Search Results

Search found 43274 results on 1731 pages for 'single line'.

Page 513/1731 | < Previous Page | 509 510 511 512 513 514 515 516 517 518 519 520  | Next Page >

  • Drupal theme preprocess function - primary links and suckerfish menus

    - by slimcady
    I have a preprocess function that works fine when the menu is single level list. However I would like it to work w/ suckerfish menus. I want to add a class to the top level menu item so that I can style it. This is the code I used for the single level menu: function cti_flex_preprocess_page(&$vars, $hook) { // Make a shortcut for the primary links variables $primary_links = $vars['primary_links']; // Loop thru the menu, adding a new class for CSS selectors $i = 1; foreach ($primary_links as $link => $attributes){ // Append the new class to existing classes for each menu item $class = $attributes['attributes']['class'] . " item-$i"; // Add revised classes back to the primary links temp variable $primary_links[$link]['attributes']['class'] = $class; $link['title'] = '<span class="hide">' . check_plain($link['title']) . '</span>'; $i++; } // end the foreach loop // reset the variable to contain the new markup $vars['primary_links'] = $primary_links; } I've been trying to use the menu_tree() function to no avail, for example: function cti_flex_preprocess_page(&$vars, $hook) { // Make a shortcut for the primary links variables $primary_links = $vars['primary_links']; // Loop thru the menu, adding a new class for CSS selectors $i = 1; foreach ($primary_links as $link => $attributes){ // Append the new class to existing classes for each menu item $class = $attributes['attributes']['class'] . " item-$i"; // Add revised classes back to the primary links temp variable $primary_links[$link]['attributes']['class'] = $class; $link['title'] = '<span class="hide">' . check_plain($link['title']) . '</span>'; $i++; } // end the foreach loop // reset the variable to contain the new markup $vars['primary_links_tree'] = menu_tree(variable_get('menu_primary_links_source', '$primary_links')); } Any ideas would be greatly appreciated.

    Read the article

  • cutting a text file into multiple parts in emacs

    - by Gaurish Telang
    Hi I am using the GNU-Emacs-23 editor. I have this huge text file containing about 10,000 lines which I want to chop into multiple files. Using the mouse to select the required text to paste in another file is the really painful. Also this is prone to errors too. If I want to divide the text file according to the line numbers into say 4 file where first file:lines 1-2500 second file:lines 2500-5000 third file :lines 5000-7500 fourth file: lines: 7500-10000 how do I do this? At the very least, is there any efficient way to copy large regions of the file just by specifying line numbers

    Read the article

  • Where/When does C# and the .NET Framework fail to be the right tool?

    - by Nate Bross
    In my non-programming life, I always attempt to use the approprite tool for the job, and I feel that I do the same in my programming life, but I find that I am choosing C# and .NET for almost everything. I'm finding it hard to come up with (realistic business) needs that cannot be met by .NET and C#. Obviously embedded systems might require something less bloated than the .NET Micro Framework, but I'm really looking for line of business type situations where .NET is not the best tool. I'm primarly a C# and .NET guy since its what I'm the most comfertable in, but I know a fair amount of C++, php, VB, powershell, batch files, and Java, as well as being versed in the web technologes (javascript, html/css). But I'm open minded about it my skill set and I'm looking for cases where C# and .NET are not the right tool for the job. The bottom line here, is that I feel that I'm choosing C# and .NET simply because I am very comfertable with it, so I'm looking for cases where you have chosen something other than .NET, even though you are primarly a .NET developer.

    Read the article

  • Why first arg to execve() must be path to executable

    - by EBM
    I understand that execve() and family require the first argument of its argument array to be the same as the executable that is also pointed to by its first argument. That is, in this: execve(prog, args, env); args[0] will usually be the same as prog. But I can't seem to find information as to why this is. I also understand that executables (er, at least shell scripts) always have their calling path as the first argument when running, but I would think that the shell would do the work to put it there, and execve() would just call the executable using the path given in its first argument ("prog" from above), then passing the argument array ("args" from above) as one would on the command line.... i.e., I don't call scripts on the command line with a duplicate executable path in the args list.... /bin/ls /bin/ls /home/john Can someone explain?

