Search Results

Search found 10984 results on 440 pages for 'pre loading'.

Page 51/440 | < Previous Page | 47 48 49 50 51 52 53 54 55 56 57 58  | Next Page >

• loading xml into SQL Server 2008 using sqlbulkload component

  - by mohamed

  "Error: Schema: relationship expected on 'headerRecord'." I get the above error while load xml file to SQL Server 2008 using SQLXMLBulkLoad4 Component , the xml file contains Call Detail records, I have generated schema file from xml file using both , Dataset and XSD.exe tool, but the error remains same., if there is another way to imports xml file with multiple tables that have relationship in each file into SQL Server 2008? . Here the xml file: <CallEventDataFile> <headerRecord> <productionDateTime>0912021247482B0300</productionDateTime> <recordingEntity>00</recordingEntity> <extensions/> </headerRecord> <callEventRecords> <mtSMSRecord> <recordType>7</recordType> <serviceCentre>91521230</serviceCentre> <servedIMSI>36570000031728F2</servedIMSI> <servedIMEI>53886000707896F0</servedIMEI> <servedMSISDN>915212454503F2</servedMSISDN> <msClassmark>3319A1</msClassmark> <recordingEntity>915212110100</recordingEntity> <location> <locationAreaCode>0006</locationAreaCode> <cellIdentifier>0C6E</cellIdentifier> </location> <deliveryTime>0912021535412B0300</deliveryTime> <systemType> <gERAN/> </systemType> <basicService> <teleservice>21</teleservice> </basicService> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <chargedParty> <calledParty/> </chargedParty> <orgRNCorBSCId>8E1A</orgRNCorBSCId> <orgMSCId>921A</orgMSCId> <globalAreaID>36F70500060C6E</globalAreaID> <subscriberCategory>0A</subscriberCategory> <firstmccmnc>36F705</firstmccmnc> <smsUserDataType>FF</smsUserDataType> <origination>8191F2</origination> <callReference>1605EB2FE1</callReference> </mtSMSRecord> <moSMSRecord> <recordType>6</recordType> <servedIMSI>36570000238707F9</servedIMSI> <servedIMEI>53928320195925F0</servedIMEI> <servedMSISDN>915212159430F2</servedMSISDN> <msClassmark>3319A2</msClassmark> <serviceCentre>91521230</serviceCentre> <recordingEntity>915212110100</recordingEntity> <location> <locationAreaCode>001B</locationAreaCode> <cellIdentifier>6983</cellIdentifier> </location> <messageReference>01</messageReference> <originationTime>0912021535412B0300</originationTime> <destinationNumber>8111F1</destinationNumber> <systemType> <gERAN/> </systemType> <basicService> <teleservice>22</teleservice> </basicService> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <chargedParty> <callingParty/> </chargedParty> <orgRNCorBSCId>8F1A</orgRNCorBSCId> <orgMSCId>921A</orgMSCId> <globalAreaID>36F705001B6983</globalAreaID> <subscriberCategory>0A</subscriberCategory> <firstmccmnc>36F705</firstmccmnc> <smsUserDataType>FF</smsUserDataType> <callReference>1701BED4FF</callReference> </moSMSRecord> <ssActionRecord> <recordType>10</recordType> <servedIMSI>36570000636448F8</servedIMSI> <servedIMEI>53246030714961F0</servedIMEI> <servedMSISDN>915212056928F8</servedMSISDN> <msClassmark>3018A1</msClassmark> <recordingEntity>915212110100</recordingEntity> <location> <locationAreaCode>000C</locationAreaCode> <cellIdentifier>05A5</cellIdentifier> </location> <supplService>FF</supplService> <ssAction> <ussdInvocation/> </ssAction> <ssActionTime>0912021535412B0300</ssActionTime> <ssParameters> <unstructuredData>AA5C2E3702</unstructuredData> </ssParameters> <callReference>1701BED500</callReference> <systemType> <gERAN/> </systemType> <ussdCodingScheme>0F</ussdCodingScheme> <ussdString> <UssdString>AA5C2E3702</UssdString> </ussdString> <ussdRequestCounter>1</ussdRequestCounter> <additionalChgInfo> <chargeIndicator>1</chargeIndicator> </additionalChgInfo> <orgRNCorBSCId>8E1A</orgRNCorBSCId> <orgMSCId>921A</orgMSCId> <globalAreaID>36F705000C05A5</globalAreaID> <subscriberCategory>0A</subscriberCategory> <firstmccmnc>36F705</firstmccmnc> </ssActionRecord> <moCallRecord> <recordType>0</recordType> <servedIMSI>36570000807501F5</servedIMSI> <servedIMEI>53246030713955F0</servedIMEI> <servedMSISDN>915212157901F0</servedMSISDN> <callingNumber>A151911700</callingNumber> <calledNumber>8151677589</calledNumber> <roamingNumber>A111113850</roamingNumber> <recordingEntity>915212110100</recordingEntity> <mscIncomingROUTE> <rOUTEName>HWBSC2</rOUTEName> </mscIncomingROUTE> <mscOutgoingROUTE> <rOUTEName>HWBSC2</rOUTEName> </mscOutgoingROUTE> <location> <locationAreaCode>0006</locationAreaCode> <cellIdentifier>0C2F</cellIdentifier> </location> <basicService> <teleservice>11</teleservice> </basicService> <msClassmark>3319A1</msClassmark> <answerTime>0912021535382B0300</answerTime> <releaseTime>0912021535422B0300</releaseTime> <callDuration>4</callDuration> <radioChanRequested> <dualFullRatePreferred/> </radioChanRequested> <radioChanUsed> <halfRate/> </radioChanUsed> <causeForTerm>0</causeForTerm> <diagnostics> <gsm0408Cause>144</gsm0408Cause> </diagnostics> <callReference>1701BED501</callReference> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <gsm-SCFAddress>915212110130</gsm-SCFAddress> <serviceKey>1</serviceKey> <networkCallReference>171D555132</networkCallReference> <mSCAddress>915212110100</mSCAddress> <speechVersionSupported>25</speechVersionSupported> <speechVersionUsed>21</speechVersionUsed> <numberOfDPEncountered>3</numberOfDPEncountered> <levelOfCAMELService>01</levelOfCAMELService> <freeFormatData>800130</freeFormatData> <systemType> <