Search Results

Search found 33068 results on 1323 pages for 'list manipulation'.

Page 502/1323 | < Previous Page | 498 499 500 501 502 503 504 505 506 507 508 509  | Next Page >

• Finding days between two dates

  - by Ram

  I need to get all the dates between two dates For example Start date : 04/06/2010 End Date : 10/06/2010 Then, it has to list out 05/06/2010 06/06/2010 07/06/2010 08/06/2010 09/06/2010 Thanks

  Read the article

• Blackberry RepeatRule

  - by Vinay

  Hi All, I am very new to Blackberry development. I am trying to access the Blackberry Events (Calender) list. Currently, I am able to read the basic information from the event list. I am stuck in getting the info regarding the RepeatRule. My code is as below: EventList eventList = (EventList)PIM.getInstance().openPIMList(PIM.EVENT_LIST, PIM.READ_ONLY); Enumeration e = eventList.items(); while (e.hasMoreElements()) { Event event = (Event)e.nextElement(); RepeatRule rRule = event.getRepeat() ; if (rRule != null) { fieldIds = rRule.getFields() ; // Here I get the values as { 0,128,64,2}. How do I decode this information? } } Can any one help in decoding this information. Any kind of links, examples or pointers would be of great help. Thanks and regards, Vinay

  Read the article

• Datetime comparaison in CAML Query for Sharepoint

  - by Garcia Julien

  Hi, i'm trying to have some item from a sharepoint list, depends on date in a custom column. I've created my query with 2U2 Caml Builder, and that's worked but when I put it in my own code in my webpart, it always return to me all the items od the list. Here is my code: DateTime startDate = new DateTime(Int32.Parse(year), 1, 1); DateTime endDate = new DateTime(Int32.Parse(year), 12, 31); SPQuery q = new SPQuery(); q.Query = "<Query><Where><And><Geq><FieldRef Name='Publicate Date' /><Value IncludeTimeValue='FALSE' Type='DateTime'>" + SPUtility.CreateISO8601DateTimeFromSystemDateTime(startDate) + "</Value></Geq><Leq><FieldRef Name='Publicate_x0020_Date' /><Value IncludeTimeValue='FALSE' Type='DateTime'>" + SPUtility.CreateISO8601DateTimeFromSystemDateTime(endDate) + "</Value></Leq></And></Where></Query>"; SPListItemCollection allItem = library.GetItems(q);

  Read the article

• Can AutoMapper call a method on destination for each member of collection on source?

  - by YonahW

  I have two classes as below. public class Destination { public Destination() { _StringCollection = new List<String>(); } private ICollection<String> _StringCollection; public IEnumerable<String> StringCollection { get { return _StringCollection.AsEnumerable<String>(); } } public void AddString(string str) { _StringCollection.Add(str); } } public class Source { public List<String> StringCollection { get; set; } } I would like to map that for each member of source call AddString(member) on Destination. I thought that maybe I could do something with a custom resolver but can't seem to figure out how.

  Read the article

• How to use custom color for each textview in listview that extends SimpleAdapter in Android ?

  - by mob-king

  I have a listview with custom rows and that extends SimpleAdapter. Each row consist of two linear layouts : 1st having two textviews of which one is hidden in horizontal orientation, second having two textviews in horizontal orientation. Now depending on the value in hidden textview , I want to setcolor for the remaining items for the row. To put it as simple: each listview item has some custom colors the value of which comes from the hidden field. I have done this by overriding getview() for the simpleadapter and returning view for each, but this makes list very slow to render (and that I think is obvious as so much of work for each view before showing it). Can I do this in some more efficient way ? like making views and then add up to list instead of using xml layout maybe one solution OR any other ? Any help ? Thanks.

  Read the article

• How do I create a simple seach box with a submit button to bring back a result set in MVC?

