Search Results

Search found 1495 results on 60 pages for 'student pdas'.

Page 49/60 | < Previous Page | 45 46 47 48 49 50 51 52 53 54 55 56  | Next Page >

  • "Well, Swing took a bit of a beating this week..."

    - by Geertjan
    One unique aspect of the NetBeans community presence at JavaOne 2012 was its usage of large panels to highlight and discuss various aspects (e.g., Java EE, JavaFX, etc) of NetBeans IDE usage and tools. For example, here's a pic of one of the panels, taken by Markus Eisele: Above you see me, Sean Comerford from ESPN.com, Gerrick Bivins from Halliburton, Angelo D'Agnano and Ioannis Kostaras from the NATO Programming Center, and Çagatay Çivici from PrimeFaces. (And Tinu Awopetu was also on the panel but not in the picture!) On one of those panels a remark was made which has kind of stuck with me. Henry Arousell, a member of the "NetBeans Platform Discussion Panel", who works on accounting software in Sweden, together with Thomas Boqvist, who was also at JavaOne, said, a bit despondently, I thought, the following words at the start of the demo of his very professional looking accounting software: "Well, Swing took a bit of a beating this week..." That remark comes in the light of several JavaFX sessions held at JavaOne, together with many sessions from the web and mobile worlds making the argument that the browser, tablet, and mobile platforms are the future of all applications everywhere. However, then I had another look at the list of Duke's Choice Award winners: http://www.oracle.com/us/corporate/press/1854931 OK, there are 10 winners of the Duke's Choice Award this year. Three of them (JDuchess, London Java Community, Student Nokia Developer Group) are not awards for software, but for people or groups. So, that leaves seven awards. Three of them (Hadoop, Jelastic, and Parleys) are, in one way or another, some kind of web-oriented solution, though both Hadoop and Jelastic are broader than that, but are service-oriented solutions, relating to cloud technologies. That leaves four others: NATO air defense software, Liquid Robotics software, AgroSense software, and UNHCR Refugee Registration software. All these are, on the software level, Java desktop solutions that, on the UI layer, make use of Java Swing, together with LuciadMaps (NATO), GeoToolkit (AgroSense), and WorldWind (Liquid Robotics). (And, it went even further than that, i.e., this is not passive usage of Swing but active and motivated: Timon Veenstra, during his AgroSense demo, said "There are far more Swing applications out there than we seem to think. Web developers just make more noise." And, during his Liquid Robotics demo, James Gosling said: "Not everything can be done in HTML.") Seems to me that Java Swing was the enabler of more Duke's Choice Award winners this year than any other UI-oriented Java technology. Now, I'm not going to interpret that one way or another, since I've noticed that interpretations of facts tend to validate some underlying agenda. Take any fact anywhere and you can interpret it to prove whatever opinion you're already holding to be true. Therefore, no interpretation from me. Simply stating the fact that Swing, far from taking a beating during JavaOne 2012, was a more significant user interface enabler of Duke's Choice Award winners than any other Java user interface technology. That's not an interpretation, but a fact.

    Read the article

  • BI&EPM in Focus April 2012

    - by Mike.Hallett(at)Oracle-BI&EPM
    General News Oracle OpenWorld call for papers now open, now through April 9 (link) Oracle Announces Availability of Oracle Exalytics In-Memory Machine (link) Oracle EPM and BI Support Newsletter Current Edition - Volume 3 : March 2012 (link) Customers Asiana Airlines Improves Passenger Management with Near-Real-Time Reservation and Ticketing Information  Centraal Boekhuis Delivers Faster with Oracle BI 11g Essatto Software Speeds Data Aggregation Tenfold; Integrates BI, Performance Management, and Data Warehousing for Midsize Businesses Grupo WTorre Supports Management's Decision-Making with OBIEE, Ensuring Uniform, Reliable, and Consistent Data Indian Overseas Bank Cuts Planning Schedule by 45 Worker Days per Year, Assesses Market Risk Instantly with Business Intelligence System Kentucky Community and Technical College System Enables Data-Driven Decision-Making Using Integrated System with Management Dashboards National Australia Bank Achieves 200% ROI, Improves Data Quality and Reporting Integrity with Oracle Hyperion DRM R.L. Polk & Co. Enhances Business Intelligence Capabilities, Optimizes System Performance with Extreme Analytics Machine Test ResCare, Inc. Transforms Reporting to Improve Healthcare Service Performance with Oracle Business Analytics  Rochester City School District Uses OBIEE to Track Student Achievement, Identify Areas for Improvement, Accelerate Reporting  Société Générale Standardizes, Accelerates, and Improves Budget Planning Accuracy across Global Enterprise The State Accounting Office of Georgia Integrates Financial Information, Shortens Financial Closings and Streamlines Reporting across 175 Organizations   Events 4-day Oracle Real-Time Decisions Hands-on Technical Workshop for Partners (PTS, Free) May 14-17, 2012: Colombes, Paris, France Nordic events : “Latest Release of Oracle Hyperion EPM and BI Suites Helps Organizations Plan through Uncertainty, Improve Decision-Making and Meet Regulatory Requirements” (April 17, Sweden | April 18, Norway | April 19, Denmark | April 24, Finland) Webcast Replay from Balaji Yelamanchili and Paul Rodwick: “Analytics Without Limits - The Latest on Oracle Exalytics In-Memory Machine and Oracle Business Intelligence”  (link)  Wednesday, April 04, 2012: Business Analytics launch webcast: Invite your customers to register (link) Big Data Online Forum now available on Demand (link)  Enterprise Performance Management Webcast Replay: Accurate Forecasting within the Business Planning Cycle (link) Oracle Hyperion Profitability and Cost Management (HPCM) Master Support Note (link) Business  Intelligence Whitepaper: Driving Innovation Through Analytics (link) Gartner: CIOs Identify BI as the No. 1 Technology Priority for 2012 (link) Webcast Replay: Exalytics in Action: Airlines, US Census and Federal Spending Demo Applications  (link) NEWLY RELEASED Walk-in Video for Exalytics - Use This to Start Customer/Partner Meetings! (link) IDC Insight Paper: “Oracle's All-Out Assault on the Big Data Market: Offering Hadoop, R, Cubes, and Scalable IMDB in Familiar Packages” (link) System Requirements and Supported Platforms for Oracle Business Intelligence Suite Enterprise Edition 11gR1 Certification Matrix now published to include OBIEE 11.1.1.6.0 (link) Maintenance Release Guide (List of Bugs Fixed) for Oracle Business Intelligence Enterprise Edition (OBIEE) 11.1.1.6.0  (link) OBIEE 11.1.1.6: Is OBIEE 11.1.1.6 Certified With OBI Apps 7.9.6.3?  (link) Information Center: Troubleshooting Oracle Business Intelligence Applications (support login req'd)  (link)      

