Search Results

Search found 36658 results on 1467 pages for 'line length'.

Page 507/1467 | < Previous Page | 503 504 505 506 507 508 509 510 511 512 513 514  | Next Page >

  • Error with swig: undefined symbol: _ZN7hosters11hostersLink7getLinkEi

    - by Eduardo
    I'm trying to make a python binding for the this library: http://code.google.com/p/hosterslib/. I'm using swig, heres is the code: %module pyhosters %{ include "hosters/hosters.hpp" %} %include "hosters/hosters.hpp" I run "swig -c++ -python -o swig_wrap.cxx swig.i" and I compile with "g++ -O2 -fPIC -shared -o _pyhosters.so swig_wrap.cxx python-config --libs --cflags -lhosters -lcln -lhtmlcxx pkg-config libglog --libs --cflags -I/usr/include/python2.6 -Wall -Wextra" But when I run python and I import it, I get: import pyhosters Traceback (most recent call last): File "", line 1, in File "./pyhosters.py", line 7, in import _pyhosters ImportError: ./_pyhosters.so: undefined symbol: _ZN7hosters11hostersLink7getLinkEi How can I solve that? Thanks.

    Read the article

  • Cannot import SQLite with Python 2.6

    - by David McLaughlin
    I'm running Python 2.6 on Unix and when I run the interactive prompt (SQLite is supposed to be preinstalled) I get: [root@idev htdocs]# python Python 2.6 (r26:66714, Oct 23 2008, 16:25:34) [GCC 3.2.2 20030222 (Red Hat Linux 3.2.2-5)] on linux2 Type "help", "copyright", "credits" or "license" for more information. >>> import sqlite Traceback (most recent call last): File "<stdin>", line 1, in <module> ImportError: No module named sqlite >>> import sqlite Traceback (most recent call last): File "<stdin>", line 1, in <module> ImportError: No module named sqlite >>> How do I resolve this?

    Read the article

  • System.Diagnostics.Debugger.Debug() stopped working

    - by Andrew Miner
    I'm working on a program which uses the System.Diagnostics.Debugger.Break() method to allow the user to set a breakpoint from the command-line. This has worked fine for many weeks now. However, when I was working on fixing a unit test today, I tried to use the debug switch from the command-line, and it didn't work. Here's what I've tried: I've confirmed that the Debug() method is really being called (by putting a System.Console.WriteLine() after it) I've confirmed that the build is still in Debug I've done a clean build I've restarted Product Studio A quick Google search didn't reveal anything, and the API documentation for .Net doesn't mention anything about this function not performing correctly. So... any ideas?

    Read the article

  • How to extract a Sub-Matrix from a Matrix ?

    - by ZaZu
    Hello, I have a matrix in a txt file and I want to load the matrix based on my input of number of rows and columns For example, I have a 5 by 5 matrix in the file. I want to extract a 3 by 3 matrix, how can I do that ? I created a nested loop using : FILE *sample sample=fopen("randomfile.txt","r"); for(i=0;i<rows;i++){ for(j=0;j<cols;j++){ fscanf(sample,"%f",&matrix[i][j]); } fscanf(sample,"\n",&matrix[i][j]); } fclose(sample); Sadly the code does not work .. If I have this matrix : 5.00 4.00 5.00 6.00 5.00 4.00 3.00 25.00 5.00 3.00 4.00 23.00 5.00 2.00 352.00 6.00 And inputting 3 for rows and 3 for columns, I get : 5.00 4.00 5.00 6.00 5.00 4.00 3.00 25.00 5.00 Which is obviously wrong , its reading line by line rather than skipping the unmentioned column ... What am I doing wrong ? Thanks !

    Read the article

  • Require a default constructor in java?

