Search Results

Search found 19966 results on 799 pages for 'wild thing'.

Page 511/799 | < Previous Page | 507 508 509 510 511 512 513 514 515 516 517 518  | Next Page >

  • Should I convert overly-long UTF-8 strings to their shortest normal form?

    - by Grant McLean
    I've just been reworking my Encoding::FixLatin Perl module to handle overly-long UTF-8 byte sequences and convert them to the shortest normal form. My question is quite simply "is this a bad idea"? A number of sources (including this RFC) suggest that any over-long UTF-8 should be treated as an error and rejected. They caution against "naive implementations" and leave me with the impression that these things are inherently unsafe. Since the whole purpose of my module is to clean up messy data files with mixed encodings and convert them to nice clean utf8, this seems like just one more thing I can clean up so the application layer doesn't have to deal with it. My code does not concern itself with any semantic meaning the resulting characters might have, it simply converts them into a normalised form. Am I missing something. Is there a hidden danger I haven't considered?

    Read the article

  • APC on Windows makes server terminate connection

    - by vanneto
    Hello. I have a slight problem and cannot for the life of me figure out what is happening. I am running a Linux machine on a server with APC enabled. Everything works fine. Now when I enable APC on Windows the server starts terminating the connection. You know, the "Site currently unavailable" message Firefox spits out. I tried the access logs, error logs and there is nothing there to indicate an error. How could APC influence on a server like this? BTW: I have a CMS on my local server/live server. On the live server it works great with APC. On the dev server the connection terminates. The strange thing is, simpler scripts execute just fine. The CMS is using CakePHP. Any help would be very appreciated.

    Read the article

  • JDBC Pagination

    - by Zeeshan
    Hi, I want to implement pagination using JDBC. The actual thing I want to know is "How can i get first 50 and then next 50 records from database for page 1 and 2 respectively" My Query is Select * from data [data table contains 20,000 rows] For page #1 I get 50 records and for page #2 I want to get next 50 records. How can I implement it efficiently in JDBC? I have searched and found that rs.absolute(row) is the way to skip first page records but it takes some amount of time on large result sets and I don't want to bear this amount of time. Also, I don't want to use rownum and limit + offset in query because these are not good to use in query, I dont know why, still I don't want to use it in query. Can anyone help me how to get limited ResultSet for pagination or is there any way JDBC is giving us?

    Read the article

  • Dynamically choosing css property in animation

    - by paddywhack
    Hi, It seems a straightforward thing but I'm not having much success. I'm just implementing a simple animation moving a div left or up using animate() but I would like to be able to set the "top" and "left" css properties dynamically. I would like to use the same function rather than have to have two, one for "left" and one for "top". Here's some code which gives the idea. function test($element){ $element.click(function(){ var cssProperty; var direction = "left"; var moveTo = "100px"; if (direction === "top") { cssProperty = "top"; } else { cssProperty = "left"; } /*Using variable as CSS property - This doesn't work */ $(this).animate({ cssProperty: moveTo }, 1000); /*Using variable as the CSS Values - This does */ $(this).animate({ left: moveTo }, 1000); }); } Variables works on the css value side but not on the css selector side. Anyone have any suggestions? Thanks

    Read the article

  • Sql Server related question

    - by stefan
    Hi guys, I have this thing that i need to do and some advices will be greatly appreciated. I have a Sql server table with some phone calls.For each phone call i have the start and end time. What i need to accomplish: a stored procedure which for a certain period of time, let's say 5 hours at a x interval, lets say 2 minutes returns the number of connected calls. Something like: Interval Nr of Calls Connected 01-01-2010 12:00:00 - 01-01-2010 12:05:00 30 01-01-2010 12:05:01 - 01-01-2010 12:10:00 10 ............. Which will be the fastest way to do that? Thank you for your help

    Read the article

  • Have anyone ever create/manipulate a table application from the ground up/scratch?

    - by Darwin
    Have anyone ever create/manipulate a table application from the ground up/scratch? I want to create a table using flash AS 3. I like to have the features like to the MS Studio Web Developer option. The options are create a table, merge cells, split cell, resize columns, delete cell, delete row, delete column etc... I think this is going to be very complicated thing to do. I think the only way to do it is to build it from the ground up because I don’t think Flash has the library/component for it. I was able to create rows and columns by creating the # of rectangles listed it from the left to the right and move the next coordinate for the next row. Now the most challenging this is to manipulate it. This is the must have feature on my website and we don’t want use Javascript to create table on the server side to create the table.

    Read the article

  • Run command with no terminal output

    - by Insomaniacal
    Hello, I've searched around online, but can't find the answer to my question. What I want to do is run a command in pythong, using the subprocess module, and store the output in a variable. However, I do not want the command's output to be printed to the terminal. For this code: def storels(): a = subprocess.Popen("ls",shell=True) storels() I get the directory listing in the terminal, instead of having it stored in a. I've also tried def storels(): subprocess.Popen("ls > tmp",shell=True) a = open("./tmp") [Rest of Code] storels() This also prints the output of ls to my terminal. I've even tried this command with the somewhat dated os.system method, since running "ls tmp" in the terminal doesn't print ls to the terminal at all, but stores it in tmp. However, the same thing happens. I'm using python 2.6. Any suggestions? Thanks in advance!