    Read the article

  • Data Structures usage and motivational aspects

    - by Aubergine
    For long student life I was always wondering why there are so many of them yet there seems to be lack of usage at all in many of them. The opinion didn't really change when I got a job. We have brilliant books on what they are and their complexities, but I never encounter resources which would actually give a good hint of practical usage. I perfectly understand that I have to look at problem , analyse required operations, look for data structure that does them efficiently. However in practice I never do that, not because of human laziness syndrome, but because when it comes to work I acknowledge time priority over self-development. Over time I thought that when I would be better developer I will automatically use more of them - that didn't happen at all or maybe I just didn't. Then I found that the colleagues usually in the same plate as me - knowing more or less some three of data structures and being totally happy about it and refusing to discuss this matter further with me, coming back to conversations about 'cool new languages' 'libraries that do jobs for you' and the joy to work under scrumban etc. I am stuck with ArrayLists, Arrays and SortedMap , which no matter what I do always suffice or either I tweak them to be capable of fulfilling my task. Yes, it might be inefficient but do we really have to care if Intel increases performance over years no matter if we improve our skills? Does new Xeon or IBM machines really care what we use? What if I like build things, but I am not particularly excited whether it is n log(n) or just n? Over twenty years the processing power increased enormously, which gives us freedom of not being critical about which one to use? On top of that new more optimized languages appear which support multiple cores more efficiently. To be more specific: I would like to find motivational material on complex real areas/cases of possible effective usages of data structures. I would be really grateful if you would provide relevant resources. There is similar question ,but in the end the links again mostly describe or do dumb example(vehicles, students or holy grail quest - yes, very relevant) them and people keep referring to the "scenario decides the data structure to use". I want to know these complex scenarios to be able to identify similarities to my scenario and then use them. The complex scenarios where it really matters and not necessarily of quantitive nature. It seems that data structures only concern is efficiency and nothing else? There seems to be no particular convenience for developer in use one over another. (only when I found scientific resources on why exactly simple carbohydrates are evil I stopped eating sugar and candies completely replacing it with less harmful fruits - I hope you can see the analogy)

    Read the article

  • Oracle CRM For Public Sector, Commercial Business, Education

    - by michael.seback
    Chongqing Transport Commission Improves Management of Transport Projects The Chongqing Transport Commission is responsible for public passenger, road, and waterway transport in urban and rural areas of Chongqing. The commission administers the region's road and water industry; oversees the construction of transport infrastructure; and manages civil aviation, railroads, roads, waterways, ports, and wharves. "After studying the IT initiatives of other provincial transport commissions, we decided to use Siebel Public Sector to build our integrated transport service system. The Siebel software offers powerful functions that allow us to integrate information and improve the management of our road, rail, and waterway infrastructure projects." - Chen Xiaoming, Vice Director, Information Center, Chongqing Transport Commission. Read more here. Siemens Information Services Increases Productivity by 20% Siemens Information Services Pvt, Ltd. provides back-office account processing services to Siemens' vendors. The company works with Siemens' healthcare, energy, and industry divisions in Europe, the United States, and parts of the Asia-Pacific region. It approves financial services such as processing payroll, accounts data, purchase orders, invoices, and payments, and also creates service catalogs for customers and internal teams. "Oracle CRM ON Demand provides us with a complete view of each customer's data from the moment they log a request to the time we close it. This has eliminated manual requests, and improved the service we offer to our clients across the Asia-Pacific region." -Sunil Zutshi, General Manager, IT, Siemens Information Services Pvt, Ltd. Read more here. China Distance Education Holdings Improves Call Center Productivity by 24% China Distance Education Holdings Limited is a leading provider of online education. The organization offers 174 courses through 16 Web sites, including accounting, healthcare, law, and engineering. In 2010, 215,000 students were enrolled. "Online education is a fast growing sector in China. To maintain our competitiveness, we implemented Oracle Contact Center Anywhere to make it easier and faster for our call center staff to respond to student enquiries. As a result, their productivity increased by 24%." - Qin Songjiang, Chief Technology Officer, China Distance Education Holdings Limited. Read more here.

    Read the article

  • Where can I hire local programmers with very specific skillsets?