    - by jdc0589
    Is there any way to require that a class have a default (no parameter) constructor, aside from using a reflection check like the following? (the following would work, but it's hacky and reflection is slow) boolean valid = false; for(Constructor<?> c : TParse.class.getConstructors()) { if(c.getParameterTypes().length == 0) { valid = true; break; } } if(!valid) throw new MissingDefaultConstructorException(...);

    Read the article

  • Scanner cuts off my String after about 2400 characters

    - by Ventrue
    I've got some very basic code like while (scan.hasNextLine()) { String temp = scan.nextLine(); System.out.println(temp); } where scan is a Scanner over a file. However, on one particular line, which is about 6k chars long, temp cuts out after something like 2470 characters. There's nothing special about when it cuts out; it's in the middle of the word "Australia." If I delete characters from the line, the place where it cuts out changes; e.g. if I delete characters 0-100 in the file then Scanner will get what was previously 100-2570. I've used Scanner for larger strings before. Any idea what could be going wrong?

    Read the article

  • Just a small problem regarding javscript BOM question

    - by caramel1991
    The question is this: Create a page with a number of links. Then write code that fires on the window onload event, displaying the href of each of the links on the page. And this is my solution <html> <body language="Javascript" onload="displayLink()"> <a href="http://www.google.com/">First link</a> <a href="http://www.yahoo.com/">Second link</a> <a href="http://www.msn.com/">Third link</a> <script type="text/javascript" language="Javascript"> function displayLink() { for(var i = 0;document.links[i];i++) { alert(document.links[i].href); } } </script> </body> </html> This is the answer provided by the book <html> <head> <script language=”JavaScript” type=”text/javascript”> function displayLinks() { var linksCounter; for (linksCounter = 0; linksCounter < document.links.length; linksCounter++) { alert(document.links[linksCounter].href); } } </script> </head> <body onload=”displayLinks()”> <A href=”link0.htm” >Link 0</A> <A href=”link1.htm”>Link 2</A> <A href=”link2.htm”>Link 2</A> </body> </html> Before I get into the javascript tutorial on how to check user browser version or model,I was using the same method as the example,by acessing the length property of the links array for the loop,but after I read through the tutorial,I find out that I can also use this alternative ways,by using the method that the test condition will evalute to true only if the document.links[i] return a valid value,so does my code is written using the valid method??If it's not,any comment regarding how to write a better code??Correct me if I'm wrong,I heard some of the people say "a good code is not evaluate solely on whether it works or not,but in terms of speed,the ability to comprehend the code,and could posssibly let others to understand the code easily".Is is true??

    Read the article

  • Newline not showing correctly in textbox

    - by TheGateKeeper
    I am loading a string from my database which among other things contains line breaks (\r\n). However, this isn't being rendered as a new line but instead as \r\n. If I type it directly in instead of loading it from a string, it works just fine but I need to be able to load it from a string. Any ideas? Edit: Upon closer inspection, it looks like the string is being returned as: Changed test7\\r\\nChanged test8\\r\\nChanged test9Changed test7 From the database. I tried running a .Replace(@"\\", @"\") on it but this had no effect at all. Any ideas?

    Read the article

  • Form validation with optional File Upload field callback

    - by MotiveKyle
    I have a form with some input fields and a file upload field in the same form. I am trying to include a callback into the form validation to check for file upload errors. Here is the controller for adding and the callback: public function add() { if ($this->ion_auth->logged_in()): //validate form input $this->form_validation->set_rules('title', 'title', 'trim|required|max_length[66]|min_length[2]'); // link url $this->form_validation->set_rules('link', 'link', 'trim|required|max_length[255]|min_length[2]'); // optional content $this->form_validation->set_rules('content', 'content', 'trim|min_length[2]'); $this->form_validation->set_rules('userfile', 'image', 'callback_validate_upload'); $this->form_validation->set_error_delimiters('<small class="error">', '</small>'); // if form was submitted, process form if ($this->form_validation->run()) { // add pin $pin_id = $this->pin_model->create(); $slug = strtolower(url_title($this->input->post('title'), TRUE)); // path to pin folder $file_path = './uploads/' . $pin_id . '/'; // if folder doesn't exist, create it if (!is_dir($file_path)) { mkdir($file_path); } // file upload config variables $config['upload_path'] = $file_path; $config['allowed_types'] = 'jpg|png'; $config['max_size'] = '2048'; $config['max_width'] = '1920'; $config['max_height'] = '1080'; $config['encrypt_name'] = TRUE; $this->load->library('upload', $config); // upload image file if ($this->upload->do_upload()) { $this->load->model('file_model'); $image_id = $this->file_model->insert_image_to_db($pin_id); $this->file_model->add_image_id_to_pin($pin_id, $image_id); } } // build page else: // User not logged in redirect("login", 'refresh'); endif; } The callback: function validate_upload() { if ($_FILES AND $_FILES['userfile']['name']): if ($this->upload->do_upload()): return true; else: $this->form_validation->set_message('validate_upload', $this->upload->display_errors()); return false; endif; else: return true; endif; } I am getting the error Fatal error: Call to a member function do_upload() on a non-object on line 92 when I try to run this. Line 92 is the if ($this->upload->do_upload()): line in the validate_upload callback. Am I going about this the right way? What's triggering this error?