    Read the article

  • How to know when a user console is locked or has logged "back into" windows

    - by Paul Kohler
    This is in regards to applications that run in the taskbar but should be applicable to standard apps, Winforms, WPF, etc. Question: I am after some method (preferably via managed code) to be notified when a user either has their screen "locked" while my app is running and/or know when they log back in. GMail Notifier does this sort of thing for example, if my PC is locked for a while when I log in again it shows a list of emails that arrived since locking the PC. I'm looking to replicate that kind of functionality. Does anyone have any ideas on how to accomplish this?

    Read the article

  • Looking for an approach to program a mobile website for any device. Are there any?

    - by ChrisBenyamin
    My wish is to know how I can program a mobile website, that fit to all mobile phones. Are there any special approaches to recognize a device and render the code according to it? Which tools and coding languages are required? My first thought was to hold the website in XML, which would be parsed depending on the device. You have to consider old phones, even devices with only wap support. For example: The mobile website has to recognize Nokia N75 and render/send the code that looks optimal for this device. Same thing with an iPhone or a Motorola Razr.

    Read the article

  • Android app display different blocks of text using the same views.

    - by user465131
    I am sure there is a better way to do what I am doing in my apps. The current one I am trying to improve is a list of military cadences. The way I am doing it now is by loading html files in a web view. What I would like to be able to do is have one view set up and just be able to add the text portion of what I would be displaying with the html file. What would be the best method. I know this is probably a pretty simple thing to do with a sting or array but I am at the very beginner level and would need to be pointed in the right direction to do it.

    Read the article

  • Passing a variable that can be updated

    - by Rob Bonner
    This seems like a simple thing, but can't get it to work. I pass a variable into a UIViewController thourgh a standard property: [aViewController setProposedDate:proposedWorkLog.entryDate]; which is retained by the controller, and possible changed. I have verified that in the controller, the data is modified. But, after it is popped off the stack and I look in the calling view, the data has not been updated. Is there a way to pass this variable and have it retain the new value, or a way to pass back a response from a closing view controller? Thanks!

    Read the article

  • Clarifying... So Background Jobs don't Tie Up Application Resources (in Rails)?

    - by viatropos
    I'm trying to get a better grasp of the inner workings of background jobs and how they improve performance. I understand that the goal is to have the application return a response to the user as fast as it can, so you don't want to, say, parse a huge feed that would take 10 seconds because it would prevent the application from being able to process any other requests. So it's recommended to put any operations that take more than say 500ms to execute, into a queued background job. What I don't understand is, doesn't that just delay the same problem? I know the user who invoked that background job will get an immediate response, but what if another user comes right when that background job starts (and it takes 10 seconds to finish), wont that user have to wait? Or is the main issue that, requests are the only thing that can happen one-at-a-time, while on the other hand a request can start while one+ background jobs are in the middle of running? Is that correct?

    Read the article

  • c# project cannot find c++ .dll?

    - by flavour404
    I have a working c++ dll that works in one c# project that I am calling via the interop service. I have created another c# project and am trying to call the same .dll but keep getting a generic error message stating that the .dll cannot be found, both project are .net 2.0. What folder, and where do I specify in the project, should I put the .dll file in so that the project can find it? Think of it as a reminder for me... In the previous project I did not have a reference to it, I just had it in the /bin folder and doing the same thing for this project does not work. Thanks R.

    Read the article

  • C++ Char without Limit

    - by Lienau
    I'm pretty well versed in C#, but I decided it would be a good idea to learn C++ as well. The only thing I can't figure out is chars. I know you can use the string lib but I also want to figure out chars. I know you can set a char with a limit like this: #include <iostream> using namespace std; int main() { char c[128] = "limited to 128"; cout << c << endl; system("pause"); return 0; } But how would I make a char without a limit? I've seen chars with * but I though that was for pointers. Any help is greatly appreciated.

    Read the article

  • Script Doesnt Run All the Way Through

    - by Chris
    I have a php script that should execute 2 for loops. Both take awhile to run. I have called ignore_user_abort(true) and set_time_limit(0). The interesting thing is, the first for loop completes, then the script dies without calling the next line of code. ignore_user_abort(true); set_time_limit(0); for($i=0; $i<10500; ++$i) { //do work } mail('[email protected]', 'First loop done', 'None'); for($j=0;$j<12500; ++$j) { //do work } mail('[email protected]', 'Second loop done', 'None'); The first loop will finish after about 20 minutes, but the mail function is never called, the script just ends. Any ideas why this might be happening other than a timeout (I have run other scripts for days on my current configuration)?