    - by Lostsoul
    I have been browsing the site and haven't found a exact fit to this question so I'll post it but if its already answered(since I'm sure its a common problem, then let me know). I have a business and want to create a totally different product in a different industry than I'm currently in, so I learned how to program and created a working prototype. I have a bit of savings and am getting some cash flow from my current business so I can go out and hire a developer(in the future hopefully it can be permenant but right now I just need a person willing to work on contract and code on weekends or their spare time and I just want to pay in cash instead of equity or future promises). At first I wasn't sure what kind of developer to hire but this question helped me understand I should target specific skills I need as opposed to general programmers. This poses a problem for me since general programmers are everywhere but if I want specific skills I'm unsure how to get them. I thought about a list of approaches but it doesn't feel complete or effective since it seems to be assuming good developers are actively looking. If it helps I want someone local(since this is my first developer hire) and looking for skills like cuda, hadoop, hbase, java and c. Any suggestions? As a FYI, I have been thinking of approaching it as: Go to meet ups for one or more skills I need. Use LinkedIn to find people with the skills I need Search for job postings that contain skills I need and then use linkedIn to reach out to that firms employees since many profiles on linkedin are not very updated or detailed but job postings generally are. Send postings to universities and maybe find a student who loves technology so much they learned these tools on their own. Post on job board. Not sure how successful it will be to post to monster. Use Craigslist, not sure if a highly skilled developer would go here for work. What am I missing? I could be wrong but it seems like good/smart/able developers aren't hunting for work non-stop(especially in this tech job market). Plus most successful people I know have work/life balance so I'm not sure if the best ones really care about code after work. Lastly, most of the skills I need aren't used in big corporations so not sure how aggressively smart developers at small shops look for work. I don’t really know any developers personally, so but should I be using the above plan or if they live balanced lives should I be looking outside of the regular resources(and instead focus on asking around my gym or my accountant or something)? Sorry, I'm making huge assumptions here, I guess because developers are a total mystery to me. I kind of wish Jane Goodall wrote a book on understanding developers social behaviour better :-p

    Read the article

  • The Buzz at the JavaOne Bookstore

    - by Janice J. Heiss
    I found my way to the JavaOne bookstore, a hub of activity. Who says brick and mortar bookstores are dead? I asked what was hot and got two answers: Hadoop in Practice by Alex Holmes was doing well. And Scala for the Impatient by noted Java Champion Cay Horstmann also seemed to be a fast seller. Hadoop in PracticeHadoop is a framework that organizes large clusters of computers around a problem. It is touted as especially effective for large amounts of data, and is use such companies as  Facebook, Yahoo, Apple, eBay and LinkedIn. Hadoop in Practice collects nearly 100 Hadoop examples and presents them in a problem/solution format with step by step explanations of solutions and designs. It’s very much a participatory book intended to make developers more at home with Hadoop.The author, Alex Holmes, is a senior software engineer with more than 15 years of experience developing large-scale distributed Java systems. For the last four years, he has gained expertise in Hadoop solving Big Data problems across a number of projects. He has presented at JavaOne and Jazoon and is currently a technical lead at VeriSign.At this year’s JavaOne, he is presenting a session with VeriSign colleague, Karthik Shyamsunder called “Java: A Perfect Platform for Data Science” where they will explain how the Java platform has emerged as a perfect platform for practicing data science, and also talk about such technologies as Hadoop, Hive, Pig, HBase, Cassandra, and Mahout. Scala for the ImpatientSan Jose State University computer science professor and Java Champion Cay Horstmann is the principal author of the highly regarded Core Java. Scala for the Impatient is a basic, practical introduction to Scala for experienced programmers. Horstmann has a presentation summarizing the themes of his book on at his website. On the final page he offers an enticing summary of his conclusions:* Widespread dissatisfaction with Java + XML + IDEs               --Don't make me eat Elephant again * A separate language for every problem domain is not efficient               --It takes time to master the idioms* ”JavaScript Everywhere” isn't going to scale* Trend is towards languages with more expressive power, less boilerplate* Will Scala be the “one ring to rule them”?* Maybe              --If it succeeds in industry             --If student-friendly subsets and tools are created The popularity of both books echoed comments by IBM Distinguished Engineer Jason McGee who closed his part of the Sunday JavaOne keynote by pointing out that the use of Java in complex applications is increasingly being augmented by a host of other languages with strong communities around them – JavaScript, JRuby, Scala, Python and so forth. Java developers increasingly must know the strengths and weaknesses of such languages going forward.

    Read the article

  • Interesting Topics in Comp. Sci. for New Students?

    - by SoulBeaver
    I hope this is the right forum to ask this question. Last friday I was in a discussion with my professors about the students' lack of motivation and interest in the field of Computer Science. All of the students are enrolled, but through questionnaires and other questions that my professor posed it was revealed that over 90% of all enrolled students are just in it for the reward of getting a job sometime in the future (since it's a growing field with high job potential) I asked my professor for the permission to take over the first couple of lectures and try and motivate, interest and inspire students for the field of Computer Science and programming in particular (this is the Intro to Programming course). This request was granted and I now have a week to come up with a lecture topic for my professor's five groups. My main goal isn't to teach, I just want to get students to be as interested in the field as I am. I want to show them what's possible, what awesome magical things have been done in the field, the future we are heading towards using programming and Comp. Sci. Therefore, I would like to pose this question: I have a few topics, materials and sample projects that I would like to talk about: -- Grace Hopper (It is my hope to interest the female programmers in the class. There are never more than two or three per group and they, more than males, are prone to jumping ship and abandoning Comp. Sci.) -- The Singularity Institute -- Alan Turing -- Robotics -- Programming not as a chore or a must, but the idea that we are, at our core, the nexus to which anything anybody does in the digital world is connected to. We are the problem solvers; we assemble all the parts together and we are the ones that, essentially, make the vision a reality. -- Give them an idea for a programming project which, through the help of the professor, could be significant to every student (I want students to not only feel interested in the topic, but they should feel important, that what they do here makes a difference) Do you have interesting topics worthy of discussion, something I can tell the students which they can get interested about? How would you approach the lecture? If you had 90 minutes worth of time to try and get students interested in the project, what would you do?

    Read the article

  • How employable am I as a programmer?