gERAN/> </systemType> <classmark3>C000</classmark3> <chargedParty> <callingParty/> </chargedParty> <mscOutgoingCircuit>1051</mscOutgoingCircuit> <orgRNCorBSCId>8E1A</orgRNCorBSCId> <orgMSCId>921A</orgMSCId> <calledIMSI>36570000635618F8</calledIMSI> <globalAreaID>36F70500060C2F</globalAreaID> <subscriberCategory>0A</subscriberCategory> <firstmccmnc>36F705</firstmccmnc> <lastmccmnc>36F705</lastmccmnc> </moCallRecord> <mtCallRecord> <recordType>1</recordType> <servedIMSI>36570000635618F8</servedIMSI> <servedIMEI>53464010474309F0</servedIMEI> <servedMSISDN>915212755697F8</servedMSISDN> <callingNumber>A151911700</callingNumber> <recordingEntity>915212110100</recordingEntity> <mscIncomingROUTE> <rOUTEName>HWBSC2</rOUTEName> </mscIncomingROUTE> <mscOutgoingROUTE> <rOUTEName>HWBSC2</rOUTEName> </mscOutgoingROUTE> <location> <locationAreaCode>0006</locationAreaCode> <cellIdentifier>0C2D</cellIdentifier> </location> <basicService> <teleservice>11</teleservice> </basicService> <supplServicesUsed> <SuppServiceUsedid> <ssCode>11</ssCode> <ssTime>0912021535382B0300</ssTime> </SuppServiceUsedid> </supplServicesUsed> <msClassmark>331981</msClassmark> <answerTime>0912021535382B0300</answerTime> <releaseTime>0912021535422B0300</releaseTime> <callDuration>4</callDuration> <radioChanRequested> <dualFullRatePreferred/> </radioChanRequested> <radioChanUsed> <halfRate/> </radioChanUsed> <causeForTerm>0</causeForTerm> <diagnostics> <gsm0408Cause>144</gsm0408Cause> </diagnostics> <callReference>1701BED502</callReference> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <networkCallReference>171D555132</networkCallReference> <mSCAddress>915212110100</mSCAddress> <speechVersionSupported>25</speechVersionSupported> <speechVersionUsed>21</speechVersionUsed> <systemType> <gERAN/> </systemType> <classmark3>C000</classmark3> <chargedParty> <calledParty/> </chargedParty> <roamingNumber>A111113850</roamingNumber> <mscIncomingCircuit>9119</mscIncomingCircuit> <orgRNCorBSCId>8E1A</orgRNCorBSCId> <orgMSCId>921A</orgMSCId> <globalAreaID>36F70500060C2D</globalAreaID> <subscriberCategory>0A</subscriberCategory> <firstmccmnc>36F705</firstmccmnc> <lastmccmnc>36F705</lastmccmnc> </mtCallRecord> <incGatewayRecord> <recordType>3</recordType> <callingNumber>A17005991565</callingNumber> <calledNumber>A1853643F7</calledNumber> <recordingEntity>915212110100</recordingEntity> <mscIncomingROUTE> <rOUTEName>ZPSTN</rOUTEName> </mscIncomingROUTE> <mscOutgoingROUTE> <rOUTEName>ZTEBSC3</rOUTEName> </mscOutgoingROUTE> <answerTime>0912021535302B0300</answerTime> <releaseTime>0912021535422B0300</releaseTime> <callDuration>12</callDuration> <causeForTerm>0</causeForTerm> <diagnostics> <gsm0408Cause>144</gsm0408Cause> </diagnostics> <callReference>2203AFBF84</callReference> <basicService> <teleservice>11</teleservice> </basicService> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <roamingNumber>A111111980</roamingNumber> <mscIncomingCircuit>934</mscIncomingCircuit> <orgMSCId>921A</orgMSCId> <mscIncomingRouteAttribute> <isup/> </mscIncomingRouteAttribute> <networkCallReference>22432B5132</networkCallReference> </incGatewayRecord> <outGatewayRecord> <recordType>4</recordType> <callingNumber>A151012431</callingNumber> <calledNumber>817026936873</calledNumber> <recordingEntity>915212110100</recordingEntity> <mscIncomingROUTE> <rOUTEName>HWBSC</rOUTEName> </mscIncomingROUTE> <mscOutgoingROUTE> <rOUTEName>ZPSTN</rOUTEName> </mscOutgoingROUTE> <answerTime>0912021535192B0300</answerTime> <releaseTime>0912021535432B0300</releaseTime> <callDuration>24</callDuration> <causeForTerm>0</causeForTerm> <diagnostics> <gsm0408Cause>144</gsm0408Cause> </diagnostics> <callReference>2303B19880</callReference> <basicService> <teleservice>11</teleservice> </basicService> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <mscOutgoingCircuit>398</mscOutgoingCircuit> <orgMSCId>921A</orgMSCId> <mscOutgoingRouteAttribute> <isup/> </mscOutgoingRouteAttribute> <networkCallReference>238BE55132</networkCallReference> </outGatewayRecord> </callEventRecords> <trailerRecord> <productionDateTime>0912021247512B0300</productionDateTime> <recordingEntity>00</recordingEntity> <firstCallDateTime>000000000000000000</firstCallDateTime> <lastCallDateTime>000000000000000000</lastCallDateTime> <noOfRecords>521</noOfRecords> <extensions/> </trailerRecord> <extensions/> </CallEventDataFile> Schema File generated by Dataset: <?xml version="1.0" standalone="yes"?> <xs:schema id="NewDataSet" xmlns="" xmlns:xs="http://www.w3.org/2001/XMLSchema" xmlns:msdata="urn:schemas-microsoft-com:xml-msdata"> <xs:element name="location"> <xs:complexType> <xs:sequence> <xs:element name="locationAreaCode" type="xs:string" minOccurs="0" /> <xs:element name="cellIdentifier" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="systemType"> <xs:complexType> <xs:sequence> <xs:element name="gERAN" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="basicService"> <xs:complexType> <xs:sequence> <xs:element name="teleservice" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="additionalChgInfo"> <xs:complexType> <xs:sequence> <xs:element name="chargeIndicator" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="chargedParty"> <xs:complexType> <xs:sequence> <xs:element name="calledParty" type="xs:string" minOccurs="0" /> <xs:element name="callingParty" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="mscIncomingROUTE"> <xs:complexType> <xs:sequence> <xs:element