    Read the article

  • another onmouseover problem this one concerns pictures

    - by user334118
    Hi all! have problems with mouseover in Mozilla and Chrome after making it work in IE, for sure I can tell you that my code woked perfectly in Chrome at least, cause thats my default browser and I used it for debuging when creating the javascipt and it worked nicely... until I tried to make it work in IE too. Here I post the full code of the webpage I'm having trouble with. <%@ Page Language="C#" AutoEventWireup="true" CodeBehind="WebbShop.aspx.cs" Inherits="FSwebportal.WebbShop" %> .prodShow{width: 100%; text-align:center;border:0; float:right; position:inherit; padding-left:310px;} prodFollow{display:block; width:100%; height:100%; position:fixed; overflow:hidden;} orderSett{display:block; position:relative; float:left; padding-top:inherit;} .ShowBig{width:290px;height:290px; padding-top:10px;} .pTb{width:50px;} .order{background-color:Transparent;margin:3px;} .txtArea{border:0;overflow:auto;width:200px;height:100px;} .prodRow{background-image:url("produktbakgrund.png"); background-repeat:repeat;} .row{background-color:Transparent;width:100%;margin: 0px auto;display:inline-table;} .col{background-color:Transparent;width:100%;margin:3px;} <div id="prodFollow"> <table id="dumbTable"> <tr> <td> <img id="sideImg" class="ShowBig" src="" alt=""/> </td> </tr> <tr> <td> <h3><b>Specifikationer:</b></h3> <select name=""> </select> </td> </tr> </table> </div> <table id="itemList" class="prodShow" cellspacing="0"> <thead> <tr class="prodRow"> <th>Bild</th> <th>Förklaring</th> <th>Artikelnummer</th> <th>Pris</th> </tr> </thead> </table> <script type="text/javascript"> function appendRow() { var tbl = document.getElementById('itemList'); var len = <%= aspInfo.Count %>; var arr = new Array(len); var currIndex = 0; var imgID=0; <% for (int x = 0; x < aspInfo.Count; x++) { Response.Write("arr["+x+"]= '"+ aspInfo[x]+"';"); } %> for(row =0; row < arr.length/4;row++) { var rad = tbl.insertRow(tbl.rows.length); rad.setAttribute('class','prodRow'); for (c = 0; c < tbl.rows[row].cells.length; c++) { if(c < 1) { createCell(rad.insertCell(c), arr[currIndex], 'col',imgID); imgID++; } else { if(c < 3) { createCell(rad.insertCell(c),"<Label class=txtArea>" + arr[currIndex] + "</Label>", 'row',imgID); } else { createCell(rad.insertCell(c),"<Label class=txtArea>" + arr[currIndex] + " SKR</Label><br>Antal:<input type=text class=pTb /><input type=button width=100px value='Lägg i varukorg'></input>", 'order',imgID); } } currIndex++; } } } function createCell(cell, text, style,imgID) { if (style == 'col') { var arrLen = <% = largeImg.Count %>; var imgArr = new Array(arrLen); <% for (int x = 0; x < largeImg.Count; x++) { Response.Write("imgArr["+x+"]= '"+ largeImg[x]+"';"); } %> var div = document.createElement('div'); div.setAttribute('class', style); div.setAttribute('className', style); div.innerHTML = "<a href='#'><img id='" + imgID + "' src='" + text + "' onmouseover=javascript:onImg('" + imgArr[imgID] + "') border='0' alt='Animg' /></a>"; cell.appendChild(div); } else { var div = document.createElement('div'); div.setAttribute('class', style); div.setAttribute('className', style); div.innerHTML = text; cell.appendChild(div); } } </script> <script type="text/javascript" language="javascript"> function onImg(bigImg) { var img = document.getElementById('sideImg#'); img.src = bigImg; alert(img.src.toString()); } </script> </form> hope you guys can solve it for me, going mad! best regards David

