Search Results

Search found 46949 results on 1878 pages for 'name matching'.

Page 48/1878 | < Previous Page | 44 45 46 47 48 49 50 51 52 53 54 55  | Next Page >

  • How to use the same element name in different purposes ( in XML and DTD ) ?

    - by BugKiller
    Hi, I Want to create a DTD schema for this xml document: <root> <student> <name> <firstname>S1</firstname> <lastname>S2</lastname> </name> </student> <course> <name>CS101</name> </course> </root> as you can see , the element name in the course contains plain text ,but the element name in the student is complex type ( first-name, last-name ). The following is the DTD: <!ELEMENT root (course|student)*> <!ELEMENT student (name)> <!ELEMENT name (lastname|firstname)> <!ELEMENT firstname (#PCDATA)> <!ELEMENT lastname (#PCDATA)> <!ELEMENT course (name)> When I want to validate it , I get an error because the course's name has different structure then the student's name . My Question: how can I make a work-around solution for this situation without changing the name of element name using DTD not xml schema . Thanks.

    Read the article

  • Matching .NET References to Namespaces

    - by maxp
    This seems confusing to me - im creating a class library, and adding all the necessary references for the source files contained in it. Now, off the bat, there were over 300 compiler errors complaining about missing namespaces. The library will now compile after i just added all of the System.* references, however this is obviously not the best way. I.e. if a classes needs using System.Web.Script;, there is no System.Web.Script reference, how would i find out which one of these references contained it? System.Web didnt.

    Read the article

  • How can I handle a .org domain on my own nameserver without paying for unwanted services?

    - by etuardu
    I have a dot org domain that I use to run a website. Until now, I had an account onto a hosting+domain provider. Recently I thought to run the website on my own webserver and to handle the domain on my own nameserver. What do I need to do in order to handle my .org domain by my own? Do I still need a registrar? Is there a more direct way that pir.org provide in order to fill in just a nameserver to be bound to a domain name?

    Read the article

  • wpf & validation application block > message localization > messageTemplateResource Name&Type

    - by Shaboboo
    I'm trying to write validation rules for my data objects in a WPF application. I'm writing them in the configuration file, and so far they are working fine. I'm stumped on how to localize the messages using messageTemplateResourceName and messageTemplateResourceType. What I know is that the strings can be writen in a resource file, given a name and referenced by that name. I get the idea, but i haven't been able to make this work. <ruleset name="Rule Set"> <properties> <property name="StringValue"> <validator lowerBound="0" lowerBoundType="Ignore" upperBound="25" upperBoundType="Inclusive" negated="false" messageTemplate="" messageTemplateResourceName="msg1" messageTemplateResourceType="Resources" tag="" type="Microsoft.Practices.EnterpriseLibrary.Validation.Validators.StringLengthValidator, Microsoft.Practices.EnterpriseLibrary.Validation" name="String Length Validator" /> </property> </properties> </ruleset> Where is the resource file and what value do I pass to messageTemplateResourceType? I have tried writing the messages in the shell project's resource file but no sucess trying to retrieve the value. I only get the default built-in message. I've tried messageTemplateResourceType="typeof(Resources)" messageTemplateResourceType="Resources" messageTemplateResourceType="Resources.resx" messageTemplateResourceType="typeof(Shell)" messageTemplateResourceType="Shell" messageTemplateResourceType="Shell, Version=1.0.0.0, Culture=neutral, PublicKeyToken=null" I've also tried adding a new resource file in the shell project, and adding a resource file to the data object's library. I'm all out of ideas Does anyone have any suggestions? I'm not even married to the idea of resource files, so if there are other ways to localize these messages I'd love to know! thanks

    Read the article

  • Finding matching submatrics inside a matrix

    - by DaveO
    I have a 100x200 2D array expressed as a numpy array consisting of black (0) and white (255) cells. It is a bitmap file. I then have 2D shapes (it's easiest to think of them as letters) that are also 2D black and white cells. I know I can naively iterate through the matrix but this is going to be a 'hot' portion of my code so speed is an concern. Is there a fast way to perform this in numpy/scipy? I looked briefly at Scipy's correlate function. I am not interested in 'fuzzy matches', only exact matches. I also looked at some academic papers but they are above my head.

    Read the article

  • HttpContext.Current.User.Identity.Name loses value

    - by Yagami
    Hi, I am using HttpContext.Current.User.Identity.Name to get a user id from 2 web application i'am developping. the problem is when i'am loggin in teh first application i get always HttpContext.Current.User.Identity.Name value (i put test in Application_AuthenticateRequest event) but when i log in teh 2nd application adn i ty to naviagte trough the 1st application teh HttpContext.Current.User.Identity.Name loses value. Environnement of test : Windows XP / VS.NET 2005 / Authentication forms BTW : both application are deployed in teh same machine Thank you for your help

    Read the article

  • Can I get a person's display name or composite name from Apple AddressBook on OSX platform?