    Read the article

  • Creating standalone, console (shell) for domain-specific operations

    - by mr.b
    Say that I have a system service, and I want to offer a low-level maintenance access to it. For that purpose, I'd like to create a standalone, console application that somehow connects to server process and lets user type in commands, allow it to use auto-completion and auto-suggestion on single/double TAB press (just like linux bash shell, mysql cli, cmd.exe, and countless others), allow command line editing capabilities (history, cursor keys to move around text..), etc. Now, it's not that much of a problem to create something like that by rolling my own from scratch, handling user input, scanning pressed keys, and doing correct actions. But, why reinvent the wheel? Is there some library/framework that helps with this kind of problems, just like readline library that offers improved command-line editing capabilities under linux? Of course, this new "shell" would respond only to valid, domain-specific commands, and would suggest valid arguments, options, switches... Any ideas? Thanks!

    Read the article

  • Cannot import SQLite with Python 2.6

    - by David McLaughlin
    I'm running Python 2.6 on Unix and when I run the interactive prompt (SQLite is supposed to be preinstalled) I get: [root@idev htdocs]# python Python 2.6 (r26:66714, Oct 23 2008, 16:25:34) [GCC 3.2.2 20030222 (Red Hat Linux 3.2.2-5)] on linux2 Type "help", "copyright", "credits" or "license" for more information. >>> import sqlite Traceback (most recent call last): File "<stdin>", line 1, in <module> ImportError: No module named sqlite >>> import sqlite Traceback (most recent call last): File "<stdin>", line 1, in <module> ImportError: No module named sqlite >>> How do I resolve this?

    Read the article

  • API-based solutions for sending payments to people without bank accounts

    - by Tauren
    I'm looking for inexpensive ways to send payments to hundreds or thousands of individual contractors, even if they do not have a bank account. Currently I only need to support payment in the USA, but may eventually be international. Here's the scenario: I offer a service that allows an organization or manager-type person to coordinate contractors for very short term jobs. These jobs are typically only an hour or two in length. A contractor may get only one job over an entire month, several jobs spread out over a month, multiple jobs on a single day, or any other combination. Thus, a single contractor could earn as little as one job's payment up to potentially payment for dozens. Payment for a month could be as little as $10 up to $1000's. Right now, the system provides payroll reports to the manager and it is the manager's responsibility to produce checks, stuff envelopes, and send mail via the US postal service. I'd like to remove this burden from the manager and have all the payments taken care of for them automatically by the system. I'm not sure where to start or what the best options would be. I'm starting to look into the following solutions, but don't know specifics yet and would like some advice before pursuing them. I'd also like to hear about other ideas or suggestions. PayPal (Send Money, Adaptive Payments, x.com, other???) Amazon (Flexible Payments System?) Fund some sort of pre-paid debit card? Web service with API that mails checks for you? Direct deposit via a bank API (for users with bank accounts)? The problem is that many of these contractors may not be able to obtain bank accounts or credit cards within the USA. I don't mind doing a hybrid of solutions, but are there any that would work well with this issue? I want the solution to be easy to use for the contractors, meaning that they can get the money easily (via check in the mail, debit card ATM withdrawal, etc.)

    Read the article

  • Python - werid behavior

    - by orokusaki
    I've done what I shouldn't have done and written 4 modules (6 hours or so) without running any tests along the way. I have a method inside of /mydir/__init__.py called get_hash(), and a class inside of /mydir/utils.py called SpamClass. /mydir/utils.py imports get_hash() from /mydir/__init__. /mydir/__init__.py imports SpamClass from /mydir/utils.py. Both the class and the method work fine on their own but for some reason if I try to import /mydir/, I get an import error saying "Cannot import name get_hash" from /mydir/__init__.py. The only stack trace is the line saying that __init__.py imported SpamClass. The next line is where the error occurs in in SpamClass when trying to import get_hash. Why is this?