  - by RJ

  I am very new to MVC and just learning the basics. I have been following along in Nerd Dinner and used the demo as a way to create my own app. I have created a page that lists out some food items with calories, fat, protein,etc... (http://rjsfitness.net/CalorieList) This is one of my own personal sites that I set up to test out MVC. I got a lot of it working but I am stuck on the textbox with a search button. My view page has this code for the search: <form action="/CalorieList/Search" method="post" id="searchForm"> <input type="text" name="searchTerm" id="searchTerm" value="" size="10" maxlength ="30" /> <input type ="submit" value="Search" /> </form> My global.asax has this code for the routing: routes.MapRoute( "Search", // Route name "CalorieList/Search/{searchTerm}", // URL with parameters new { controller = "CalorieList", action = "Search", search = "" } // Parameter defaults ); My Controller has this code: public ActionResult Index(int? page) { const int pageSize = 10; //load a list with the calorie list var calorieLists = calorieListRepository.GetAllCalorieLists(); //var paginatedCalorieLists = calorieLists.Skip((page ?? 0) * pageSize).Take(pageSize).ToList(); var paginatedCalorieLists = new PaginatedList<CalorieList>(calorieLists, page ?? 0, pageSize); return View("Index", paginatedCalorieLists); } public ActionResult Search(String searchTerm) { const int pageSize = 100; int? page = 0; var calorieLists = calorieListRepository.GetCalorieListsBySearch(searchTerm); var paginatedCalorieLists = new PaginatedList<CalorieList>(calorieLists, page ?? 0, pageSize); return View("Index", paginatedCalorieLists); } return View("Index", paginatedCalorieLists); } When I enter a value and click the button, the Index method fires instead of the Seach method in the controller and I get the full list again. If I manually type the url (http://rjsfitness.net/CalorieList/Search/choc) I get the right listing. Why isn't my button click using the right routing and giving me the search results?

  Read the article

• Find all paths from root to leaves of tree in Scheme

  - by grifaton

  Given a tree, I want to find the paths from the root to each leaf. So, for this tree: D / B / \ A E \ C-F-G has the following paths from root (A) to leaves (D, E, G): (A B D), (A B E), (A C F G) If I represent the tree above as (A (B D E) (C (F G))) then the function g does the trick: (define (g tree) (cond ((empty? tree) '()) ((pair? tree) (map (lambda (path) (if (pair? path) (cons (car tree) path) (cons (car tree) (list path)))) (map2 g (cdr tree)))) (else (list tree)))) (define (map2 fn lst) (if (empty? lst) '() (append (fn (car lst)) (map2 fn (cdr lst))))) But this looks all wrong. I've not had to do this kind of thinking for a while, but I feel there should be a neater way of doing it. Any ideas for a better solution (in any language) would be appreciated.

  Read the article

• Setting minOccurs="0" (required) on web service parameters of type int

  - by Alex Angas

  I have an ASP.NET 2.0 web method with the following signature: [WebMethod] public QueryResult[] GetListData( string url, string list, string query, int noOfItems, string titleField) I'm running the disco.exe tool to generate .wsdl and .disco files from this web service for use in SharePoint. The following WSDL for the parameters is being generated: <s:element minOccurs="0" maxOccurs="1" name="url" type="s:string" /> <s:element minOccurs="0" maxOccurs="1" name="list" type="s:string" /> <s:element minOccurs="0" maxOccurs="1" name="query" type="s:string" /> <s:element minOccurs="1" maxOccurs="1" name="noOfItems" type="s:int" /> <s:element minOccurs="0" maxOccurs="1" name="titleField" type="s:string" /> Why does the int parameter have minOccurs set to 1 instead of 0 and how do I change it? I've tried using [XmlElementAttribute(IsNullable=false)] in the parameter declaration without success.

  Read the article

• Adding meeting action points in MediaWiki and viewing them in another page

  - by Mark Robinson

  In the minutes of a meeting we want to be able to place action points in the text. Then we want easily to be able to print a list of action points, e.g. via another page. So the minutes will be: blah blah blah #AP1 ... blah blah blah #AP2... blah And then we want a list like this: #AP1 #AP2 How would we do this? Is there e.g. a solution with templates or an extension?

  Read the article

• Surface Detection in 2d Game?

  - by GamiShini

  I'm working on a 2D Platform game, and I was wondering what's the best (performance-wise) way to implement Surface (Collision) Detection. So far I'm thinking of constructing a list of level objects constructed of a list of lines, and I draw tiles along the lines. ( http://img375.imageshack.us/img375/1704/lines.png ). I'm thinking every object holds the ID of the surface that he walks on, in order to easily manipulate his y position while walking up/downhill. Something like this: //Player/MovableObject class MoveLeft() { this.Position.Y = Helper.GetSurfaceById(this.SurfaceId).GetYWhenXIs(this.Position.X) } So the logic I use to detect "droping/walking on surface" is a simple point (player's lower legs)-touches-line (surface) check (with some safety approximation - let`s say 1-2 pixels over the line). Is this approach OK? I`ve been having difficulty trying to find reading material for this problem, so feel free to drop links/advice.