    - by AlexT
    I have come across ABRecordCopyCompositeName() in these pages but, having Spotlighted it, have a hunch it's only available for the IOS platform. The AddressBook app itself, and ABPeoplePicker obviously do something similar internally, so is there an equivalent API for OSX? It's a tedious thing to retrieve title, first name, middle name, last name, suffix and work out if it's a company before building it yourself.

    Read the article

  • strstr matching first occurrence in c

    - by lex0273
    I was wondering how could I match the string "just" in str1 if str1 contains the strings as: "this is just\2323 a test" // "just" will always be the same I'm trying to match it using strstr but so far it won't match because of the \xxxx Any suggestions on how to match it? Thanks

    Read the article

  • Pattern Matching in Columns

    - by Chronicles
    File 1 A11;F1;BMW A23;F2;BMW B12;F3;BMW H11;F4;JBW File 2 P01;A1;0;0--00 ;123;456;150 P01;A11;0;0--00 ;123;444;208 P01;B12;0;0--00 ;123;111;36 P01;V11;0;0--00 ;123;787;33.9 Output -;-;-;P01;A1;0;0--00 ;123;456;150 A11;F1;BMW;P01;A11;0;0--00 ;123;444;208 B12;F3;BMW;P01;B12;0;0--00 ;123;111;36 -;-;-;P01;V11;0;0--00 ;123;787;33.9 I TRIED awk 'FNR==NR {a[$2] = $0; next }{ if($1 in a) {p=$1;$1="";print a[p],$0}}' File1 File2 But didnt work. Basically I want to get the details from FILE 1 and compare with FILE2 (master list) . Example : A1 in FILE2 was not available in FILE1 , so in output file we have “-“ for 1st three fields and rest from FILE2 . Now, we have A11 and we got the detail in FILE1. So we write details of A11 from both File 1 & 2

    Read the article

  • Matching 'weird' characters in PHP regex

    - by Bill X
    I have some strings that need a-strippin': ÜT: 9.996636,76.294363 Tons of long strings of location codes. A literal regex in PHP won't match them, IE $pattern = /ÜT:/; echo preg_replace($pattern, "", $row['location']); Won't match/strip anything. (To know it's working, /T:/ does strip the last bit of that string). What's the encoding error doing on here? Alternately, I would accept a concise way to take out just the numbers.

    Read the article

  • Fluid Columns with matching height and background image

    - by JamesArmes
    I'm working on a new layout for my site that uses a header, footer and two column center region. The two columns consist of the main content area which is fluid height and width and a right sidebar which is fluid height and fixed width. I have done similar layouts before, but this one depends on using two different background images (one for the sidebar and one for the content area). Is there any way to implement this, using proper HTML & CSS, so that the background images of the two columns are always the same height, regardless of which columns content is longer? I've tried using JavaScript to simulate this, but it doesn't work so well if there are images in the content area. I would really prefer not to use this method any way. Any help is greatly appreciated. I have setup a staging environment at http://staging.jamesarmes.net/jimmyssandbox to provide an example. This environment is not my finished product, but I want to get the containers under control before I move any further

    Read the article

  • NameServer SOA records misconfigured

    - by Khoa Bui
    This is my config of NS. hostingdk.com. SOA zone1.hostingdk.com admin.hostingdk.com 2010051905; 43100; 7200; 2419100; 86400; hostingdk.com. NS zone1.hostingdk.com. hostingdk.com. NS zone2.hostingdk.com. zone1.hostingdk.com. A 96.30.49.11 zone2.hostingdk.com. A 96.30.46.238 Both zone1 & zone2 have registered name server in Enom domain control panel. My problem is, one domain .lv cant not change DNS to my NS. They said: Error : Nameserver zone1.hostingdk.com cannot be queried for SOA Error : Nameserver zone2.hostingdk.com cannot be queried for SOA Please help me, how to fix it ?

    Read the article

  • PHP matching a string

    - by John Jones
    Hi, I have an Indian company data set and need to extract the City and Zip from the address field: Address Field Example: Gowripuram West, Sengunthapuram Post, Near L.G.B., Karur, Tamilnadu, Karur - 639 002, India As you can see the City is Karur and the zip is followed after the - (hyphen). I need the PHP code to match [city] - [zip] Not sure how to do this I can find the Zip after the Hypen but not sure how to find the City, please note the City can be 2 words. Cheers for your time./ J

    Read the article

  • How to use the same element name for different purposes ( in XML and DTD ) ?