    Read the article

  • unsetting application role in classic ASP

    - by user303526
    Hi, I'm trying to unset an application role but have been failing miserably. I was able to get the cookie value after setting (sp_setapprole) the application role. But I haven't been able to use that cookie (type varbinary / byte array) in my query to unset using sp_unsetapprole. If it was any other stored procedure it wouldn't have been a problem. I was able to use Command object and create a parameter which takes data type input of adVarBinary (204) and execute the command line.. but to the Server the query goes as below. exec sp_executesql N'sp_unsetapprole @P1 ',N'@P1 varbinary(36)',0x01000000CD11697F8F0ED3627BC1DAD25FB9CEB3A2EC5B289C658235E510CD9F29230000 Since sp_setapprole and sp_unsetapprole have to be run ad hoc, the sql server is failing to run this line. And I'm finding it hard to append varbinary cookie value to a simple query such as 'sp_unsetapprole ' & varKookie so it runs "directly" on to the server. Any kind of suggestions are welcome. Thanks, Nandagopal

    Read the article

  • jQuery getting just added by ajax element

    - by Qiao
    $.post('includes/script.php', $(this).serialize(), function(data) { $('body').append(data); }); alert ($('#new').length) php script is <php echo "<div id="new">text</div>" ?> it alerts 0, so it can't see new div. How can you make it see new div?

    Read the article

  • Python string formatting too slow

    - by wich
    I use the following code to log a map, it is fast when it only contains zeroes, but as soon as there is actual data in the map it becomes unbearably slow... Is there any way to do this faster? log_file = open('testfile', 'w') for i, x in ((i, start + i * interval) for i in range(length)): log_file.write('%-5d %8.3f %13g %13g %13g %13g %13g %13g\n' % (i, x, map[0][i], map[1][i], map[2][i], map[3][i], map[4][i], map[5][i]))

    Read the article

  • How do I set up Scala plugin for NetBeans to copy the Scala runtime library?

    - by Alexey Romanov
    Versions: NetBeans 6.8, Scala Kit 0.16.1 When I compile my project, I get the following output: init: deps-jar: Compiling 2 source files to F:\MyProgramming\NorvigSpellChecker\build\classes compile: Created dir: F:\MyProgramming\NorvigSpellChecker\dist Building jar: F:\MyProgramming\NorvigSpellChecker\dist\NorvigSpellChecker.jar Not copying the libraries. To run this application from the command line without Ant, try: java -jar "F:\MyProgramming\NorvigSpellChecker\dist\NorvigSpellChecker.jar" jar: BUILD SUCCESSFUL (total time: 3 seconds) Of course, the libraries should be copied, so I can't actually run it by using this command line. I don't see any options to copy the library in the project configuration. The plugin uses Ant for building, but I don't have any experience with it; presumably it should be easy enough to tell Ant to copy the libraries. Here is build-impl.xml, what should I do in build.xml?

    Read the article

  • Python: User-Defined Exception That Proves The Rule

    - by bandana
    Python documentations states: Exceptions should typically be derived from the Exception class, either directly or indirectly. the word 'typically' leaves me in an ambiguous state. consider the code: class good(Exception): pass class bad(object): pass Heaven = good() Hell = bad() >>> raise Heaven Traceback (most recent call last): File "<pyshell#163>", line 1, in <module> raise Heaven good >>> raise Hell Traceback (most recent call last): File "<pyshell#171>", line 1, in <module> raise Hell TypeError: exceptions must be classes or instances, not bad so when reading the python docs, should i change 'typically' with ''? what if i have a class hierarchy that has nothing to do with the Exception class, and i want to 'raise' objects belonging to the hierarchy? i can always raise an exception with an argument: raise Exception, Hell This seems slightly awkward to me What's so special about the Exception class, that only its family members can be raised?

    Read the article

  • What's the difference between these two calls to a function taking a collection of structural types?