  Read the article

• Serialize a generic collection specifying element names for items in the collection

  - by mdresser

  I have a simple class derived from a generic list of string as follows: [Serializable] [System.Xml.Serialization.XmlRoot("TestItems")] public class TemplateRoleCollection : List<string> { } when I serialize this, I get the following XML: <TestItems> <string>cat</string> <string>dog</string> <string>wolf</string> </TestItems> Is there any way to override the xml element name which is used for serializing items in the collection? I would like the following xml to be produced: <TestItems> <TestItem>cat</TestItem> <TestItem>dog</TestItem> <TestItem>wolf</TestItem> </TestItems>

  Read the article

• customising serialisation of java collections using xstream

  - by Will Goring

  I have an object that needs to be serialised as XML, which contains the following field: List<String> tags = new List<String>(); XStream serialises it just fine (after some aliases) like this: <tags> <string>tagOne</string> <string>tagTwo</string> <string>tagThree</string> <string>tagFour</string> </tags> That's OK as far as it goes, but I'd like to be able to rename the <string> elements to, say, <tag>. I can't see an obvious way to do that from the alias documentation on the XStream site. Am I missing something obvious?

  Read the article

• I have to select the checkbox two times to check/uncheck in jTable

  - by 117526709403775781607

  I have a jTable code i intend to use, but the problem with it is that when i click on the checkbox once it doesn't select/deselect it, instead i have to click twice. But if i select any other cell in the row except the one containing the checkbox the purpose is solved. HERE IS MY CODE : public class TableSelectionTest extends JFrame implements ListSelectionListener { private final int COLUMN_COUNT = 5; private TblModel model; public TableSelectionTest() { initialize(); setDefaultCloseOperation(EXIT_ON_CLOSE); pack(); } private void initialize() { List data = new ArrayList(); for (int i = 0; i < 10; i++) { Object record[] = new Object[COLUMN_COUNT]; record[0] = Boolean.FALSE; for (int j = 1; j < COLUMN_COUNT; j++) { record[j] = new Integer(j); } data.add(record); } model = new TblModel(data); JTable table = new JTable(model); table.getSelectionModel().setSelectionMode(ListSelectionModel.SINGLE_SELECTION); table.getSelectionModel().addListSelectionListener (this); JScrollPane scroll = new JScrollPane(table); getContentPane().add(scroll, BorderLayout.CENTER); } public static void main(String[] args) { TableSelectionTest f = new TableSelectionTest(); f.show(); } class TblModel extends AbstractTableModel { private List data; public TblModel(List data) { this.data = data; } public int getColumnCount() { return COLUMN_COUNT; } public int getRowCount() { return data == null ? 0 : data.size(); } public void setValueAt(Object value, int rowIndex, int columnIndex) { getRecord(rowIndex)[columnIndex] = value; super.fireTableCellUpdated(rowIndex, columnIndex); } public Object getValueAt(int rowIndex, int columnIndex) { return getRecord(rowIndex)[columnIndex]; } public boolean isCellEditable(int rowIndex, int columnIndex) { if(columnIndex == 0) return true; else return false; } public Class getColumnClass(int columnIndex) { if (data == null || data.size() == 0) { return Object.class; } Object o = getValueAt(0, columnIndex); return o == null ? Object.class : o.getClass(); } private Object[] getRecord(int rowIndex) { return (Object[]) data.get(rowIndex); } } public void valueChanged(ListSelectionEvent e) { if (!e.getValueIsAdjusting()) { ListSelectionModel lsm = (ListSelectionModel) e.getSource(); int index = lsm.getMinSelectionIndex(); if(model.getRecord(index)[0] == Boolean.FALSE) model.setValueAt(Boolean.TRUE, index, 0); else if(model.getRecord(index)[0] == Boolean.TRUE) model.setValueAt(Boolean.FALSE, index, 0); } } } Please reply soon as it is bugging me a lot Thank you in advance :)