    - by dsimcha
    I'm currently a Ph.D. student in Biomedical Engineering with a concentration in computational biology and am starting to think about what I want to do after graduate school. I feel like I've accumulated a lot of programming skills while in grad school, but taken a very non-traditional path to learning all this stuff. I'm wondering whether I would have an easy time getting hired as a programmer and could fall back on that if I can't find a good job directly in my field, and if so whether I would qualify for a more prestigious position than "code monkey". Things I Have Going For Me Approximately 4 years of experience programming as part of my research. I believe I have a solid enough grasp of the fundamentals that I could pick up new languages and technologies pretty fast, and could demonstrate this in an interview. Good math and statistics skills. An extensive portfolio of open source work (and the knowledge that working on these projects implies): I wrote a statistics library in D, mostly from scratch. I wrote a parallelism library (parallel map, reduce, foreach, task parallelism, pipelining, etc.) that is currently in review for adoption by the D standard library. I wrote a 2D plotting library for D against the GTK Cairo backend. I currently use it for most of the figures I make for my research. I've contributed several major performance optimizations to the D garbage collector. (Most of these were low-hanging fruit, but it still shows my knowledge of low-level issues like memory management, pointers and bit twiddling.) I've contributed lots of miscellaneous bug fixes to the D standard library and could show the change logs to prove it. (This demonstrates my ability read other people's code.) Things I Have Going Against Me Most of my programming experience is in D and Python. I have very little to virtually no experience in the more established, "enterprise-y" languages like Java, C# and C++, though I have learned a decent amount about these languages from small, one-off projects and discussions about language design in the D community. In general I have absolutely no knowledge of "enterprise-y" technlogies. I've never used a framework before, possibly because most reusable code for scientific work and for D tends to call itself a "library" instead. I have virtually no formal computer science/software engineering training. Almost all of my knowledge comes from talking to programming geek friends, reading blogs, forums, StackOverflow, etc. I have zero professional experience with the official title of "developer", "software engineer", or something similar.

    Read the article

  • What shall I include in a 10 week web technologies course?

    - by Iain
    In September I will be teaching a university module on web technologies. This session will be available to 1st year (freshman) students who don't necessarily have any programming knowledge or know how the web works. In the 2nd semester I will be teaching Flash, which is my specialism, so I know exactly what I am going to teach, but in the 1st semester I will be teaching them web standards technologies - HTML, CSS, JS, jQuery, PHP and MySQL. Where I need advice is how to proportion the emphasis for each part, and which parts of each technology to cover. Another real issue I'm struggling with is how much of the bad old ways should I teach them? Do they need to know about bold as well as strong, etc. UPDATE: based, on your feedback I will only be teaching the latest version of everything - CSS3, HTML5 etc. I'm not sure exactly how long the semester will be but I'm guessing about 10-12 weeks. Each session is a 2 hour lab. Obviously there's only so much I can cover in that time and it will be up to the students to go a research this stuff properly on W3 schools etc. My ideas so far were: Lesson 0 - Course intro and overview of the current tech landscape. What is out there, what will we be learning, what won't we. What is a web server, URL etc. Looking at different example websites and discussing how they work. Lesson 1 - HTML basics (head, body, title, img, table, a, lists, h1, strong etc) Lesson 2 - CSS for styling and layout - fonts, webfonts, float etc Lesson 3 - Intro to programming JS (variables, loops, conditionals, functions) Lesson 4 - more JS programming fundamentals, DOM manipulation Lesson 5 - jQuery - making things fly about and look cool Lesson 6 - XML and Ajax Lesson 7 - PHP basics - syntax, server-side principles Lesson 8 - PHP and MySQL - forms, logins, saving user info Lesson 9 - don't know Lesson 10 - don't know Please let me know if you think this is the right order, what have I missed, how to use any spare sessions etc. Thanks :) UPDATE BASED ON RESPONSES: Thanks for all your responses - some great stuff. To be absolutely clear, this is not a computer science course, it is a practical module on a creative technology course. The emphasis definitely has to be on making cool things work rather than understanding how the backbone of the internet works. That can come later, if the students are interested. At the end of the module I would like the students to be able to produce a web page or pages that does something cool, using some or all of the technologies I cover. Many of these topics are of course far beyond the scope of a 2 hour session, however I do not have the option of reducing the syllabus, I will just have to explain what the technology does and encourage the student to research it in their own time.

    Read the article

  • Software engineering project idea feedback [on hold]

    - by Chris Sewell
    I'm a third year student currently undergoing my project/dissertation section of my degree. I have drafted a proposal for my final year project and would appreciate any feedback. The feedback can be anything constructive either specific to this proposal, the area that I will be working and researching in or my ideas. I will accept all input. Aims My aim is to attempt a proof of concept and prototype a runtime-as-a-service (RaaS). This cloud based runtime will allow clients to dynamically offload tasks or create cloud applications. Currently software-as-a-service (SaaS) cloud applications are purpose built and have a predefined scope in which they can assist or serve the client; this scope cannot be changed without physical alteration to the client and server software. With RaaS the client potentially could define any task it wanted at any time depending on its environment variables, the client and server would then communicate parameters and returns for that task. For the client to utilize a RaaS it must be able to conceive and then define a task using an appropriate XML vocabulary. As the scope of the cloud solution is defined by the client at its runtime, the cloud solution only has to exist for as long as the client requires it to as opposed to a client using a dedicated service. Deliverables The crux of the project will require an XML vocabulary in which the client and server will communicate. I’ll prototype the server application that will dynamically create and manage cloud solutions. The solution will be coded using an interpreted language, such as python or javascript, which can evaluate expressions in runtime or a language that can dynamically compile such as C# or Java. As a further proof of concept I will also produce a mock client that offloads tasks to the server. The report will attempt to explain the different flavours of cloud computing solutions including infrastructure-as-a-service (IaaS), platform-as-a-service (PaaS) and SaaS including real world examples and where the use of a RaaS could have improved the overall example solution. Disclaimer: I'm not requesting stakeholders in my project nor am I delegating work. Any materials other than feedback, advice or directions will not be utilized.