name="rOUTEName" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="mscOutgoingROUTE"> <xs:complexType> <xs:sequence> <xs:element name="rOUTEName" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="radioChanRequested"> <xs:complexType> <xs:sequence> <xs:element name="dualFullRatePreferred" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="radioChanUsed"> <xs:complexType> <xs:sequence> <xs:element name="halfRate" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="diagnostics"> <xs:complexType> <xs:sequence> <xs:element name="gsm0408Cause" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="CallEventDataFile"> <xs:complexType> <xs:sequence> <xs:element name="extensions" type="xs:string" minOccurs="0" /> <xs:element name="headerRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="productionDateTime" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="extensions" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="callEventRecords" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="mtSMSRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="recordType" type="xs:string" minOccurs="0" /> <xs:element name="serviceCentre" type="xs:string" minOccurs="0" /> <xs:element name="servedIMSI" type="xs:string" minOccurs="0" /> <xs:element name="servedIMEI" type="xs:string" minOccurs="0" /> <xs:element name="servedMSISDN" type="xs:string" minOccurs="0" /> <xs:element name="msClassmark" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="deliveryTime" type="xs:string" minOccurs="0" /> <xs:element name="orgRNCorBSCId" type="xs:string" minOccurs="0" /> <xs:element name="orgMSCId" type="xs:string" minOccurs="0" /> <xs:element name="globalAreaID" type="xs:string" minOccurs="0" /> <xs:element name="subscriberCategory" type="xs:string" minOccurs="0" /> <xs:element name="firstmccmnc" type="xs:string" minOccurs="0" /> <xs:element name="smsUserDataType" type="xs:string" minOccurs="0" /> <xs:element name="origination" type="xs:string" minOccurs="0" /> <xs:element name="callReference" type="xs:string" minOccurs="0" /> <xs:element ref="location" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="systemType" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="basicService" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="additionalChgInfo" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="chargedParty" minOccurs="0" maxOccurs="unbounded" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="moSMSRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="recordType" type="xs:string" minOccurs="0" /> <xs:element name="servedIMSI" type="xs:string" minOccurs="0" /> <xs:element name="servedIMEI" type="xs:string" minOccurs="0" /> <xs:element name="servedMSISDN" type="xs:string" minOccurs="0" /> <xs:element name="msClassmark" type="xs:string" minOccurs="0" /> <xs:element name="serviceCentre" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="messageReference" type="xs:string" minOccurs="0" /> <xs:element name="originationTime" type="xs:string" minOccurs="0" /> <xs:element name="destinationNumber" type="xs:string" minOccurs="0" /> <xs:element name="orgRNCorBSCId" type="xs:string" minOccurs="0" /> <xs:element name="orgMSCId" type="xs:string" minOccurs="0" /> <xs:element name="globalAreaID" type="xs:string" minOccurs="0" /> <xs:element name="subscriberCategory" type="xs:string" minOccurs="0" /> <xs:element name="firstmccmnc" type="xs:string" minOccurs="0" /> <xs:element name="smsUserDataType" type="xs:string" minOccurs="0" /> <xs:element name="callReference" type="xs:string" minOccurs="0" /> <xs:element ref="location" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="systemType" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="basicService" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="additionalChgInfo" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="chargedParty" minOccurs="0" maxOccurs="unbounded" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="ssActionRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="recordType" type="xs:string" minOccurs="0" /> <xs:element name="servedIMSI" type="xs:string" minOccurs="0" /> <xs:element name="servedIMEI" type="xs:string" minOccurs="0" /> <xs:element name="servedMSISDN" type="xs:string" minOccurs="0" /> <xs:element name="msClassmark" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="supplService" type="xs:string" minOccurs="0" /> <xs:element name="ssActionTime" type="xs:string" minOccurs="0" /> <xs:element name="callReference" type="xs:string" minOccurs="0" /> <xs:element name="ussdCodingScheme" type="xs:string" minOccurs="0" /> <xs:element name="ussdRequestCounter" type="xs:string" minOccurs="0" /> <xs:element name="orgRNCorBSCId" type="xs:string" minOccurs="0" /> <xs:element name="orgMSCId" type="xs:string" minOccurs="0" /> <xs:element name="globalAreaID" type="xs:string" minOccurs="0" /> <xs:element name="subscriberCategory" type="xs:string" minOccurs="0" /> <xs:element name="firstmccmnc" type="xs:string" minOccurs="0" /> <xs:element ref="location" minOccurs="0" maxOccurs="unbounded" /> <xs:element name="ssAction" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="ussdInvocation" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="ssParameters" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="unstructuredData" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element