  Read the article

• C# SQL Parameter Errors in Loops

  - by jakesankey

  Please help me out with this. I have this small application to load txt files into a sql db and it works fine with sqlite. When I ported to SQL I started getting 'parameter already declared' errors.. If anyone can help me reorganize this code, it would be great! I need to get the parameter definitions outside of the loops or something.. using System; using System.Data; using System.Data.SQLite; using System.IO; using System.Text.RegularExpressions; using System.Threading; using System.Collections.Generic; using System.Linq; using System.Data.SqlClient; namespace JohnDeereCMMDataParser { internal class Program { public static List<string> GetImportedFileList() { List<string> ImportedFiles = new List<string>(); using (SqlConnection connect = new SqlConnection(@"Server=FRXSQLDEV;Database=RX_CMMData;Integrated Security=YES")) { connect.Open(); using (SqlCommand fmd = connect.CreateCommand()) { fmd.CommandText = @"SELECT FileName FROM Import;"; fmd.CommandType = CommandType.Text; SqlDataReader r = fmd.ExecuteReader(); while (r.Read()) { ImportedFiles.Add(Convert.ToString(r["FileName"])); } } } return ImportedFiles; } private static void Main(string[] args) { using (SqlConnection con = new SqlConnection(@"Server=FRXSQLDEV;Database=RX_CMMData;Integrated Security=YES")) { con.Open(); using (SqlCommand insertCommand = con.CreateCommand()) { Console.WriteLine("Connecting to SQL server..."); SqlCommand cmdd = con.CreateCommand(); string[] files = Directory.GetFiles(@"C:\Documents and Settings\js91162\Desktop\", "R.txt*", SearchOption.AllDirectories); insertCommand.Parameters.Add(new SqlParameter("@FeatType", DbType.String)); insertCommand.Parameters.Add(new SqlParameter("@FeatName", DbType.String)); insertCommand.Parameters.Add(new SqlParameter("@Value", DbType.String)); insertCommand.Parameters.Add(new SqlParameter("@Actual", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@Nominal", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@Dev", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@TolMin", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@TolPlus", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@OutOfTol", DbType.Decimal)); List<string> ImportedFiles = GetImportedFileList(); foreach (string file in files.Except(ImportedFiles)) { var FileNameExt1 = Path.GetFileName(file); cmdd.Parameters.Add(new SqlParameter("@FileExt", FileNameExt1)); cmdd.CommandText = @" IF (EXISTS (SELECT * FROM INFORMATION_SCHEMA.TABLES WHERE TABLE_SCHEMA = 'RX_CMMData' AND TABLE_NAME = 'Import')) BEGIN SELECT COUNT(*) FROM Import WHERE FileName = @FileExt; END"; int count = Convert.ToInt32(cmdd.ExecuteScalar()); con.Close(); con.Open(); if (count == 0) { Console.WriteLine("Parsing CMM data for SQL database... Please wait."); insertCommand.CommandText = @" INSERT INTO Import (FeatType, FeatName, Value, Actual, Nominal, Dev, TolMin, TolPlus, OutOfTol, PartNumber, CMMNumber, Date, FileName) VALUES (@FeatType, @FeatName, @Value, @Actual, @Nominal, @Dev, @TolMin, @TolPlus, @OutOfTol, @PartNumber, @CMMNumber, @Date, @FileName);"; string FileNameExt = Path.GetFullPath(file); string RNumber = Path.GetFileNameWithoutExtension(file); string RNumberE = RNumber.Split('_')[0]; string RNumberD = RNumber.Split('_')[1]; string RNumberDate = RNumber.Split('_')[2]; DateTime dateTime = DateTime.ParseExact(RNumberDate, "yyyyMMdd", Thread.CurrentThread.CurrentCulture); string cmmDate = dateTime.ToString("dd-MMM-yyyy"); string[] lines = File.ReadAllLines(file); bool parse = false; foreach (string tmpLine in lines) { string line = tmpLine.Trim(); if (!parse && line.StartsWith("Feat. Type,")) { parse = true; continue; } if (!parse || string.IsNullOrEmpty(line)) { continue; } Console.WriteLine(tmpLine); foreach (SqlParameter parameter in insertCommand.Parameters) { parameter.Value = null; } string[] values = line.Split(new[] { ',' }); for (int i = 0; i < values.Length - 1; i++) { SqlParameter param = insertCommand.Parameters[i]; if (param.DbType == DbType.Decimal) { decimal value; param.Value = decimal.TryParse(values[i], out value) ? value : 0; } else { param.Value = values[i]; } } } insertCommand.Parameters.Add(new SqlParameter("@PartNumber", RNumberE)); insertCommand.Parameters.Add(new SqlParameter("@CMMNumber", RNumberD)); insertCommand.Parameters.Add(new SqlParameter("@Date", cmmDate)); insertCommand.Parameters.Add(new SqlParameter("@FileName", FileNameExt)); // insertCommand.ExecuteNonQuery(); } } Console.WriteLine("CMM data successfully imported to SQL database..."); } con.Close(); } } } } FYI - the PartNumber, CMMNumber, Date, etc at the bottom are pulled from the file name and I need it in the table next to each respective record.