    Read the article

  • From Co-op to fulltime help with salary negotation [closed]

    - by Peter
    Hey I'm a coop student that worked at a particular medium size printing company for 8 months. I had a good time it was lax, sometimes insufficiently challenging but none the less I learned a whole lot. I stuck with them for another 5 months (including this month) at the same rate I was paid then, doing testing work, tool development, taking care of emergencies when the lead developers were away, and other smaller projects and now bigger projects and problem handling (bad printer output etc.). I know their website inside out (ecommerce), and I know their printing software inside out and have made many changes to them both without a hitch. I have also done a lot of refactoring of the existing code base which as far as Im concerned, I believe am the only one to do those sorts of restructuring even though there is constant talk about it. I guess the unit testing paid off and lets me see the value in modularity if even a tad more. Never the less I have faith in my skill and the restructuring I did turned out better than I had imagined . Now the problem is that I finish school next month and so I asked for a full time spot the month after. They have been expanding and have hired a new guy a few months after my coop spot, and just now they hired a new guy to deal with the CRM application. The lead developer who wrote all of the software had left 5 months ago so it was up to all of us to learn what he had done over 4 years (including db, networking). So now I'm afraid that if I assert myself for a salary similar to the other guys, which I believe I am certainly on par with, that I would be seen as ingrateful. It's hard to flip a switch and say, hey double my pay, although when I'm working with their bread and butter (printers) and writing new features, refactoring the whole application for extensibility. I love it regardless of pay. I also feel maybe I'm replaceeble, although nobody knows the website better than myself and the lead web dev (not by a long shot), and nobody knows the printer software/drivers better than myself. I just thought they would have brought up a raise earlier on, and now it feels like they don't value my work. I'm also tired of worrying about it. I think my question is, well what do I do next?

    Read the article

  • How to end a relationship with a client without pissing them off?

    - by thesam18888
    Here's my situation: I'm a freelancing student and I was working on a software project for a client over the summer holidays of 2010. At the time I completed the application, tested it on my machine, delivered it to the client and went back to University. However the client is not completely satisfied with the product and apparently has found a couple of bugs with it. Ever since I went back to Uni, they have been chasing me up and asking me to spend some time to fix the bugs. I have explained that this is simply not possible as I am extremely busy with my Uni work and cannot afford to spare my time for anything else. The client is getting increasingly pissed off and have been chasing me by calling during lectures at evenings and even asking me if I could go over to their place over the weekend to talk about this. This is in turn pissing me off as well because they're essentially asking me to give up my education so that I could help them out by fixing bugs. I go to Uni 5 days a week, 9-6 and feel it is unreasonable for them to call me during evenings and to ask me to work over weekends etc. I would like to end my relationship with this client but would like to do it amicably without pissing them off. How can I do this? I really wish they would just find someone else but I was charging them piss-poor rates so I think they don't want to go to anyone else because they would have to pay more. EDIT The application does not seem to work perfectly on their machine. I had tested it extensively on my machine and it seemed to work fine. I am not sure what exactly is causing it to not work. I was paid a very low amount and it was on an hourly basis. e.g. I would send an invoice saying I worked on this for x amount of hours and they would pay me for it. Apart from the work itself, I have not charged them for all the time spent sending e-mails back and forth, phone calls, visits to their place etc. I would really like to end all my dealings with this client right away.

    Read the article

  • Complete Beginner to Game Programming and Unreal Engine 4, Looking For Advice [on hold]

    - by onemic
    I am currently a 2nd year programming student(Just finished my first year so I will be starting my second year in September) and have mainly learned C and C++ in my classes. In terms of what I know of C++, I know about general inheritance, polymorphism, overloading operators, iterators, a little bit about templates(only class and function templates) etc. but not of the more advanced topics like linked lists and other sequential containers(containers in general I guess), enumerations, most of the standard library(other than like strings and vectors), and probably a bunch of other stuff I dont even know about yet. I subscribed to Unreal Engine 4 as I was very intrigued by their Unreal Tournament announcement earlier this month, especially after hearing that UE4 is going completely C++. Of course my end goal in doing this programming program is to eventually go into game/graphics programming. Since it's my summer off, I thought what better way then to actually apply some of my skills to a personal project so I actually have a firmer understanding of C++ past what my professors tell me. My questions are this: What would be the best way to start off making a small personal game in UE4 as a project for the summer? What should I be aiming for, especially for someone that is still learning C++? Should I focus on making a simple 2D game rather than a 3D one to get started? Seeing the Flappy Chicken showcase intrigued me because before I thought the UE engine was pretty much pigeonholed into being for FPS games What should my expectations be going into UE4 and a game engine for the first time?(UE4 will be my first foray into making a game) What can I expect to gain from making things in UE4, in terms of making games and in terms of further fleshing out my knowledge of C++? Would you recommend I start off 100% using C++ for scripting or using the visual blueprints? Since I'm not a designer, how would I be able to add objects and designs to my game? For someone at my level is retaining the UE4 subscription worth it or is it better to cancel and resub when I learn enough about UE4 and C++? Lastly is there anything to be gained in terms of knowledge/insight through me looking at the source code for UE4? I opened it in VS2013, but noticed that most of the files were C# files and not cpp's. Thanks in advance for taking the time to answer.