    Read the article

  • Checking if any of a list of values falls within a table of ranges

    - by Conspicuous Compiler
    I'm looking to check whether any of a list of integers fall in a list of ranges. The ranges are defined in a table defined something like: # Extra Type Field Default Null Key 0 int(11) rangeid 0 NO PRI 1 int(11) max 0 NO MUL 2 int(11) min 0 NO MUL Using MySQL 5.1 and Perl 5.10. I can check whether a single value, say 7, is in any of the ranges with a statement like SELECT 1 FROM range WHERE 7 BETWEEN min AND max If 7 is in any of those ranges, I get a single row back. If it isn't, no rows are returned. Now I have a list of, say, 50 of these values, not stored in a table at present. I assemble them using map: my $value_list = '(' . ( join ', ', map { int $_ } @values ) . ')' ; I want to see if any of the items in the list fall inside of any of the ranges, but am not particularly concerned with which number nor which range. I'd like to use a syntax such as: SELECT 1 FROM range WHERE (1, 2, 3, 4, 5, 6, 7, 42, 309, 10000) BETWEEN min AND max MySQL kindly chastises me for such syntax: Operand should contain 1 column(s) I pinged #mysql who were quite helpful. However, having already written this up by the time they responded and thinking it'd be helpful to fix the answer in a more permanent medium, I figured I'd post the question anyhow. Maybe SO will provide a different solution?

    Read the article

  • How do I do a join in ActiveRecord after records have been returned?

    - by Russ Bradberry
    I am using ActiveRecord in Rails 3 to pull data from two different tables in two different databases. These databases can not join on each other, but I have the need to do a simple join after-the-fact. I would like to preserve the relation so that I can chain it down the line. here is a simplified version of what I am doing browsers = Browser.all # <-- this is fairly small and can reside in memory events = Event.where(:row_date=>Date.today).select(:name, :browser_id) So as you can see, I want to join browsers in on the events relation, where browser_id should equal browsers.name. events is a relation and I can still add clauses to it down the line, so I dont want to run the query on the db just yet. How would I accomplish this?

    Read the article

  • System.Diagnostics.Debugger.Debug() stopped working

    - by Andrew Miner
    I'm working on a program which uses the System.Diagnostics.Debugger.Break() method to allow the user to set a breakpoint from the command-line. This has worked fine for many weeks now. However, when I was working on fixing a unit test today, I tried to use the debug switch from the command-line, and it didn't work. Here's what I've tried: I've confirmed that the Debug() method is really being called (by putting a System.Console.WriteLine() after it) I've confirmed that the build is still in Debug I've done a clean build I've restarted Product Studio A quick Google search didn't reveal anything, and the API documentation for .Net doesn't mention anything about this function not performing correctly. So... any ideas?