ref="systemType" minOccurs="0" maxOccurs="unbounded" /> <xs:element name="ussdString" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="UssdString" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element ref="additionalChgInfo" minOccurs="0" maxOccurs="unbounded" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="moCallRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="recordType" type="xs:string" minOccurs="0" /> <xs:element name="servedIMSI" type="xs:string" minOccurs="0" /> <xs:element name="servedIMEI" type="xs:string" minOccurs="0" /> <xs:element name="servedMSISDN" type="xs:string" minOccurs="0" /> <xs:element name="callingNumber" type="xs:string" minOccurs="0" /> <xs:element name="calledNumber" type="xs:string" minOccurs="0" /> <xs:element name="roamingNumber" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="msClassmark" type="xs:string" minOccurs="0" /> <xs:element name="answerTime" type="xs:string" minOccurs="0" /> <xs:element name="releaseTime" type="xs:string" minOccurs="0" /> <xs:element name="callDuration" type="xs:string" minOccurs="0" /> <xs:element name="causeForTerm" type="xs:string" minOccurs="0" /> <xs:element name="callReference" type="xs:string" minOccurs="0" /> <xs:element name="gsm-SCFAddress" type="xs:string" minOccurs="0" /> <xs:element name="serviceKey" type="xs:string" minOccurs="0" /> <xs:element name="networkCallReference" type="xs:string" minOccurs="0" /> <xs:element name="mSCAddress" type="xs:string" minOccurs="0" /> <xs:element name="speechVersionSupported" type="xs:string" minOccurs="0" /> <xs:element name="speechVersionUsed" type="xs:string" minOccurs="0" /> <xs:element name="numberOfDPEncountered" type="xs:string" minOccurs="0" /> <xs:element name="levelOfCAMELService" type="xs:string" minOccurs="0" /> <xs:element name="freeFormatData" type="xs:string" minOccurs="0" /> <xs:element name="classmark3" type="xs:string" minOccurs="0" /> <xs:element name="mscOutgoingCircuit" type="xs:string" minOccurs="0" /> <xs:element name="orgRNCorBSCId" type="xs:string" minOccurs="0" /> <xs:element name="orgMSCId" type="xs:string" minOccurs="0" /> <xs:element name="calledIMSI" type="xs:string" minOccurs="0" /> <xs:element name="globalAreaID" type="xs:string" minOccurs="0" /> <xs:element name="subscriberCategory" type="xs:string" minOccurs="0" /> <xs:element name="firstmccmnc" type="xs:string" minOccurs="0" /> <xs:element name="lastmccmnc" type="xs:string" minOccurs="0" /> <xs:element ref="mscIncomingROUTE" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="mscOutgoingROUTE" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="location" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="basicService" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="radioChanRequested" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="radioChanUsed" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="diagnostics" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="additionalChgInfo" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="systemType" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="chargedParty" minOccurs="0" maxOccurs="unbounded" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="mtCallRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="recordType" type="xs:string" minOccurs="0" /> <xs:element name="servedIMSI" type="xs:string" minOccurs="0" /> <xs:element name="servedIMEI" type="xs:string" minOccurs="0" /> <xs:element name="servedMSISDN" type="xs:string" minOccurs="0" /> <xs:element name="callingNumber" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="msClassmark" type="xs:string" minOccurs="0" /> <xs:element name="answerTime" type="xs:string" minOccurs="0" /> <xs:element name="releaseTime" type="xs:string" minOccurs="0" /> <xs:element name="callDuration" type="xs:string" minOccurs="0" /> <xs:element name="causeForTerm" type="xs:string" minOccurs="0" /> <xs:element name="callReference" type="xs:string" minOccurs="0" /> <xs:element name="networkCallReference" type="xs:string" minOccurs="0" /> <xs:element name="mSCAddress" type="xs:string" minOccurs="0" /> <xs:element name="speechVersionSupported" type="xs:string" minOccurs="0" /> <xs:element name="speechVersionUsed" type="xs:string" minOccurs="0" /> <xs:element name="classmark3" type="xs:string" minOccurs="0" /> <xs:element name="roamingNumber" type="xs:string" minOccurs="0" /> <xs:element name="mscIncomingCircuit" type="xs:string" minOccurs="0" /> <xs:element name="orgRNCorBSCId" type="xs:string" minOccurs="0" /> <xs:element name="orgMSCId" type="xs:string" minOccurs="0" /> <xs:element name="globalAreaID" type="xs:string" minOccurs="0" /> <xs:element name="subscriberCategory" type="xs:string" minOccurs="0" /> <xs:element name="firstmccmnc" type="xs:string" minOccurs="0" /> <xs:element name="lastmccmnc" type="xs:string" minOccurs="0" /> <xs:element ref="mscIncomingROUTE" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="mscOutgoingROUTE" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="location" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="basicService" minOccurs="0" maxOccurs="unbounded" /> <xs:element name="supplServicesUsed" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="SuppServiceUsedid" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="ssCode" type="xs:string" minOccurs="0" /> <xs:element name="ssTime" type="xs:string" minOccurs="0" /> </xs:sequence>