    Read the article

  • Working for Web using open-source Technologies

    - by anirudha
    As a Web Developer we all have own dream to make a great web application. a great application was built upon high discipline and best practice on the process of development then we can make modification easier in future as if we want. the user feedback also have a matter because they tell us what they want or expected with the application we make day and night. sometime they report a nice story , experience or a problem they got with our application. so that's matter because they telling about our application much more because they use our software and a part of process of future development or next version of application we make. so the Web have a good thing that they updated as soon as possible. in desktop application their is a numbers of trouble client have when they want to use our application. first thing that installation of software never goes right on every system. big company spent a big amount of money to troble these problem the user have with their software.   Web application is nice implementation of application because their is no trouble with installation all have same experience and if something goes wrong patch come soon and no waiting for new version. Chrome even a desktop application [browser] but they automatically update themselves so their is no trouble for user to get next version now hasseles.    Web application development in Microsoft way have their own rule , pattern practice to make better application in less time. the technologies i want to show you here is some great opensource example like MySQL jQuery and ASP.NET MVC a framework based on ASP.NET server side language.   For going to next step we need to show you a list of software you need to have to fully experience this tutorial.   Visual Web Developer 2010 Express Edition  MySQL [open-source RDBMS]   Query [open-source javascript library]   for getting these software you need to pay nothing.   Visual Web Developer can obtained from Microsoft.com/Express or if you are student or Web Developer you are eligible to get the Visual studio professional and many other great software from Microsoft through their Dreamspark or WebsiteSpark programmes.   MySQL is a great Relational Database management software who are freely available from MySQL.com as a database monitorting tool you can use MySQL workbrench who can be freely get from MySQL official website or many other free tool are available for begining development with MySQL   jQuery is a great library for making javascipt development easier and faster.you can obtained jQuery from jQuery.com their official website.

    Read the article

  • The type of programmer I want to be [closed]

    - by Aventinus_
    I'm an undergraduate Software Engineer student, although I've decided that pure programming is what I want to do for the rest of my life. The thing is that programming is a vast field and although most of its aspects are extremely interesting, soon or later I'll have to choose one (?) to focus on. I have several ideas on small projects I'd like to develop this summer, having in mind that this will gain me some experience and, in the best scenario, some cash. But the most important reason I'd like to develop something close to “professional” is to give myself direction on what I want to do as a programmer. One path is that of the Web Programmer. I enjoy PHP and MySQL, as well as HTML and CSS, although I don't really like ASP.NET. I can see myself writing web apps, using the above technologies, as well as XML and Javascript. I also have a neat idea on a Facebook app. The other path is that of the Desktop Programmer. This is a little more complicated cause I really-really enjoy high level languages such as Java and Python but not the low level ones, such as C. I use both Linux and Windows for the last 6 years and I like their latest DEs (meaning Gnome Shell and Metro). I can see myself writing desktop applications for both OSs as long as it means high level programming. Ideally I'd like being able to help the development of GNOME. The last path that interests me is the path of the Smartphone Programmer. I have created some sample applications on Android and due to Java I found it a quite interesting experience. I can also see myself as an independent smartphone developer. These 3 paths seem equally interesting at the moment due to the shallowness of my experience, I guess. I know that I should spend time with all of them and then choose the right one for me but I'd like to know what are the pros and cons in terms of learning curve, fun, job finding and of course financial rewards with each of these paths. I have fair or basic understanding of the languages/technologies I described earlier and this question will help me choose where to focus, at least for now.

    Read the article

  • "Could not establish secure channel for SSL/TLS" in .NET CF application on smart phone

    - by Stefan Mohr
    I have a stubborn communications issue with an application running on the .NET Compact Framework 3.5 on Windows Mobile smartphones. I am constructing a web request using this code: UTF8Encoding encoding = new System.Text.UTF8Encoding(); byte[] Data = encoding.GetBytes(HttpUtility.ConstructQueryString(parameters)); httpRequest = WebRequest.Create((domain)) as HttpWebRequest; httpRequest.Timeout = 10000000; httpRequest.ReadWriteTimeout = 10000000; httpRequest.Credentials = CredentialCache.DefaultCredentials; httpRequest.Method = "POST"; httpRequest.ContentType = "application/x-www-form-urlencoded"; httpRequest.ContentLength = Data.Length; Stream SendReq = httpRequest.GetRequestStream(); SendReq.Write(Data, 0, Data.Length); SendReq.Close(); HttpWebResponse httpResponse = (HttpWebResponse)httpRequest.GetResponse(); return httpResponse.GetResponseStream(); The web service functions by receiving a JSON-encoded document as part of the URL (eg. https://site.com/ws/sync??document={"version":"1.0.0","items":[{"item_1":"item1"}]}&user=usr&password=pw), and as a response receives another JSON document as response data. This code runs fine on all emulators and PDAs running WM 5 and 6. We have seen an issue with a couple of customers running Treo smartphones (and only on the Sprint network). We have tested the code on an identical device on the AT&T network (via DeviceAnywhere) and once again the code worked as we expected. This has to be some sort of security policy on the phone, but we've been unable to determine a workaround or diagnose it thoroughly as we cannot reproduce it in house and have had to resort to getting users to assist with running test drivers for us. When this code executes, the user's device throws the following exception: System.Net.WebException Could not establish secure channel for SSL/TLS Stack trace: at System.Net.HttpWebRequest.finishGetRequestStream() at System.Net.HttpWebRequest.GetRequestStream() at OurApp.GetResponseStream(String domain, Hashtable parameters) inner exception: System.IO.IOException Authentication failed because the remote party has closed the transport stream. Stack trace: at System.Net.SslConnectionState.ClientSideHandshake() at System.Net.SslConnectionState.PerformClientHandShake() at System.Net.Connection.connect(Object ignored) at System.Threading.ThreadPool.WorkItem.doWork(Object o) at System.Threading.Timer.ring() Examining the server Apache logs shows no hits from the user's IP - I don't think the device is even attempting to send a packet before failing. If relevant, the server is running Apache on Linux and is written using the TurboGears Python framework. The server certificate is issued by a CA and is still valid. The test driver where this error was copied from was not code signed, however the same error (without the error messages) is signed with a GeoTrust certificate so we don't believe this is a code signing issue. The application installs and launches without issue on all phones - it's just establishing this SSL connection that is breaking for these users. One significant issue in troubleshooting is that there is a substantial inconvenience each time we try out a solution (need to find a "volunteer" customer), so we're really looking for a silver bullet or a better understanding of the handshaking process so we can be reasonably confident we only need to ask the user to test it one or two more times. One final mention: we have tried the sync both over ActiveSync and also over GPRS with identical results. Any thoughts would be greatly appreciated!