    Read the article

  • Form validation with optional File Upload field callback

    - by MotiveKyle
    I have a form with some input fields and a file upload field in the same form. I am trying to include a callback into the form validation to check for file upload errors. Here is the controller for adding and the callback: public function add() { if ($this->ion_auth->logged_in()): //validate form input $this->form_validation->set_rules('title', 'title', 'trim|required|max_length[66]|min_length[2]'); // link url $this->form_validation->set_rules('link', 'link', 'trim|required|max_length[255]|min_length[2]'); // optional content $this->form_validation->set_rules('content', 'content', 'trim|min_length[2]'); $this->form_validation->set_rules('userfile', 'image', 'callback_validate_upload'); $this->form_validation->set_error_delimiters('<small class="error">', '</small>'); // if form was submitted, process form if ($this->form_validation->run()) { // add pin $pin_id = $this->pin_model->create(); $slug = strtolower(url_title($this->input->post('title'), TRUE)); // path to pin folder $file_path = './uploads/' . $pin_id . '/'; // if folder doesn't exist, create it if (!is_dir($file_path)) { mkdir($file_path); } // file upload config variables $config['upload_path'] = $file_path; $config['allowed_types'] = 'jpg|png'; $config['max_size'] = '2048'; $config['max_width'] = '1920'; $config['max_height'] = '1080'; $config['encrypt_name'] = TRUE; $this->load->library('upload', $config); // upload image file if ($this->upload->do_upload()) { $this->load->model('file_model'); $image_id = $this->file_model->insert_image_to_db($pin_id); $this->file_model->add_image_id_to_pin($pin_id, $image_id); } } // build page else: // User not logged in redirect("login", 'refresh'); endif; } The callback: function validate_upload() { if ($_FILES AND $_FILES['userfile']['name']): if ($this->upload->do_upload()): return true; else: $this->form_validation->set_message('validate_upload', $this->upload->display_errors()); return false; endif; else: return true; endif; } I am getting the error Fatal error: Call to a member function do_upload() on a non-object on line 92 when I try to run this. Line 92 is the if ($this->upload->do_upload()): line in the validate_upload callback. Am I going about this the right way? What's triggering this error?

    Read the article

  • Unable to get data from a WCF client

    - by Scott
    I am developing a DLL that will provide sychronized time stamps to multiple applications running on the same machine. The timestamps are altered in a thread that uses a high performance timer and a scalar to provide the appearance of moving faster than real-time. For obvious reasons I want only 1 instance of this time library, and I thought I could use WCF for the other processes to connect to this and poll for timestamps whenever they want. When I connect however I never get a valid time stamp, just an empty DateTime. I should point out that the library does work. The original implementation was a single DLL that each application incorporated and each one was synced using windows messages. I'm fairly sure it has something to do with how I'm setting up the WCF stuff, to which I am still pretty new. Here are the contract definitions: public interface ITimerCallbacks { [OperationContract(IsOneWay = true)] void TimerElapsed(String id); } [ServiceContract(SessionMode = SessionMode.Required, CallbackContract = typeof(ITimerCallbacks))] public interface ISimTime { [OperationContract] DateTime GetTime(); } Here is my class definition: [ServiceBehavior(InstanceContextMode = InstanceContextMode.Single)] public class SimTimeServer: ISimTime The host setup: // set up WCF interprocess comms host = new ServiceHost(typeof(SimTimeServer), new Uri[] { new Uri("net.pipe://localhost") }); host.AddServiceEndpoint(typeof(ISimTime), new NetNamedPipeBinding(), "SimTime"); host.Open(); and the implementation of the interface function server-side: public DateTime GetTime() { if (ThreadMutex.WaitOne(20)) { RetTime = CurrentTime; ThreadMutex.ReleaseMutex(); } return RetTime; } Lastly the client-side implementation: Callbacks myCallbacks = new Callbacks(); DuplexChannelFactory pipeFactory = new DuplexChannelFactory(myCallbacks, new NetNamedPipeBinding(), new EndpointAddress("net.pipe://localhost/SimTime")); ISimTime pipeProxy = pipeFactory.CreateChannel(); while (true) { string str = Console.ReadLine(); if (str.ToLower().Contains("get")) Console.WriteLine(pipeProxy.GetTime().ToString()); else if (str.ToLower().Contains("exit")) break; }

    Read the article

  • Use matching value of a RegExp to name the output file.

    - by fx42
    I have this file "file.txt" which I want to split into many smaller ones. Each line of the file has an id field which looks like "id:1" for a line belonging to id 1. For each id in the file, I like to create a file named idid.txt and put all lines that belong to this id in that file. My brute force bash script solution reads as follows. count=1 while [ $count -lt 19945 ] do cat file.txt | grep "id:$count " >> ./sets/id$count.txt count='expr $count + 1' done Now this is very inefficient as I have do read through the file about 20.000 times. Is there a way to do the same operation with only one pass through the file? - What I'm probably asking for is a way to use the value that matches for a regular expression to name the associated output file.