  Read the article

• asp.net mvc default model binding problem

  - by csetzkorn

  I have some problems with ASP.NET MVC’s default model binder. The View contains HTML like this: <input name="SubDTO[0].Id" value="1" type="checkbox"> <input name="SubDTO[1].Id" value="2" type="checkbox"> This is my simplified ‘model’: public class SubDTO { public virtual string Id { get; set; } } public class DTO { public List<SubDTO> SubDTOs { get; set; } public DTO() { SubDTOs = new List< SubDTO>(); } } All this works fine if the user selects at least the first checkbox (SubDTO[0].Id). The controller ‘receives’ a nicely initialised/bound DTO. However, if the first check box is not selected but only, for example, SubDTO[1].Id the object SubDTOs is null. Can someone please explain this ‘strange’ behaviour and how to overcome it? Thanks. Best wishes, Christian

  Read the article

• sharepoint online quick launch

  - by Brian

  Hello, we are converting from sharepoint 2003 to sharepoint on line. I am having trouble reproducing a specific behavior in the online version. If a choose a list, I get a "select a view" navigation on the left hand side of the page showing the available views. When a new view is created, it automatically appears on this navigation list. In the online sharepoint, instead there is a view dropdown. I know I can manually setup links on the quick launch but I'm looking for an automatic way to do this. Can the online sharepoint be set up so that when views are added they automatically appear as left-hand links? Or can the "views" dropdown be moved to the left side which would be an acceptable work around? Please note I am unfamiliar with SP designer and I do work with .NET but I dont want to go that route just for this issue - thanks.

  Read the article

• Eliminating matching values in a SQL result set

  - by Burgess Taylor

  I have a table with a list of transactions (invoices and credits) and I need to get a list of all the rows where the invoices and credits don't match up. eg user product value bill ThingA 200 jim ThingA -200 sue ThingB 100 liz ThingC 50 I only want to see the third and fourth rows, as the values of the others match off. I can do this if I select product, sum(value) ... group by product having sum(value) < 0 which works well, but I want to return the user name as well. As soon as I add the user to the select, I need to group by it as well, which messes it up as the amounts don't match up by user AND product. Any ideas ? I am using MS SQL 2000... Cheers

  Read the article

• Latex - Apply an operation to every character in a string

  - by hroest

  Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

  Read the article

• Explicitly multiplying values as longs

  - by Bill Szerdy

  I understand that all math is done as the largest data type required to handle the current values but when you transverse a loop how do you explicitly multiply longs? The following code returns 0, I suspect, because of an overflow. long result = 0L; List<Long> temp = (List<Long>) getListOfIntegers(); for (int i = 0; i < temp.size(); i++) { result *= temp.get(i).longValue(); } System.out.println(result);

  Read the article

• Pass in the object a java class is embedded in as a parameter.

  - by Leif Andersen

  I'm building an android application, which has a list view, and in the list view, a click listener, containing an onItemClick method. So I have something like this: public class myList extends ListActivity { @Override public void onCreate(Bundle savedInstanceState) { getListView().setOnItemClickListener(new OnItemClickListener() { public void onItemClick(AdapterView<?> parent, View view, int position, long id) { /* Do something*/ } } } Normally, this works fine. However, many times I find myself needing too preform an application using the outer class as a context. thusfar, I've used: parent.getContext(); to do this, but I would like to know, is that a bad idea? I can't really call: super because it's not really a subclass, just an embedded one. So is there any better way, or is that considered cosure? Also, if it is the right way, what should I do if the embedded method doesn't have a parameter to get the outside class? Thank you.