    Read the article

  • Weird routing issue

    - by Joel Coel
    I'm having some weird internet problems on campus. I know it's something simple, but it's a case where I need another set of eyes. I think I can explain the problem best by posting a tracert: Tracing route to google.com [74.125.45.147] over a maximum of 30 hops: 1 3 ms 3 ms 3 ms 192.168.8.1 2 1 ms 1 ms 1 ms elissaemily-pc.york.edu [192.168.10.5] 3 2 ms 2 ms 2 ms rrcs-76-79-19-33.west.biz.rr.com [76.79.19.33] 4 31 ms 3 ms 2 ms ge-1-1-0.lnclne00-mx41.neb.rr.com [76.85.220.109] 5 20 ms 17 ms 17 ms ge-7-3-0.chcgill3-rtr1.kc.rr.com [76.85.220.137] 6 20 ms 20 ms 19 ms ae-5-0.cr0.chi30.tbone.rr.com [66.109.6.112] 7 19 ms 19 ms 24 ms ae-1-0.pr0.chi10.tbone.rr.com [66.109.6.155] 8 26 ms 24 ms 24 ms 74.125.48.109 9 23 ms 24 ms 21 ms 216.239.46.246 10 39 ms 39 ms 55 ms 209.85.242.215 11 39 ms 39 ms 39 ms 209.85.254.243 12 39 ms 40 ms 96 ms 209.85.253.145 13 39 ms 39 ms 39 ms yx-in-f147.1e100.net [74.125.45.147] Trace complete. Note the second entry in there. Not only is the host name a student's computer, but the ip address doesn't exist. Dhcp shows that host as having a different address and you can't ping any 192.168.10.5. Yet somehow it's routing packets for us (and not very well, either — things are slow right now). The basic network routing table looks like this: Destination Subnet Mask Gateway --------------------------------------- Default Route -- 10.1.1.5 (our firewall) 10.0.0.0 255.0.0.0 -- 192.168.8.0 255.255.252.0 --

    Read the article

  • Find Search Replace from landmark to landmark - including everything in between

    - by Erick Tronboll
    Appreciate some Jedi help... I have the following string: gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR repeating sporadically throughout my document and want to remove everything from: gi|37463 to the AAMGR sequence but, I want to keep the blocks where JQ250 appears: gi|374638936|gb|*JQ250*332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC and remove only the lines that have AEZ554 gi|374638939|gb|*AEZ554*52.1| myosin light chain 2, partial [Batrachoseps major] AAMGR ..................................... So, ideally the following block: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638935|gb|AEZ55450.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638937|gb|AEZ55451.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR Would be left as just: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC ................................many thanks as I help a struggling Grad Student

    Read the article

  • Windows Server 2008 R2 RAS VPN: access server on internal interface ip

    - by Mathias
    short question: I'm usually a linux admin but need to setup a Win2k8 R2 server for a student project. The server is running as VM on a root server and has a public internet IP assigned. Additionally I need a VPN server to access some services running on the server. I managed to set up a working VPN gateway via the Routing and RAS service which assigns clients an IP in the private subnet 192.168.88.0/24 with the Interface "Internal" listening on 192.168.88.1. Additionally I set up the external interface as NAT interface. So I can connect to the VPN server, get an IP assigned and the server additionally does NAT and I can access the internet over the VPN connection. The only thing I additionally need, is that I can access the server itself over that internal IP (e.g. client 192.168.88.2, server 192.168.88.1) as I want to access some services which I don't like to expose to the internet and restrict them to connected VPN clients. Does anybody have a hint, which configuration I'm missing here to be able to access the server over the VPN connection? EDIT: VPN clients get assigned the IP from the private subnet with subnetmask 255.255.255.255, I guess that might be the reason I can't access the server on the private IP address although it's in the same network range. Any ideas how to change this? I defined a static address pool in the Routing and RAS service, but I can't change the netmask there. EDIT2: I can't access the server from the client, but I can fully access the client from the server (ping, HTTP). I guess it has to do with firewall configuration. Thanks in advance, Mathias

    Read the article

  • Windows Server 2008 R2 RAS VPN: access server on internal interface ip

    - by Mathias
    Hey, short question: I'm usually a linux admin but need to setup a Win2k8 R2 server for a student project. The server is running as VM on a root server and has a public internet IP assigned. Additionally I need a VPN server to access some services running on the server. I managed to set up a working VPN gateway via the Routing and RAS service which assigns clients an IP in the private subnet 192.168.88.0/24 with the Interface "Internal" listening on 192.168.88.1. Additionally I set up the external interface as NAT interface. So I can connect to the VPN server, get an IP assigned and the server additionally does NAT and I can access the internet over the VPN connection. The only thing I additionally need, is that I can access the server itself over that internal IP (e.g. client 192.168.88.2, server 192.168.88.1) as I want to access some services which I don't like to expose to the internet and restrict them to connected VPN clients. Does anybody have a hint, which configuration I'm missing here to be able to access the server over the VPN connection? EDIT: VPN clients get assigned the IP from the private subnet with subnetmask 255.255.255.255, I guess that might be the reason I can't access the server on the private IP address although it's in the same network range. Any ideas how to change this? I defined a static address pool in the Routing and RAS service, but I can't change the netmask there. EDIT2: I can't access the server from the client, but I can fully access the client from the server (ping, HTTP). I guess it has to do with firewall configuration. Thanks in advance, Mathias

