Search Results

Search found 8638 results on 346 pages for 'ext js'.

Page 48/346 | < Previous Page | 44 45 46 47 48 49 50 51 52 53 54 55  | Next Page >

  • [js] how combine 2 functions on submit?

    - by Mahmoud
    hey there, as you can see, i have to functions first to check if all forms are not empty and the second function is to verify the captcher, when i combine them together both work at the same time, i want to first to verify the first function, when that function returns true then the other function starts, here is the code that i used on form <form action="reg.php" method="post" enctype="application/x-www-form-urlencoded" onsubmit=" Checking(this); return jcap();" > As you can see both function execute at the same time so i tried this <form action="reg.php" method="post" enctype="application/x-www-form-urlencoded" onsubmit=" if(Checking(this) == true ){ return jcap();}" > is bypass both

    Read the article

  • Execute js on DOMContentLoaded in ff-extension

    - by ArtWorkAD
    Hi, I want to enable jQuery for my extension. So I want to do something similar to $(document).ready(function() { // put all your jQuery goodness in here. }); So I came up with var app = window.document.getElementById('page'); app.addEventListener("DOMContentLoaded", onPageLoad, false); function onPageLoad(){ alert("test"); } But this does not work at all. Any ideas how to call onPageLoad each time DOM content is reloaded?

    Read the article

  • html/js: Refresh 'Select' options

    - by framara
    Hi, There's a class 'Car' with brand and model as properties. I have a list of items of this class List<Car> myCars. I need to represent in a JSP website 2 ComboBox, one for brand and another for model, that when you select the brand, in the model list only appear the ones from that brand. I don't know how to do this in a dynamic way. Any suggestion where to start? Thanks Update Ok, what I do now is send in the request a list with all the brand names, and a list of the items. The JSP code is like: <select name="manufacturer" id="id_manufacturer" onchange="return getManufacturer();"> <option value=""></option> <c:forEach items="${manufacturers}" var="man"> <option value="${man}" >${man}</option> </c:forEach> </select> <select name="model" id="id_model"> <c:forEach items="${mycars}" var="car"> <c:if test="${car.manufacturer eq man_selected}"> <option value="${car.id}">${car.model}</option> </c:if> </c:forEach> </select> <script> function getManufacturer() { man_selected = document.getElementById('id_manufacturer').value; } </script> How do I do to refresh the 'model' select options according to the selected 'man_selected' ?

    Read the article

  • getting the names of elements in JS/jQuery

    - by Mala
    I have some checkbox inputs like so: <input type="checkbox" name="1" class="filter"/> <input type="checkbox" name="2" class="filter"/> ...etc... I'm trying to write a function where any time a checkbox is selected, it generates a string with all the names concatenated. Here's what I have so far: $('.filter').click(function(event){ var filters = $('.filter').toArray(); var fstr = ""; for (f in filters) { fstr = fstr+","+f.name; } alert(fstr); }); The names keep coming up as 'undefined', though (i.e. the alert returns ,undefined,undefined,undefined,undefined,undefined,undefined). How do I access the names?

    Read the article

  • Query parameter using JS framework ?

    - by Maxim Veksler
    Hi, I seem to not be able to find implementation from the common Ajax libraries (JQuery, mootools, prototypejs...) that would allow the operation of parsing the window.location.href for request parameter. I would expect something like: $P{"param1"} == "param1_value" Am I missing something? p.s. The web does contains implementation examples for such operations

    Read the article

  • Angular.js: value() not injected in config()

    - by Nik
    I am having trouble getting the value() injected into the app.config(). Here's the code (coffeescript) window.app = angular.module("app", []) app.value("template_path", "assets/angular/templates/users") app.config(["$routeProvider","template_path" ($routeProvider, template_path) -> console.log template_path it is throwing an "Unknown provider: template_path from app" error Could it be that the config() method cannot be injected with value() set values? I am using 1.0.2 Thank you!

