds a performance overhead in that bugs me. Loops are ugly, but they are fast :) A straight code answer is fine, but I'd like to understand the logic needed for such a comparison as well. I'm probably going to have to implement said logic more than a few times down the road.

    Read the article

  • Can FFT length affect filtering accuracy?

    - by Charles
    Hi, I am designing a fractional delay filter, and my lagrange coefficient of order 5 h(n) have 6 taps in time domain. I have tested to convolute the h(n) with x(n) which is 5000 sampled signal using matlab, and the result seems ok. When I tried to use FFT and IFFT method, the output is totally wrong. Actually my FFT is computed with 8192 data in frequency domain, which is the nearest power of 2 for 5000 signal sample. For the IFFT portion, I convert back the 8192 frequency domain data back to 5000 length data in time domain. So, the problem is, why this thing works in convolution, but not in FFT multiplication. Does converting my 6 taps h(n) to 8192 taps in frequency domain causes this problem? Actually I have tried using overlap-save method, which perform the FFT and multiplication with smaller chunks of x(n) and doing it 5 times separately. The result seems slight better than the previous, and at least I can see the waveform pattern, but still slightly distorted. So, any idea where goes wrong, and what is the solution. Thank you.

    Read the article

< Previous Page | 471 472 473 474 475 476 477 478 479 480 481 482  | Next Page >