    Read the article

  • Apache / PHP Begins to Deny SQL Requests after about 2000

    - by Daniel Stern
    We have a web page on our server that we use to run administrative scripts. For example, we might run the script "unenrolStudents()" which runs 5,000 SQL SET commands one after another and sets 5000 student entries in an SQL database to unenrolled. However, we are finding that after running a few thousand queries (it is not totally consistent) we will be "locked out" by our server. SYMPTOMS OF LOCKING OUT: - unable to connect to server with winSCP - opening putty with that connection shows a blank screen (no login / pass) - clearing cookies / cache in chrome does NOT fix locking out - other computers in the office ALSO become locked out - locking out can be triggered with a high frequency of requests (10000 in 1 second) or by less over time (10000 in 500 seconds - this will still cause a lockout even though the frequency is much less) We believe this is a security feature of our own Apache. I know we are using Suhosin but I didn't configure it so I don't know. How can I disable this locking effect so that I can confidently run all my SQL requests and they will go through? Has anyone else dealt with this and found workarounds? Thanks DS

    Read the article

  • Software to automate website screenshot capture

    - by Leniel Macaferi
    Do you know any software that can automate the process of getting screenshots of every page of a website? It would act like a spider/crawler/robot. You name it... For example: I developed a website and now I'd like to get a screenshot of every page of the site. I of course could do it manually (a lot of work). For each module of the site (Student, Payment, etc) I have different pages (Create, Edit, Details, Delete, etc) forms. The thing I'm looking for is a software that can visit every link of the site and then capture the screen - a software that can automate the whole process. It would also be good if the software allowed the user to pass a list of URLs to capture screenshots allowing even more fine grained configuration. EDIT: I tried Selenium mentioned by Aaron in his answer but I managed to find an app that does exactly what I needed. It's called Paparazzi!. I wrote a blog post to showcase my attempt at Selenium and the findings regarding Paparazzi!'s batch capture functionality: Software to automate website screenshot capture

    Read the article

  • Internet Radio Station for University

    - by ryan
    I am trying to help my University Student Radio station rethink the setup of the way they stream music, but I have some questions regarding the use of Ubuntu to stream music. Currently, the radio station uses two windows machines: one of which is used to stream the radio station and serve the website, and the other is used by rotating djs to select songs and create playlists. The computer used by djs feeds mono into the sound card of the server and the server streams the feed online. -Ideally I would like to maintain a two-computer setup: One computer as server, and another that is used to select and play music by rotating djs. -I would like to use Ubuntu for the server. -I would like to use Windows for the other machine. -The server should be able to stream song information. First, is there a way to somehow get the song information from an analog feed? Second, what is the best streaming server for radio? I have encountered shoutcast, icecast, and darwin, but I don't know where to begin in attempting to gauge them. Finally, if anyone has any tips or pointers about small internet radio station management/ setup they would be appreciated as this is my first radio station, and I am eager to hear of past experiences.

    Read the article

  • open source solution to a gateway for a network of a housing cooperative of 150 people

    - by SirDinosaur
    i just inherited a barely functioning network for a student housing cooperative of about 150 people. in it's current state, as i understand it from the previous person in charge of the network, we have working wireless access points and working ethernet cords going to working gigabit switches going to a barely functioning gateway (right now a simple home router) to one of three possible outbound connections. it is possible to connect to the network through the wireless or ethernet, but especially during peak hours, packets / connections are likely dropped or otherwise get no response. my intuition tells me to replace the gateway with something that can handle multiple outbound connections (WAN) and one inbound connection (LAN), while the rest of the network seems suitable for now. i'm somewhat knowledgable in Linux (been using Debian after first Arch Linux) and i want to use as much open source as possible, but i'm confused whether or not a simple server that i could easily understand will work for this situation. do i need specialized hardware to handle the switching more effectively? if so, what are my options? (i found this, thoughts?) or if a Debian server would work, anything else i should about the specs required for this type of server? also links to any useful information on using open source to maintain this type of network would be most appreciated. <3 P.S. crossposted http://redd.it/yybp2.

    Read the article

  • Cheap desktop computer in 19" rack-mountable form-factor?

    - by Alex Basson
    I'm a high school teacher at a small private school. As of this year, we have SMARTBoards in every classroom (though I've had one in the class I share for two years now). The classrooms themselves don't have computers in them, so we teachers bring our laptops to class and connect them to the boards. This has several disadvantages: This takes a few minutes while we wait for the board to boot up and then orient the board to our individual laptop -- we have to do this every time b/c different teachers have different laptops requiring different orientations. This isn't ideal because when you only have 43 minutes per class period, waiting five minutes just to get started is a real waste. Carrying your laptop to class doesn't sound so bad until you consider that we're also carrying textbooks and piles of student papers, and we're carrying it all through crowded high school hallways. More than one laptop has fallen THUNK to the floor, with dire consequences. We feel we could eliminate the need to use our laptops with the SMARTBoards if we had a dedicated computer in each classroom hooked up to the board at all times. Each board set-up is connected to a podium with a standard 19" rack in it, currently housing a power supply and DVD player. There're plenty of rack spaces available. So I'm thinking: maybe we could get some inexpensive computers in a 19" rack-mountable form factor, install them in the podiums, and connect them to the boards on a permanent basis. Any suggestions?

    Read the article

< Previous Page | 45 46 47 48 49 50 51 52 53 54 55 56  | Next Page >