    - by BugKiller
    Hi, I Want to create a DTD schema for this xml document: <root> <student> <name> <firstname>S1</firstname> <lastname>S2</lastname> </name> </student> <course> <name>CS101</name> </course> </root> as you can see , the element name in the course contains plain text ,but the element name in the student is complex type ( first-name, last-name ). The following is the DTD: <!ELEMENT root (course|student)*> <!ELEMENT student (name)> <!ELEMENT name (lastname|firstname)> <!ELEMENT firstname (#PCDATA)> <!ELEMENT lastname (#PCDATA)> <!ELEMENT course (name)> When I want to validate it , I get an error because the course's name has different structure then the student's name . My Question: how can I make a work-around solution for this situation without changing the name of element name using DTD not xml schema . Thanks.

    Read the article

  • Array within Form collecting multiple values with the same name possible?

    - by JM4
    Good afternoon, I will first start with the goal I am trying to accomplish and then give a very basic sample of what I need to do. Goal Instead of collecting several variables and naming them with keys individually, I have decided to give in and use an array structure to handle all inputs of the same type and rules. Once I have the variables, I will validate against them and if 'ok' store them in a MySQL table. The table will hold consumer information and will need to store multiple rows of the same type of information. First Pass I will leave out the validation portion of this question because I feel I need to first understand the basics. <form action="?" method="POST" name="Form"> Member 1 First Name:<input type="text" name="MemberFirstName[]" /><br /> Member 1 Last Name: <input type="text" name="MemberLastName[]" /><br /> Member 1 Email: <input type="text" name="MemberEmail[]" /><br /> Member 2 First Name:<input type="text" name="MemberFirstName[]" /><br /> Member 2 Last Name: <input type="text" name="MemberLastName[]" /><br /> Member 2 Email: <input type="text" name="MemberEmail[]" /><br /> Member 3 First Name:<input type="text" name="MemberFirstName[]" /><br /> Member 3 Last Name: <input type="text" name="MemberLastName[]" /><br /> Member 3 Email: <input type="text" name="MemberEmail[]" /><br /> <input type="submit" name="submit" value="Continue" /> </form> I am hoping that each input given for First Name (a required field) will generate a unique key for that particular entry and not overwrite any data entered. Because I am carrying information from page to page (checkout form), I am turning the POST variables into SESSION variables then storing in a mysql database in the end. My hope is to have: <?php $conn = mysql_connect("localhost", "username", "password"); mysql_select_db("DBname",$conn); $sql = "INSERT INTO tablename VALUES ('$_SESSION[Member1FirstName]', '$_SESSION[Member1LastName]', '$_SESSION[Member1Email]', '$_SESSION[Member2FirstName]', '$_SESSION[Member2LastName]', '$_SESSION[Member2Email]', '$_SESSION[Member1FirstName]', '$_SESSION[Member3LastName]', '$_SESSION[Member3Email]')"; $result = mysql_query($sql, $conn) or die(mysql_error()); Header ("Location: completed.php"); ?> Where Member1, Member2, and Member3 values will appear on their own row within the table. I KNOW my code is wrong but I am giving a first shot at the overall business purpose I am trying to achieve and trying to learn how to code the right way. I am very, very new to programming so any 'baby advice' is greatly appreciated.

    Read the article

  • MySQL - Return number of rows matching query data?

    - by Keir Simmons
    I have a query as follows: SELECT 1 FROM shop_inventory a JOIN shop_items b ON b.id=a.iid AND b.szbid=3362169 AND b.cid=a.cid WHERE a.cid=1 GROUP BY a.bought The only thing I need to do with this data is work out the number of rows returned (which I could do with mysqli -> num_rows;. However, I would like to know if there is a method to return the number of rows that match the query, without having to run num_rows? For example, the query should return one row, with one result, number_of_rows. I hope this makes sense!

    Read the article

  • django app with a generic name

    - by zaharpopov
    Django tutorials everywhere use constant-set application name all around - in urls file, in HTML templates, in views. But if I want to distribute an application and let the user sets it name (i.e. its URL postfix on http://server.com/appname) - how can I do? I must have some common name setting then in configuration, but how to work it for template files, etc?