  Read the article

• Objective-C memory leak in loading remote content

  - by Ican Zilb

  I try to load a plist file from my server. I can think of 2 ways to do that, but for both Instruments says there's huge memory leak : NSData* plistData = [NSData dataWithContentsOfURL:url]; and NSDictionary* updateDigest = [NSDictionary dictionaryWithContentsOfURL: [NSURL URLWithString:updateURL] ]; The backtrace of the memory leak leads to __CFURLCache in CFNetwork and I am wondering if something can be done to fix the leak? Any other way to load a remote plist xml, without the memory leakage ? Thanks

  Read the article

• loading data from file into 2d array

  - by Chris

  I am just starting with perl and would like some help with arrays please. I am reading lines from a data file and splitting the line into fields: open (INFILE, $infile); do { my $linedata = <INFILE>; my @data= split ',',$linedata; .... } until eof; I then want to store the individual field values (in @data) in and array so that the array looks like the input data file ie, the first "row" of the array contains the first line of data from INFILE etc. Each line of data from the infile contains 4 values, x,y,z and w and once the data are all in the array, I have to pass the array into another program which reads the x,y,z,w and displays the w value on a screen at the point determined by the x,y,z value. I can not pas the data to the other program on a row-by-row basis as the program expects the data to in a 2d matrtix format. Any help greatly appreciated. Chris

  Read the article

• How do you access the commit message in a Mercurial in-process hook?

  - by davidavr

  I've been trying def debug_hook(ui, repo, **kwargs): changectx = repo[None] ui.status('change.desc: %s\n' % changectx.description()) return True But it always prints an empty string. Is this because it is a precommit hook and the message isn't available yet? Or am I just missing something obvious?

  Read the article

• Apache not loading Xdebug, but does when started from the Command Line

  - by JamesD

  I know that this sounds odd, but believe me, it's what is happening. Here are my system settings: Windows7 Apache 2.2 PHP 5.2.12 Xdebug 2.0.5 I have XDebug configured in my PHP.ini file. When I run php -m, I do in fact see that Xdebug is loaded. Now, if I start Apache AS A SERVICE (or by the Apache Monitor), and run phpinfo(), it is NOT showing Xdebug as being loaded. However, (now here's the crazy part), if I go to my Apache bin directory, and simply run httpd.exe, and then go and look at phpinfo(), Xdebug now shows as being loaded! Also, comparing some phpinfo() when started via service or by command line, it looks like the php.ini file is the same for either case. Everything looks the same except for the Xdebug being loaded part. Please, if you have any ideas it would be greatly appreciated.

  Read the article

• How to do loading dialogs in Android?

  - by Eno

  Those dark spinning progress dialogs in the Amazon and Engadget apps - are those standard in Android?