    Read the article

  • Kerning problems when drawing text character by character

    - by shekel
    I'm trying to draw strings character by character to add lighting effects to shapes composed of text. while (i != line.length()) { c = line.substring(i, i + 1); cWidth = g.getFontMetrics().stringWidth(c); g.drawString(c, xx += cWidth, yy); i++; } The problem is, the width of a character isn't the actual distance it's drawn from another character when those two characters are printed as a string. Is there any way to get the correct distance in graphics2d?

    Read the article

  • How to skip extra lines before the header of a tab delimited delimited file in R

    - by Michael Dunn
    The software I am using produces log files with a variable number of lines of summary information followed by lots of tab delimited data. I am trying to write a function that will read the data from these log files into a data frame ignoring the summary information. The summary information never contains a tab, so the following function works: read.parameters <- function(file.name, ...){ lines <- scan("tmp.log", what="character", sep="\n") first.line <- min(grep("\\t", lines)) return(read.delim(file.name, skip=first.line-1, ...)) } However, these logfiles are quite big, and so reading the file twice is very slow. Surely there is a better way?

    Read the article

  • iPhone: How to Determine Average Light/Dark of an Area of an UIImage

    - by TechZen
    I need to place labels with a transparent background over a variable-content UIImage. Readability will vary significantly depending on the relationship between the color of the label's text and the color/luminosity of the area of the image displayed under the label. Since the image will be constantly changing, the color of the label's text needs to change in sync. I have found several techniques for determining the color, perceived luminosity etc of a single pixel. However, I need to rather quickly (while a view loads) determine the rough perceived color/luminosity of an area of the UIImage under the frame of the UILabel. I presume I will also need to measure the alpha because the same color/luminosity looks different at different alpha values. Is there a way to calculate such a value for an area? Will I be reduced to simply summing pixels? If it comes to that, is there an algorithm to accomplish this? I've thought of two possible approaches: Perform some "folding" operations i.e. combining pixels from one half of the area to the other half. Then repeat until I get a single value. Would this be practical? How would you logically combine pixels to average their perceived color/luminosity? Sample a statistically significant number of pixels in the area and then combine them (somehow) to get a rough measure. I think this problem comes up a lot these days with people being so found of customizing backgrounds. Seems like something that would be worth my time to bang out a category or class to handle this and then share it around.

    Read the article

  • NSUserDefaults and default language used for I18N

    - by fedmest
    I have searched around a lot for this and found some answers that sounded quite like what I wanted but never worked. I simply need to have my iPhone app load NIBs and Localizable.strings that I decide (through user selection) rather than the ones that are established through the global iPhone/iPad settings. General consensus seems to be that this line [[NSUserDefaults standardUserDefaults] setObject:[NSArray arrayWithObject:@"ro"] forKey:@"AppleLanguages"]; would do the trick (in this specific case, load the NIBs and Localizable.strings in ro.lproj) but I have not had such luck. It keeps on looking for the files in en.lproj or whatever language I chose in the Settings app. I have then tried adding this line [[NSUserDefaults standardUserDefaults] setObject:[NSArray arrayWithObject:@"ro_RO"] forKey:@"AppleLocale"]; and to my great surprise, it worked! ...only once :-( then back to the same issue. Has anyone got any idea how to solve this issue? The aforementioned code was added at the very start of applicationDidFinishLaunching, which is before any NIBs or strings files should be loaded.