    - by James Moore
    Why does the call to fn(Iterator("foo") compile, but the call to fn(fooIterator) fail with an error "type mismatch; found : Iterator[java.lang.String] required: scala.Iterator[com.banshee.Qx.HasLength]" object Qx { type HasLength = {def length: Int} def fn(xs: Iterator[HasLength]) = 3 var tn = fn(Iterator("foo")) var fooIterator = Iterator("foo") var tnFails = fn(fooIterator) //doesn't compile } Aren't they the same thing?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • javascript problem

    - by Gourav
    I have created a dynamic table whose rows gets appended by click of the "Add" button, i want the user not to be able to submit the page if no value is entered in all the rows of the table. how do i achieve this The code is <html> <head> <script type="text/javascript"> function addRowToTable() { var tbl = document.getElementById('tblSample'); var lastRow = tbl.rows.length; var iteration = lastRow+1; var row = tbl.insertRow(lastRow); var cellLeft = row.insertCell(0); var textNode = document.createTextNode(iteration); cellLeft.appendChild(textNode); var cellRight = row.insertCell(1); var el = document.createElement('input'); el.type = 'text'; el.name = 'txtRow' + iteration; el.id = 'txtRow' + iteration; el.size = 40; cellRight.appendChild(el); } function validation() { var a=document.getElementById('tblSample').rows.length; for(i=0;i<a;i++) { alert(document.getElementById('tblSample').txtRow[i].value);//this doesnt work } return true; } </script> <meta http-equiv="Content-Type" content="text/html; charset=ISO-8859-1"> <title>Insert title here</title> </head> <body> <form name ='qqq' action="sample.html"> <p> <input type="button" value="Add" onclick="addRowToTable();" /> <input type="button" value="Submit" onclick="return validation();" /> </p> <p> <table border="1" id="tblSample"> <tr> <td>1</td> <td>The 1st row</td> </tr> </table> </p> </form> </body> </html> Please suggest

    Read the article

  • Which network protocol to use for lightweight notification of remote apps?

    - by Chris Thornton
    I have this situation.... Client-initiated SOAP 1.1 communication between one server and let's say, tens of thousands of clients. Clients are external, coming in through our firewall, authenticated by certificate, https, etc.. They can be anywhere, and usually have their own firewalls, NAT routers, etc... They're truely external, not just remote corporate offices. They could be in a corporate/campus network, DSL/Cable, even Dialup. Client uses Delphi (2005 + SOAP fixes from 2007), and the server is C#, but from an architecture/design standpoint, that shouldn't matter. Currently, clients push new data to the server and pull new data from the server on 15-minute polling loop. The server currently does not push data - the client hits the "messagecount" method, to see if there is new data to pull. If 0, it sleeps for another 15 min and checks again. We're trying to get that down to 7 seconds. If this were an internal app, with one or just a few dozen clients, we'd write a cilent "listener" soap service, and would push data to it. But since they're external, sit behind their own firewalls, and sometimes private networks behind NAT routers, this is not practical. So we're left with polling on a much quicker loop. 10K clients, each checking their messagecount every 10 seconds, is going to be 1000/sec messages that will mostly just waste bandwidth, server, firewall, and authenticator resources. So I'm trying to design something better than what would amount to a self-inflicted DoS attack. I don't think it's practical to have the server send soap messages to the client (push) as this would require too much configuration at the client end. But I think there are alternatives that I don't know about. Such as: 1) Is there a way for the client to make a request for GetMessageCount() via Soap 1.1, and get the response, and then perhaps, "stay on the line" for perhaps 5-10 minutes to get additional responses in case new data arrives? i.e the server says "0", then a minute later in response to some SQL trigger (the server is C# on Sql Server, btw), knows that this client is still "on the line" and sends the updated message count of "5"? 2) Is there some other protocol that we could use to "ping" the client, using information gathered from their last GetMessageCount() request? 3) I don't even know. I guess I'm looking for some magic protocol where the client can send a GetMessageCount() request, which would include info for "oh by the way, in case the answer changes in the next hour, ping me at this address...". Also, I'm assuming that any of these "keep the line open" schemes would seriously impact the server sizing, as it would need to keep many thousands of connections open, simultaneously. That would likely impact the firewalls too, I think. Is there anything out there like that? Or am I pretty much stuck with polling? TIA, Chris

    Read the article

  • Can I disable FF3 back button cache?