    Read the article

  • php error reporting - having trouble matching local & web server settings

    - by Andrew Heath
    I'm trying to add a custom error handler to my site, but in doing so have discovered that my webhost's PHP error reporting settings and those of my localhost (default XAMPP) vary considerably. While I thought I was programming to E_STRICT like a good little boy, adding the error handler to my webhost revealed craploads of Runtime Notices. Example: Runtime notice strtotime() [function.strtotime]: It is not safe to rely on the system's timezone settings. Please use the date.timezone setting, the TZ environment variable or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Chicago' for 'CST/-6.0/no DST' instead In /home/... Clearly this isn't a red-alert, showstopping error. But what bothers me is that it doesn't show up on my localhost. I'd certainly like to improve my code by addressing these sorts of issues if I could see them! I've looked through both php.ini files, and my webhost's setting is error_reporting = E_ALL & ~E_NOTICE whereas mine was error_reporting = E_STRICT, which I had thought was better. However, changing mine to match and rebooting the server doesn't seem to have accomplished anything. Could someone please point me in the right direction?

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • Regular expressions and matching URLs with metacharacters

    - by James P.
    I'm having trouble finding a regular expression that matches the following String. Korben;http://feeds.feedburner.com/KorbensBlog-UpgradeYourMind?format=xml;1 One problem is escaping the question mark. Java's pattern matcher doesn't seem to accept \? as a valid escape sequence but it also fails to work with the tester at myregexp.com. Here's what I have so far: ([a-zA-Z0-9])+;http://([a-zA-Z0-9./-]+);[0-9]+ Any suggestions? Edit: The original intent was to match all URLs that could be found after the first semi colon.

    Read the article

  • How can I get the fully qualified name of an assembly from it's basic name?

    - by GenericTypeTea
    I'm currently writing a custom forms application that allows a user to design a data capture form. I store the field's ControlType and ControlAssembly in the database and then create them on the forms at runtime. For example: ControlType = `System.Web.UI.WebControls.TextBox`. ControlAssembly= `System.Web`. So I can therefor create a fully qualified name and create the control doing the following: string target = Assembly.CreateQualifiedName("System.Web", field.ControlType); Type type = Type.GetType(target); Control control = Activator.CreateInstance(type) as Control; But, this will cause an error as "System.Web" is not a valid assembly name. The assembly name itself has to be fully qualified, i.e. System.Web.Extensions would be: "System.Web.Extensions, Version=1.0.61025.0, Culture=neutral, PublicKeyToken=31bf3856ad364e35" Is there any way I can get the fully qualified name of the assembly System.Web without having to store the entirity of the version, culture and PKT?

    Read the article

  • Matching non-[a-zA-Z] characters in PHP regex

    - by Bill X
    I have some strings that need a-strippin': ÜT: 9.996636,76.294363 Tons of long strings of location codes. A literal regex in PHP won't match them, IE $pattern = /ÜT:/; echo preg_replace($pattern, "", $row['location']); Won't match/strip anything. (To know it's working, /T:/ does strip the last bit of that string). What's the encoding error going on here? Alternately, I would accept a concise way to take out just the numbers.

    Read the article

  • getting global name not defined error

    - by nashr rafeeg
    i have the following class class notify(): def __init__(self,server="localhost", port=23053): self.host = server self.port = port register = gntp.GNTPRegister() register.add_header('Application-Name',"SVN Monitor") register.add_notification("svnupdate",True) growl(register) def svn_update(self, author="Unknown", files=0): notice = gntp.GNTPNotice() notice.add_header('Application-Name',"SVN Monitor") notice.add_header('Notification-Name', "svnupdate") notice.add_header('Notification-Title',"SVN Commit") # notice.add_header('Notification-Icon',"") notice.add_header('Notification-Text',Msg) growl(notice) def growl(data): s = socket.socket(socket.AF_INET, socket.SOCK_STREAM) s.connect((self.host,self.port)) s.send(data) response = gntp.parse_gntp(s.recv(1024)) print response s.close() but when ever i try to use this class via the follwoing code i get 'NameError: global name 'growl' is not defined' from growlnotify import * n = notify() n.svn_update() any one has an idea what is going on here ? cheers nash

    Read the article

  • Matching tuples in Prolog

    - by milosz
    Why does Prolog match (X, Xs) with a tuple containing more elements? An example: test2((X, Xs)) :- write(X), nl, test2(Xs). test2((X)) :- write(X), nl. test :- read(W), test2(W). ?- test. |: a, b(c), d(e(f)), g. a b(c) d(e(f)) g yes Actually this is what I want to achieve but it seems suspicious. Is there any other way to treat a conjunction of terms as a list in Prolog?

    Read the article

< Previous Page | 44 45 46 47 48 49 50 51 52 53 54 55  | Next Page >