  Read the article

• PHP: Join two separate mysql queries into the same json data object

  - by Dan

  I'm trying to mesh the below mysql query results into a single json object, but not quite sure how to do it properly. //return data $sql_result = mysql_query($sql,$connection) or die ("Fail."); $arr = array(); while($obj = mysql_fetch_object($sql_result)) { $arr[] = $obj; } echo json_encode($arr); //return json //plus the selected options $sql_result2 = mysql_query($sql2,$connection) or die ("Fail."); $arr2 = array(); while($obj2 = mysql_fetch_object($sql_result2)) { $arr2[] = $obj2; } echo json_encode($arr2); //return json Here's the current result: [{"po_number":"test","start_date":"1261116000","end_date":"1262239200","description":"test","taa_required":"0","account_overdue":"1","jobs_id":null,"job_number":null,"companies_id":"4","companies_name":"Primacore Inc."}][{"types_id":"37"},{"types_id":"4"}] Notice how the last section [{"types_id":"37"},{"types_id":"4"}] is placed into a separate chunk under root. I'm wanting it to be nested inside the first branch under a name like, "types". I think my question has more to do with Php array manipulation, but I'm not the best with that. Thank you for any guidance.

  Read the article

• xml appending issue - in ie, chrome browsers

  - by 3gwebtrain

  Hi, i am using this coding for my xml information to append in to html. As well it works fine. but in the ie7,ie8 as well chrome browser it's not propelry. This code work9ing well with firefox,opera, safari.. i unable to find, what is the mistake i made this.. any one help me please? $(function(){ var thisPage; var parentPage; $('ul.left-navi li a').each(function(){ $('ul.left-navi li a').removeClass('current'); var pathname = (window.location.pathname.match(/[^\/]+$/)[0]); var currentPage = $(this).attr('href'); var pathArr = new Array(); pathArr = pathname.split("."); var file = pathArr[pathArr.length - 2]; thisPage = file; if(currentPage==pathname){ $(this).addClass("active"); } }) $.get('career-utility.xml',function(myData){ var receivedData = myData; var myXml = $(myData).find(thisPage); parentPage = thisPage; var overviewTitle = myXml.find('overview').attr('title'); var description = myXml.find('discription').text(); var mainsublinkTitle = myXml.find('mainsublink').attr('title'); var thisTitle = myXml.find("intro").attr('title'); var thisIntro = myXml.find("introinfo").text(); $('<h3>'+overviewTitle+'</h3>').appendTo('.overViewInfo'); $('<p>'+description+'</p>').appendTo('.overViewInfo'); var sublinks = myXml.find('mainsublink').children('sublink'); $('#intro h3').append(thisTitle); $('#intro').append(thisIntro); sublinks.each(function(numsub){ var newSubLink = $(this); var sublinkPage = $(this).attr('pageto'); var linkInfo = $(this).text(); $('ul.career-link').append('<li><a href="'+sublinkPage+'">'+linkInfo+'</a></li>'); }) // alert('thisTitle : '+thisTitle+'thisIntro :'+thisIntro); $(myXml).find('listgroup').each(function(index){ var count = index; var listGroup = $(this); var listGroupTitle = $(this).attr('title'); var shortNote = $(this).attr('shortnote'); var subLink = $(this).find('sublist'); var firstList = $(this).find('list'); $('.grouplist').append('<div class="list-group"><h3>'+listGroupTitle+'</h3><ul class="level-one level' + count + '"></ul></div>'); firstList.each(function(listnum) { $(this).wrapInner('<li>') .find('sublistgroup').wrapInner('<ul>').children().unwrap() .find('sublist').wrapInner('<li>').children().unwrap(); // Append content of 'list' node $('ul.level'+count).append($(this).children()); }); }); }); })

  Read the article

• Rails link from one model to another based on db field?