  Read the article

• Menu item for each module, with module content loading dynamically with Prism or MEF

  - by user573145

  I am developing an application currently using Prism and MEF. I would ideally like to generate a toolbar or menu with an item for each module, and when an item is clicked, only the views declared within that module load into a tab control. For example: Menu Region: ModuleA(Selected) | ModuleB Tab Region: ModuleAViewA | ModuleAViewB | ModuleAViewC Changes to Menu Region: Employees | Inventory(selected) Tab Region: Items | In Fi

  Read the article

• SSRS: Report loading external images, image not found, can I hide the image control

  - by Nauman

  My SSRS report loads logo images for each customer from a customer number specific folder on the report server. I write an expression, to form my URL to the image based on th customer number. ..."http://localhost/images/" + iCustomerNumber.ToString() + "/logo.gif" I am able to get this working, but the problem I face is, when a particular customer doesn't has an image, then my report shows a red X mark in place of the logo. In this case, I expect to hide the image control itself. Any thoughts???? The other dirty solution will be to ensure that each customer specific folder has the designated image! even if there is no logo for a customer, I'll place a blank.gif or a spacer.gif of probably a square pixel in dimension!.

  Read the article

• loading child swf as3

  - by RichW

  Hi, I've been given an fla to make some changes too. Basically its a fairly long timeline animation with sound. So far I've successfully added a few button functions for sound etc.. but one has got me stumped. One of the buttons needs to load a child swf. I'm using the code below but I'm recieving an error - 'Error #1009: Cannot access a property or method of a null object reference'. I believe this may be refferring to an object that isn't set yet but I have no idea which one it is: Code: var mcExt:MovieClip = new MovieClip(); var ldr:Loader = new Loader(); ldr.contentLoaderInfo.addEventListener(Event.COMPLETE, swfLoaded); ldr.load(new URLRequest("Downloads.swf")); function swfLoaded(e:Event):void { mcExt = MovieClip(ldr.contentLoaderInfo.content); ldr.contentLoaderInfo.removeEventListener(Event.COMPLETE, swfLoaded); mcExt.x = 50; mcExt.y = 50; addChild(mcExt); } Any help on what is going wrong would be greatly appreciated! Thanks

  Read the article

• Error loading my managedObjectModel

  - by niklassaers

  Hi guys, When I call [myAppDelegate managedObjectModel], in the retain line below, my application will crash (iPhone SDK v3.1.3): - (NSManagedObjectModel *)managedObjectModel { if (managedObjectModel != nil) { return managedObjectModel; } managedObjectModel = [[NSManagedObjectModel mergedModelFromBundles:nil] retain]; return managedObjectModel; } Here is my crash trace #0 0x905c44e6 in objc_exception_throw #1 0x01e78c3b in +[NSException raise:format:arguments:] #2 0x01e78b9a in +[NSException raise:format:] #3 0x000af99b in _NSArrayRaiseInsertNilException #4 0x0001c360 in -[NSCFArray insertObject:atIndex:] #5 0x0001c274 in -[NSCFArray addObject:] #6 0x01c16a7e in +[NSManagedObjectModel mergedModelFromBundles:] #7 0x00002432 in -[myAppDelegate managedObjectModel] at myAppDelegate.m:102 What is going on here? This is template code that I haven't seen fail before. Cheers Nik

  Read the article

• jquery block UI malfunction on ajax loading event

  - by Ygam

  problem: trigger errored when block UI is called on this code (function($){ function preloader() { $('a#preloader').click(function(e){ e.preventDefault(); var url = base_url + 'runtest/preloader'; $('div#content').load(url, preloaderCallback); }); } function remotePreload() { $('a#remotepreload').click(function(e){ e.preventDefault(); var object = $(this); object.data('clicked', 'yes'); var url = base_url + 'runtest/remote_preloader'; $('div#content').load(url); }); } /* * callback functions */ function preloaderCallback() { $('div.imageholder img').hide(); $('div.imageholder img').each(function(){ var img = new Image(); var sursa = $(this).attr('src'); var parent = $(this).parent(); var preloaderSource = '<img src="' + base_url + 'media/images/preloader.gif' + '" alt="loader"/>'; parent.append(preloaderSource); $(img).load(function(){ parent.append($(this)); $(this).hide().fadeIn(500); $(this).siblings().remove(); }).attr('src', sursa); }); } function blocker() { $('#content').block(); } function handlePageLoad() { $('a#remotepreload').ajaxStart(function(e){ var elem = $(e.target); if (elem.data('clicked') == 'yes') { // error when blocker() function is called here alert('Started'); } }); $('a#remotepreload').ajaxComplete(function(e){ var elem = $(e.target); if (elem.data('clicked') == 'yes') { elem.removeData('clicked'); alert('Ended'); } }); } // call onready functions $(function(){ preloader(); remotePreload();handlePageLoad(); }); })(jQuery); // here's the error from firefox's debugger uncaught exception: [Exception... "Could not convert JavaScript argument arg 0" nsresult: "0x80570009 (NS_ERROR_XPC_BAD_CONVERT_JS)" location: "JS frame :: http://localhost/testsuite/media/js/jquery.min.js :: anonymous :: line 115" data: no] here's the html markup <div id="wrap"> <div id="header"> <?= $header ?> </div> <div id="content"> <?= $content ?> </div> <div id="sidebar"> <?= $sidebar ?> </div> <div id="footer"> <?= $footer ?> </div> </div> EDIT I was using Jquery 1.4.1 when this happened. Switched back to 1.3 and everything went back to normal.