    Read the article

  • JS Split ( ) to check if substring exists in Array

    - by Javacadabra
    I have an array of products that are stored as Strings in this format productname:quantity. The issue I am running into is that if a user adds one product with a quantity of x it is inserted into the array as it should. However, if they then decide to add more of a particular product a new entry is made into the array instead of checking if the product already exists and adjusting the quantity to the new value. oldQty + newQty. For example this is my array: ["CBL202659/A:1","OUTER9:1","PALLET CARDS:1"] If I add another PALLET CARDS product it creates a new entry rather than updating the quantity of the existing item to 2. New array ["CBL202659/A:1","OUTER9:1","PALLET CARDS:1","PALLET CARDS:1"] I would like the array to end up like this: - updating the quantity ["CBL202659/A:1","OUTER9:1","PALLET CARDS:2"] Currently this is my code: I use the split() method to seperate the String where a colon occurs and store the product name and quantity in two seperate variables. $(".orderBtn").click(function(event){ //Show the order Box $(".order-alert").show(); event.preventDefault(); //Create the Array var productArray = []; //Get reference to the product clicked var stockCode = $(this).closest('li').find('.stock_code').html(); //Get reference to the quantity selected var quantity = $(this).closest('li').find('.order_amount').val(); var item = stockCode + ":" + quantity; var itemCheck = stockCode + ":"; if(quantity == 0){ console.log("Quantity must be greater than 0") }else{ //If no Cookie exists, create one and add the Array if ($.cookie('order_cookie') === undefined) { console.log("CREATE NEW COOKIE"); //Add items to Array productArray.push(item); //Add Array to Cookie $.cookie('order_cookie', JSON.stringify(productArray), { expires: 1, path: '/' }); //If the Cookie already exists do this } else { productArray = JSON.parse($.cookie('order_cookie'));//get ref to array if(productArray.indexOf(itemCheck)!= -1){//It exists so update qty console.log("EXISTS... updating item: " + itemCheck); //var index = productArray.indexOf(item); //var update = productArray[index].split(":"); //var name = update[0]; //var oldQty = update[1]; //console.log(name + ":" + oldQty); //productArray[index] = item; }else{//It does not exist, so add to array console.log("Does not exist... adding new item: " + item); //Append items onto the Array productArray.push(item); } //Update the Cookie $.cookie('order_cookie', JSON.stringify(productArray), { expires: 1, path: '/' }); console.log($.cookie('order_cookie')); } //Display the number of items in the Array in the Order Box $('#order_counter').html(productArray.length); } }); I suppose the real question I am asking here, is if it is possible to search the array for a subString - containing productname: ??

    Read the article

  • require.js - How can I set a version on required modules as part of the URL?

    - by Ovesh
    I am using require.js to require JS modules in my application. I need a way to bust client cache on new JS modules, by way of a different requested URL. i.e., if the file hello/there.js has already been cached on the client, I can change the file name to force the browser to get the new file. In other words, for the module hello/there, I'd like require.js to request the url hello/there___v1234___.js (the file name can look different, it's just an example), according to a version string which is accessible on the client. What is the best way to achieve that?

    Read the article

  • Calling As function from js problem

    - by Gene
    I have a swf file that is not controlled by me. The swf expects a javascript call to set some variables after initialization. The swf is embedded using the swfobject and I'm trying to call the as function right after the embed. This appears to be too soon because I get an error. Everything else should be fine since calling the as function manually via firebug does not produce the error. So the question is how do I call the function when the embed is complete?

    Read the article

  • Get next key-value pair in an object

    - by captainclam
    So, given a key, I want to find the next property in an object. Then, I want to return the value of the NEXT property. I can not rely on the keys to be ordered or sequential (they're uuids). Please see below for trivial example of what I want: var db ={ a: 1, b: 2, c: 3 } var next = function(db, key) { // ??? } next(db, 'a'); // I want 2 next(db, 'b'); // I want 3 I also want a prev() function, but I'm sure it will be the same solution. This seems like such a trivial problem but I can't for the life of me figure out how to do it. Happy for the solution to use underscore.js or be written in coffeescript :)

    Read the article

  • Kill unload function in JS?