    - by Sergej Andrejev
    I found out that when pressing back button it gets previous page from browser cache even if I send following headers: Test1.aspx Server ASP.NET Development Server/9.0.0.0 Date Wed, 24 Mar 2010 17:49:40 GMT X-AspNet-Version 2.0.50727 Location Test2.aspx Cache-Control no-cache, no-store Pragma no-cache Expires -1 Content-Type text/html; charset=utf-8 Content-Length 189 Connection Close

    Read the article

  • On Click alert if $.get returns a value, if not, submit the form

    - by bradenkeith
    If the submit button is clicked, prevent the default action and see if the field 'account_name' is already in use. If the $.get() returns a result, alert the user of the results. If it doesn't, submit form with id="add_account_form". My problem is that my else{} statement is not submitting the form. I get no response when submit is clicked & there is no value returned. Also I would like to change my code where it goes $("#add_account_form").submit(..) instead of .click() however, would that cause a problem when trying to submit the form later in the script? <script type="text/javascript"> $(document).ready( function () { $("#submit").click( function () { var account_name = $("input[name=account_name]").val(); $.get( "'.url::site("ajax/check_account_name").'", {account_name: account_name}, function(data){ if(data.length > 0){ confirm( "The account name you entered looks like the following:\n" +data+ "Press cancel if this account already exists or ok to create it." ); }else{ $("#add_account_form").submit(); } }); return false; }); }); </script> <p> <input type="submit" id="submit" class="submit small" name="submit" value="Submit" /> </p> </form> Thanks for your help. EDIT So anyone who runs into my problems, it's that $.get() is asynchronous, so it will always return false, or true depending on what submitForm is defined as. $.ajax() however, allows async to be set as false, which allows the function to finish before moving on. See what I mean: $(document).ready( function () { $("#add_account_form").submit( function () { var submitForm = true; var account_name = $("input[name=account_name]").val(); $.ajax({ type: "GET", async: false, url: "'.url::site("ajax/check_account_name").'", data: ({account_name: account_name}), success: function(data){ if(data.length > 0){ if(!confirm( "The account name you entered looks like the following:\n" +data+ "Press cancel if this account already exists or ok to create it." )){ submitForm = false; } } } }); if (submitForm == false ) { return false; } }); }); Thanks for your help @Dan

    Read the article

  • Access violation using LocalAlloc()