  Read the article

• Trouble with loading jquery onload.

  - by Darcy

  Hi guys, I'm trying to build some jquery tabs based on the request (which is stored in a table). I have two pages sharing one .js file. One page is for the user to create the request, and the other is for the administrator to approve/deny the request. On the admin page, here is my javascript code: $(function() { GetRequest(); }); Which is just calling a function I have inside my .js file. All the code in the .js file is also wrapped in a '$(function(){ //...code here })'. The problem is the function isn't built yet when calling it from the page. Is there a way I can tell the page to wait until the script is complete?

  Read the article

• Loading Accessory callout view for mkannotationview

  - by Zap

  I have a map annotation view that contains a rightcallout button which loads an accessory view which is a UIViewController class. I am using resuable annotations, but am wondering how I can pass updated information to my UIViewController class. Let's say I have 2 string values which map to 2 UILabels on my view. How can I update those values after the initial accessory view has already been loaded into memory as a resusable view? Any help would be appreciated.

  Read the article

• Java WebApp: Loading resource from .jar located in WEB-INF

  - by shaman.sir

  There are a lot of similar questions, but, probably, mine is a little bit different: What is the right way to load resource from inside of .jar file located in WEB-INF/lib folder (if I know the jar file name and the name of the class it resource belongs to), while Web Application is running? Should I use getServletContext().getResourceAsStream(?) for this purpose or the <name-of-known-class>.getResourseAsStream(?), and what path do I need to specify there? So, the structure is: /WEB-INF /classes /some/package/name ?.class #some Java code or Servlet that tries to read 'required-file.xml' /lib /<jar-with-known-name>.jar /another/package/with/known/name SomeKnownClass.class required-file.xml

  Read the article

• Ajax Content Loading(Processing) image or indicator

  - by Arny

  Hi there, in part of my web page, I have couple of asp:image Thumbnails, onclick I use ajax modal popup extender to show the imgae in full size which are working fine, what I need to add is to have a processing image or indicator both in thumbnail and modal popup extender, I also have ajax autocomplete that is working fine, I need to add some indicator or processing image to it as soon as user start typing a word. any idea? Thanks in advance

  Read the article

• Django template not loading properly

  - by fmsf

  Hey, When this one runs everything goes fine: (r"^newobject$", "views.myobjects.newobject"), All the CSS + JS files are properly fetched from: static/css/... static/js/... When this one runs: (r"^mybjects/(([a-z]|[A-Z]|[0-9])+)$","views.myobjects.loadobject"), All the css and JS files that are being fetched, are run trough the urlpatterns and are returning my defailt page: (r"", 'views.main.index'), This makes all my CSS and JS code to actualy be HTML. My guess is that i'm giving some noob mistake. Is there any common reason why this should happen? And how to fix it?

  Read the article

• Loading a Reusable UITableViewCell from a Nib

  - by Greg Martin

  I am able to design custom UITableViewCells and load them just fine using the technique described in the thread found at http://forums.macrumors.com/showthread.php?t=545061. However, using that method no longer allows you to init the cell with a reuseIdentifier which means you have to create whole new instances of each cell at every call. Has anyone figured out a good way to still cache particular cell types for reuses, but still be able to design them in Interface Builder?

  Read the article

• htaccess rewrite rule not loading site content

  - by peter

  I am struggling with .htaccess rewrite rules. Let's say I have this URL. localhost/site/index.php and I want to rewrite it as this URL localhost/site/tutorial I would use this RewriteRule Options +FollowSymLinks RewriteEngine on RewriteRule ^tutorial/(.*)$ /up/index.php The page works, but the CSS files don't load. Also, if I have a URL like this: index.php?page=home Then I would have to parse through that URL to get 'home' not using $_GET anymore correct??

  Read the article

• loading multiple line query in one row

  - by bharath

  Hi, How to load a multiple line query in one row using mysql.The data is stored in a text file. For example: "GGAGTTGTGGGAGTGGAGGAGGAAGAGGCGGTGGGGAGTACGGGGGCTGGTCCCAGAAGATGGCGGAGGC GGGGGATTTCTGGTAGGTCCTACTTTAGGACAAGATGTGGTGGTACTGTTGAAGCGTCAGTCTTTGATTC" Thanks in advance.