    Read the article

  • Polling servers at the same port - Threads and Java

    - by John
    Hi there. I'm currently busy working on an IP ban tool for the early versions of Call of Duty 1. (Apparently such a feature wasn't implemented in these versions). I've finished a single threaded application but it won't perform well enough for multiple servers, which is why I am trying to implement threading. Right now, each server has its own thread. I have a Networking class, which has a method; "GetStatus" -- this method is synchronized. This method uses a DatagramSocket to communicate with the server. Since this method is static and synchronized, I shouldn't get in trouble and receive a whole bunch of "Address already in use" exceptions. However, I have a second method named "SendMessage". This method is supposed to send a message to the server. How can I make sure "SendMessage" cannot be invoked when there's already a thread running in "GetStatus", and the other way around? If I make both synchronized, I will still get in trouble if Thread A is opening a socket on Port 99999 and invoking "SendMessage" while Thread B is opening a socket on the same port and invoking "GetStatus"? (Game servers are usually hosted on the same ports) I guess what I am really after is a way to make an entire class synchronized, so that only one method can be invoked and run at a time by a single thread. Hope that what I am trying to accomplish/avoid is made clear in this text. Any help is greatly appreciated.

    Read the article

  • How do you organise multiple git repositories?

    - by dbr
    With SVN, I had a single big repository I kept on a server, and checked-out on a few machines. This was a pretty good backup system, and allowed me easily work on any of the machines. I could checkout a specific project, commit and it updated the 'master' project, or I could checkout the entire thing. Now, I have a bunch of git repositories, for various projects, several of which are on github. I also have the SVN repository I mentioned, imported via the git-svn command.. Basically, I like having all my code (not just projects, but random snippets and scripts, some things like my CV, articles I've written, websites I've made and so on) in one big repository I can easily clone onto remote machines, or memory-sticks/harddrives as backup. The problem is, since it's a private repository, and git doesn't allow checking out of a specific folder (that I could push to github as a separate project, but have the changes appear in both the master-repo, and the sub-repos) I could use the git submodule system, but it doesn't act how I want it too (submodules are pointers to other repositories, and don't really contain the actual code, so it's useless for backup) Currently I have a folder of git-repos (for example, ~/code_projects/proj1/.git/ ~/code_projects/proj2/.git/), and after doing changes to proj1 I do git push github, then I copy the files into ~/Documents/code/python/projects/proj1/ and do a single commit (instead of the numerous ones in the individual repos). Then do git push backupdrive1, git push mymemorystick etc So, the question: How do your personal code and projects with git repositories, and keep them synced and backed-up?

    Read the article

  • Loading .sql files from within PHP

    - by Josh Smeaton
    I'm creating an installation script for an application that I'm developing and need to create databases dynamically from within PHP. I've got it to create the database but now I need to load in several .sql files. I had planned to open the file and mysql_query it a line at a time - until I looked at the schema files and realised they aren't just one query per line. So, please.. how do I load an sql file from within PHP? (as phpMyAdmin does with it's import command).

    Read the article

  • python logparse search specific text

    - by krisdigitx
    hi, I am using this function in my code to return the strings i want from reading the log file, I want to grep the "exim" process and return the results, but running the code gives no error, but the output is limited to three lines, how can i just get the output only related to exim process.. #output: {'date': '13', 'process': 'syslogd', 'time': '06:27:33', 'month': 'May'} {'date': '13', 'process': 'exim[23168]:', 'time': '06:27:33', 'month': 'May'} {'May': ['syslogd']} #function: def generate_log_report(logfile): report_dict = {} for line in logfile: line_dict = dictify_logline(line) print line_dict try: month = line_dict['month'] date = line_dict['date'] time = line_dict['time'] #process = line_dict['process'] if "exim" in line_dict['process']: process = line_dict['process'] break else: process = line_dict['process'] except ValueError: continue report_dict.setdefault(month, []).append(process) return report_dict

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Newline not showing correctly in textbox

    - by TheGateKeeper
    I am loading a string from my database which among other things contains line breaks (\r\n). However, this isn't being rendered as a new line but instead as \r\n. If I type it directly in instead of loading it from a string, it works just fine but I need to be able to load it from a string. Any ideas? Edit: Upon closer inspection, it looks like the string is being returned as: Changed test7\\r\\nChanged test8\\r\\nChanged test9Changed test7 From the database. I tried running a .Replace(@"\\", @"\") on it but this had no effect at all. Any ideas?

    Read the article

< Previous Page | 509 510 511 512 513 514 515 516 517 518 519 520  | Next Page >