    Read the article

  • Can jquery capture the dynamic dom events and perform actions

    - by Zombie15
    I just wanted to know if something like this is possible. Jquery should fire some action on certian custom event. Like Whenever a new row is added to dom dynamically to table then i have certain action like change the background color to example red. That should work across the whole site. Somethings like Event listeners in Doctrine2 or Signals in Django EDIT: Basically i want some thing like where i can create custom event $.AddnewEvent(newRowAdded); Then i can customise that event with my own functions like $.newRowAdded(function(){ blah blah });

    Read the article

  • SQL: Interrupting a query

    - by NoozNooz42
    I've worked on a project using a proprietary non-SQL DB where queries could be interrupted and in the codebase there were quite some spots where that functionnality was used and made perfect sense (for example to stop a long running query that gets cancelled by the user, or when a more recent query takes place and renders the previous query obsolete, etc.) and I realized I never really saw that kind of "interrupted queries" previously and thought it could make a good SO question (several questions, but they're all related to exactly the same thing): can SQL queries be interrupted? is this part of the SQL standard? if it's not part of the SQL standard, which SQL DBs allow queries to be interrupted (any example most welcome)? is it common to interrupt a DB query (SQL or not) which you'll know you won't care about the result anymore? (in the codebase I've worked on, it sure helps lighten the server's load)

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • What is the best way to deal with address inputs that can be from multiple countries?

    - by Andrew.S
    Most of my websites in the past have been rather limited to the United States when it came to displaying addresses. On a project I'm working on right now, however, users can add events from all over the world. My problem is how to go about dealing with the different way in which addresses are displayed across the world. For example, City/State/Zip is just a US thing. I was figuring I would alter the inputs displayed based on the country selected but I have no idea how I'm supposed to know the way every single country does addresses. Ideas?

    Read the article

  • Outlook 2007 plugin

    - by JL
    I am about to embark on my first outlook 2007 plugin. I would like to create a new tool bar that will have a button that will initially be disabled. When the user selects a message the button should be enabled... but only if the email is of a certain type of email... This is where I need your expert advice, is there a way to quickly flag an email in outlook, so that in the email select event you can look for a property of that email... for example... on_select if mail.type = "FromISP" then I would prefer not to use the from field.... the other thing is during the send process I need to set the flag, I am doing this again using .net so I have full control over how the mail is created. Any ideas would help... Thanks

    Read the article

  • What scripts should not be ported from bash to python?

    - by Jack
    I decided to rewrite all our Bash scripts in Python (there are not so many of them) as my first Python project. The reason for it is that although being quite fluent in Bash I feel it's somewhat archaic language and since our system is in the first stages of its developments I think switching to Python now will be the right thing to do. Are there scripts that should always be written in Bash? For example, we have an init.d daemon script - is it OK to use Python for it? We run CentOS. Thanks.

    Read the article

  • Language in mdi forms

    - by WFgo
    I have a problem with set lenguage to MDI forms. In my main form I have a menustrip and I use resource file for translate I wanted to know if I'm doing the right thing My code is this (Example): Public Class Main Public SNFrm As New SalesNote Private Sub SetLanguage() SNFrm.Text = My.Resources.... SNFrm.AcceptBtn.Text = My.Resources... End Sub Private Sub MenuSalesNote_Click(......) SNFrm = New SalesNote SNFrm.MdiParent = Me SNFrm.StartPosition = FormStartPosition.CenterScreen SNFrm.Show() End Sub End Class Then, in My SalesNote Form_Closing Event Main.SNFrm.Dispose() is this correctly? Help!

    Read the article

  • jQuery: How do I insert an html string an arbitrary number of times (i.e. not with an each() function)?

    - by Sam Bivins
    I just need to take a certain html query object and append it to an html element a lot of times. I have this: var box = $("<div class='box'>&nbsp</div>"); $("#firstbox").after(box); and it works fine, but it just adds one 'box' after the #firstbox element. I'd like to do something like this: var box = $("<div class='box'>&nbsp</div>"); $("#firstbox").after(box * 6000); so that it will insert 6000 copies of that 'box' html, but this is not working. This is I'm sure the easiest thing to do, but I can't seem to find how to multiply actions like this without using the each() function, which doesn't apply here because I don't have 6000 of anything on my page. Thanks.

    Read the article

  • .NET framework is copied to 'compiler/CLR' and 'GAC?

    - by prosseek
    The book of CLR via C# has this line at page 76. When you install the .NET Framework, tow copies of Microsoft's assembly files are actuall installed. One set is installed into the compiler/CLR directory, and another set is installed into GAC subdirectory I could find the GAC at C:\Windows\Microsoft.NET\assembly, but I couldn't find the compiler/CLR thing. What's the physical directory name of compiler/CLR? I mean, where is it? Why there are two GAC in assembly directory? I find GAC_32 and GAC_MSIL.

    Read the article

  • How place a link below a picture that is displayed using fancybox (jquery)?

    - by janoChen
    In the first picture of my website (the two persons), shows an URL address when you click on it. I used the "title" thing. Is there a simple way of doing the same but placing a link instead? code: <div class="pusher"> <h3><?php echo l('showcase1_h3'); ?></h3> <p><?php echo l('showcase1_p'); ?></p> <div class="pic"> <a id="showcase1" title="studyatbest.com" href="images/showcase1.png"><img src="images/showcase1t.png"/></a> </div> </div> http://alexchen.co.nr/

    Read the article

< Previous Page | 507 508 509 510 511 512 513 514 515 516 517 518  | Next Page >