  Read the article

• Stop an anchor from loading on javascript confirm

  - by Joseph Carrington

  I was under the impression that this was formed correctly, but here it is forwarding to the anchor href (clicking through? what should I call this?) whether or not the user selects cancel or okay. <script type="text/javascript"> function myconfirm(my_string) { var agree = confirm('Are you sure you want to remove ' + my_string + '?'); if(agree) { return true; } else { return false; } } </script> and the anchor <a href="example.com/?remove=yes" onclick="myconfirm('my_string')">My String</a>

  Read the article

• Loading an external .htm file into a div with javascript

  - by Mads Friis

  So I got this code Javascript: <script type="text/javascript"> $(function(){ $('.ajax') .click(function(e){ e.preventDefault() $('#content').load( 'file.htm' ) }) }) </script> html: <a href="file.htm" class="ajax">Link</a> it works perfectly in firefox, but nothing happens when I click the link in chrome and IE simply opens a new window with the file. any advice?

  Read the article

• Rails CSS not Loading using Heroku

  - by eWizardII

  I have the following site set up here on Heroku - http://www.peerinstruction.net/users/sign_up the issue is that I have updated the css yet it is not being actively reflected on the site, it just shows a textbox, with some edited/custom fonts. I have attached the css file in the following gist - https://gist.github.com/f74b626c54ecbb60bbde The signup page controller: !!! Strict %html %head %title= yield(:title) || "Untitled" = stylesheet_link_tag 'application', 'web-app-theme/base', 'web-app-theme/themes/activo/style', 'web-app-theme/override' = javascript_include_tag :defaults = csrf_meta_tag = yield(:head) %body #container #header %h1 %a{:href => "/"} Peer Instruction Network #user-navigation %ul.wat-cf %li .content.login .flash - flash.each do |type, message| %div{ :class => "message #{type}" } %p= message = form_for(resource, :as => resource_name, :url => session_path(resource_name), :html => { :class => "form login" }) do |f| .group.wat-cf .left= f.label :email, :class => "label right" .right= f.text_field :email, :class => "text_field" .group.wat-cf .left= f.label :password, :class => "label right" .right= f.password_field :password, :class => "text_field" .group.wat-cf .right %button.button{ :type => "submit" } Login /= link_to "Sign In", destroy_user_session_path #box = yield The signup pages haml file: %h2 .block .content.login .flash - flash.each do |type, message| %div{ :class => "message #{type}" } %p= message = form_for(resource, :as => resource_name, :url => registration_path(resource_name)) do |f| = devise_error_messages! %div = f.label :firstname %br/ = f.text_field :firstname %div = f.label :middlename %br/ = f.text_field :middlename %div = f.label :lastname %br/ = f.text_field :lastname %div = f.label :email %br/ = f.email_field :email %div = f.label :password %br/ = f.password_field :password %div = f.label :academic %br/ = f.text_field :academic %div= f.submit "Continue" = render :partial => "devise/shared/links" I used web-app-theme to create an activo theme and then modify it.

  Read the article

• Dynamic adding of usercontrols not showing control on page

  - by Phil

  I am trying to insert a user control dynamically into my default.aspx page via the following method in the page_init: Dim control As UserControl = LoadControl("~\Modules\Content.ascx") Controls.Add(control) When I run the page there is no sign of the usercontrol. Am I using the correct code to insert the usercontrol? Is there an alternative method of insertion available? Does the fact that the usercontrol has a page_load make a difference? Do I need to register the control in my aspx page at design time? Thanks in advance for any assistance you can offer.

  Read the article

• Loading Youtube Iframe API with RequireJS

  - by davidgnin

  I'm trying to use the Youtube Iframe API inside a module definded with Require JS. As this API is loaded async and calls a function once is loaded, I used a requireJS plugin called "async", that worked before with google maps api. However, this time something isn't working. My module starts this way: define(['text!fmwk/widgets/video/video.html','fmwk/utils/browser','async!http://www.youtube.com/iframe_api'], function (videoTpl,root) { ... }); and chrome console fires this error: Uncaught Error: Load timeout for modules: async!http://www.youtube.com/iframe_api_unnormalized3,async!http://www.youtube.com/iframe_api http://requirejs.org/docs/errors.html#timeout If I don't use async plugin the object YT or its functions are undefinded, and the same happens if I download the API code. The API is loaded sometimes if I put an script tag in the head tag of the html file. All this is expected, but I don't understand because async plugin fails. Thank you for your attention and help :)

  Read the article

• Problem while loading the application on iPAD?

  - by chaitanya

  Hi, I developed a simple application for iPAD. I want to test the app how it works on the device. I have paid developer licence, and i have added the device id and created the app id and i have downloaded the provisioning profile using both. The same way how we will build the app for iphone i have done for ipad. i have sent the provisioning profile and .ipa file to my friend to load on to the ipad device(same device which i have added in the developer.apple.com). when he tried to drag n drop the provisioning file on to the device from iTunes it is giving below error. "abc.mobileprovision" was not copied on to the iPAD, because it cannot be palyed on this iPAD I am not able to understand what the exact error is. Can anyone please let me know how to dump the applicatio on to the ipad device?

  Read the article

< Previous Page | 47 48 49 50 51 52 53 54 55 56 57 58  | Next Page >