    - by PaulH
    I have a Visual Studio 2008 Windows Mobile 6 C++ application that is using an API that requires the use of LocalAlloc(). To make my life easier, I created an implementation of a standard allocator that uses LocalAlloc() internally: /// Standard library allocator implementation using LocalAlloc and LocalReAlloc /// to create a dynamically-sized array. /// Memory allocated by this allocator is never deallocated. That is up to the /// user. template< class T, int max_allocations > class LocalAllocator { public: typedef T value_type; typedef size_t size_type; typedef ptrdiff_t difference_type; typedef T* pointer; typedef const T* const_pointer; typedef T& reference; typedef const T& const_reference; pointer address( reference r ) const { return &r; }; const_pointer address( const_reference r ) const { return &r; }; LocalAllocator() throw() : c_( NULL ) { }; /// Attempt to allocate a block of storage with enough space for n elements /// of type T. n>=1 && n<=max_allocations. /// If memory cannot be allocated, a std::bad_alloc() exception is thrown. pointer allocate( size_type n, const void* /*hint*/ = 0 ) { if( NULL == c_ ) { c_ = LocalAlloc( LPTR, sizeof( T ) * n ); } else { HLOCAL c = LocalReAlloc( c_, sizeof( T ) * n, LHND ); if( NULL == c ) LocalFree( c_ ); c_ = c; } if( NULL == c_ ) throw std::bad_alloc(); return reinterpret_cast< T* >( c_ ); }; /// Normally, this would release a block of previously allocated storage. /// Since that's not what we want, this function does nothing. void deallocate( pointer /*p*/, size_type /*n*/ ) { // no deallocation is performed. that is up to the user. }; /// maximum number of elements that can be allocated size_type max_size() const throw() { return max_allocations; }; private: /// current allocation point HLOCAL c_; }; // class LocalAllocator My application is using that allocator implementation in a std::vector< #define MAX_DIRECTORY_LISTING 512 std::vector< WIN32_FIND_DATA, LocalAllocator< WIN32_FIND_DATA, MAX_DIRECTORY_LISTING > > file_list; WIN32_FIND_DATA find_data = { 0 }; HANDLE find_file = ::FindFirstFile( folder.c_str(), &find_data ); if( NULL != find_file ) { do { // access violation here on the 257th item. file_list.push_back( find_data ); } while ( ::FindNextFile( find_file, &find_data ) ); ::FindClose( find_file ); } // data submitted to the API that requires LocalAlloc()'d array of WIN32_FIND_DATA structures SubmitData( &file_list.front() ); On the 257th item added to the vector<, the application crashes with an access violation: Data Abort: Thread=8e1b0400 Proc=8031c1b0 'rapiclnt' AKY=00008001 PC=03f9e3c8(coredll.dll+0x000543c8) RA=03f9ff04(coredll.dll+0x00055f04) BVA=21ae0020 FSR=00000007 First-chance exception at 0x03f9e3c8 in rapiclnt.exe: 0xC0000005: Access violation reading location 0x01ae0020. LocalAllocator::allocate is called with an n=512 and LocalReAlloc() succeeds. The actual Access Violation exception occurs within the std::vector< code after the LocalAllocator::allocate call: 0x03f9e3c8 0x03f9ff04 > MyLib.dll!stlp_std::priv::__copy_trivial(const void* __first = 0x01ae0020, const void* __last = 0x01b03020, void* __result = 0x01b10020) Line: 224, Byte Offsets: 0x3c C++ MyLib.dll!stlp_std::vector<_WIN32_FIND_DATAW,LocalAllocator<_WIN32_FIND_DATAW,512> >::_M_insert_overflow(_WIN32_FIND_DATAW* __pos = 0x01b03020, _WIN32_FIND_DATAW& __x = {...}, stlp_std::__true_type& __formal = {...}, unsigned int __fill_len = 1, bool __atend = true) Line: 112, Byte Offsets: 0x5c C++ MyLib.dll!stlp_std::vector<_WIN32_FIND_DATAW,LocalAllocator<_WIN32_FIND_DATAW,512> >::push_back(_WIN32_FIND_DATAW& __x = {...}) Line: 388, Byte Offsets: 0xa0 C++ MyLib.dll!Foo(unsigned long int cbInput = 16, unsigned char* pInput = 0x01a45620, unsigned long int* pcbOutput = 0x1dabfbbc, unsigned char** ppOutput = 0x1dabfbc0, IRAPIStream* __formal = 0x00000000) Line: 66, Byte Offsets: 0x1e4 C++ If anybody can point out what I may be doing wrong, I would appreciate it. Thanks, PaulH

    Read the article

  • A smart UDP protocol analyzer?

    - by ripper234
    Is there a "smart" UDP protocol analyzer that can help me reverse engineer a message based protocol? I'm using Wireshark to do the sniffing, but if there's a tool that can detect regularities in the protocol (repeated strings, bits of the protocol that are CRC/Checksum or length, ...) and aid the process that would help.

    Read the article

  • Experience using IRC to coordinate software development?

    - by momeara
    I am part of a growing software project with at least 200 active developer in 10 locations. I would like to set up an on-line chat forum for developers because I think it would help to coordinate efforts. We have an email mailing list but I feel like some questions or announcements are too informal to send to everyone while mentioning it in a chat forum might be a useful community resource. I have never participated in a software project that used an on-line chat forum so I would like to hear about peoples experiences. I am particularly interested in technical issues: Use of IRC vs. alternative platforms; how to manage access, eg. for developers only, allowing users to participate; the value of requiring certain announcements to be made on the chat forum eg who is resolving broken builds etc. If I pitch the idea to the community I would like to have some good arguments why it would be a good idea and some prospective of its usefulness in other software projects.

    Read the article

< Previous Page | 503 504 505 506 507 508 509 510 511 512 513 514  | Next Page >