    - by Newbie
    Hello! Is there a way to kill the unload function with javascript(jquery)? I am looking for something like this: window.onbeforeunload = function(){ confirm("Close?") } or in jquery: $(window).unload(function() { confirm("close?") }); Now, on window unload I get my confirm alert but it will continue in any case. Clicking cancel it won't stay on my page. Can U help me plz?

    Read the article

  • Force download through markup or JS

    - by mschoening
    Lets assume I have a file on a CDN (Cloud Files from Rackspace) and a static html page with a link to that file. Is there any way I can force download this file (to prevent it from opening in the browser -- for mp3s for example)? We could make our server read the file and set the corresponding header to: header("Content-Type: application/force-download") but we have about 5 million downloads per month so we would rather let the CDN take care of that. Any ideas?

    Read the article

  • A brief question about JS or AJAX

    - by Luke
    I have been finding ways around this for a long time but think it's time I addressed it. If I have a page that has a dropdown menu, is there anyway I can select a value which will subsequently load other values further down. Can this be done without a page reload? I will give you an example. Say I was making some tools for an admin panel, but first of all they needed to select a member to work with. They would select the member and then below, the fields about that member would be populated based on what was selected in the first menu. As I have already asked, can this be done without a page reload? Thanks for reading.

    Read the article

  • Alligator tags(<% %>) inside js string?

    - by bangoker
    I am trying to redirect a page reading the url from the config file. However, when I try this: <script type="text/javascript"> <%string redirectUrl = System.Web.Configuration.WebConfigurationManager.AppSettings["RedirectURL"];%> window.parent.location.replace("<%=redirectUrl%>"); </script> the alligator tags <% % are Not being highlighted, and when I run I get the following error in the yellow screen: the controls collection cannot be modified because the control contains code blocks (i.e. <% ... %>). What am I doing wrong?? Thanks!

    Read the article

  • [DOM/JS] display table in IE

    - by budzor
    I have code like that: var xPola = 10, //how many cols yPola = 10, //how many cols bokPola = 30, //size of cell body = document.getElementsByTagName('body')[0]; var tablica = document.createElement('table'); body.appendChild(tablica); for( var y = 0; y < yPola; y++ ) { var rzad = document.createElement('tr'); tablica.appendChild(rzad); for( var x = 0; x < xPola; x++ ) { var pole = document.createElement('td'); pole.setAttribute('width', bokPola); pole.setAttribute('height', bokPola); rzad.appendChild(pole); } }; it works fine in FF, Chrome & Opera (it displays 10x10 table with 30px width&height rows). In IE nothing happens. I check in firebug lite and it is in HTML section, inside BODY tag but i see nothing. Whats wrong?

    Read the article

  • With JS add default date on TextBox

    - by senzacionale
    <asp:TextBox ID="txtDate" runat="server" AutoPostBack="true" OnTextChanged="txtDate_TextChanged"></asp:TextBox> how can with Jquery add default date. I do not know where and when to call this code: function addDefaultDate() { if ($('#txtDate').val().length == 0) { var now = new Date(); $('#txtDate').text(now.getDate() + '.' + now.getMonth() + '.' + now.getYear()); } }

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • I want to style within JS

    - by 422
    Issue I have is I can use tags, but I would like to style particular words. Adding a class doesnt work, is it because I am within script dom ? Example: var config = [ { "name" : "tour_1", "bgcolor" : "black", "color" : "white", "position" : "BR", "text" : "Customize your user profile, it's easy. This is your shop window on <strong>here</strong> and <strong>there</strong>", "time" : 4000 } Instead of strong, I would like to apply class, like <p class="orange"> But it wont have it, any suggestions... please

    Read the article

  • MooTools is not a function js error

    - by Adriane
    hello whatever i append to $('click_filter1') it shows the error ... is not a function (for show(), hide(), toggle()) if i insert an alert, the alert gets executed, so the framework is init ok the element with the id exists for sure what can be the problem of this? why iam getting this error? $('click_filter1').addEvent('click', function() { $('click_filter1').show(); }.bind(this));

    Read the article

< Previous Page | 44 45 46 47 48 49 50 51 52 53 54 55  | Next Page >