  - by Danny McClelland

  Hi Everyone, I have a company model and a person model with the following relationships: class Company < ActiveRecord::Base has_many :kases has_many :people def to_s; companyname; end end class Person < ActiveRecord::Base has_many :kases # foreign key in join table belongs_to :company end In the create action for the person, I have a select box with a list of the companies, which assigns a company_id to that person's record: <%= f.select :company_id, Company.all.collect {|m| [m.companyname, m.id]} %> In the show view for the person I can list the company name as follows: <%=h @person.company.companyname %> What I am trying to work out, is how do I make that a link to the company record? I have tried: <%= link_to @person.company.companyname %> but that just outputs the company name inside a href tag but links to the current page. Thanks, Danny

  Read the article

• Scalable Database Tagging Schema

  - by Longpoke

  EDIT: To people building tagging systems. Don't read this. It is not what you are looking for. I asked this when I wasn't aware that RDBMS all have their own optimization methods, just use a simple many to many scheme. I have a posting system that has millions of posts. Each post can have an infinite number of tags associated with it. Users can create tags which have notes, date created, owner, etc. A tag is almost like a post itself, because people can post notes about the tag. Each tag association has an owner and date, so we can see who added the tag and when. My question is how can I implement this? It has to be fast searching posts by tag, or tags by post. Also, users can add tags to posts by typing the name into a field, kind of like the google search bar, it has to fill in the rest of the tag name for you. I have 3 solutions at the moment, but not sure which is the best, or if there is a better way. Note that I'm not showing the layout of notes since it will be trivial once I get a proper solution for tags. Method 1. Linked list tagId in post points to a linked list in tag_assoc, the application must traverse the list until flink=0 post: id, content, ownerId, date, tagId, notesId tag_assoc: id, tagId, ownerId, flink tag: id, name, notesId Method 2. Denormalization tags is simply a VARCHAR or TEXT field containing a tab delimited array of tagId:ownerId. It cannot be a fixed size. post: id, content, ownerId, date, tags, notesId tag: id, name, notesId Method 3. Toxi (from: http://www.pui.ch/phred/archives/2005/04/tags-database-schemas.html, also same thing here: http://stackoverflow.com/questions/20856/how-do-you-recommend-implementing-tags-or-tagging) post: id, content, ownerId, date, notesId tag_assoc: ownerId, tagId, postId tag: id, name, notesId Method 3 raises the question, how fast will it be to iterate through every single row in tag_assoc? Methods 1 and 2 should be fast for returning tags by post, but for posts by tag, another lookup table must be made. The last thing I have to worry about is optimizing searching tags by name, I have not worked that out yet. I made an ASCII diagram here: http://pastebin.com/f1c4e0e53

  Read the article

• problem with jquery sortable of ul with childrens - how to allow li to be sorted only on the same le

  - by Y.G.J

  $(document).ready(function() { $("#test-list").sortable({ items: "> li", handle : '.handle', axis: 'y', opacity: 0.6, update : function () { var order = $('#test-list').sortable('serialize'); $("#info").load("process-sortable.asp?"+order+"&id=catid&order=orderid&table=tblCats"); } }); $("#test-sub").sortable({ containment: "ul", items: "li", handle : '.handle2', axis: 'y', opacity: 0.6, update : function () { var order = $('ul').sortable('serialize'); $("#info").load("process-sortable.asp?"+order+"&id=catid&order=orderid&table=tblCats"); } }); }); <ul id="test-list"> <li id="listItem_10">first<img align="middle" src="Themes/arrow.png" class="handle" /></li> <li id="listItem_8">second<img align="middle" src="Themes/arrow.png" class="handle" /> <ul id="test-sub"> <li id="listItem_4><img align="middle" src="Themes/arrow.png" class="handle2" /></li> <li id="listItem_3"><img align="middle" src="Themes/arrow.png" class="handle2" /></li> <ul id="test-sub"> <li id="listItem_9"><img align="middle" src="Themes/arrow.png" class="handle2" /></li> </ul> </li> </ul> </li> </ul> the problems i have: sorting the main ul is working but not all the time - i will try to fix that my own but if there is a problem with the code here and not the one in proccess-sortable - tell me. moving li in the main ul is ok but the sub or the sub of the sub is having problem - i can drag something from one sub to it's sub or the other way too - i don't want that to happend. i want to be able to drag li and by selecting that one that only this ul group will send to proccess-sortable to be updated - how can i catch the specific ul of li i am draging?

  Read the article

< Previous Page | 498 499 500 501 502 503 504 505 506 507 508 509  | Next Page >