Search Results

Search found 5910 results on 237 pages for 'entity splitting'.

Page 52/237 | < Previous Page | 48 49 50 51 52 53 54 55 56 57 58 59  | Next Page >

  • Splitting list into a list of possible tuples

    - by user1742646
    I need to split a list into a list of all possible tuples, but I'm unsure of how to do so. For example pairs ["cat","dog","mouse"] should result in [("cat","dog"), ("cat","mouse"), ("dog","cat"), ("dog","mouse"), ("mouse","cat"), ("mouse","dog")] I was able to form the first two, but am unsure of how to get the rest. Here's what I have so far: pairs :: [a] -> [(a,a)] pairs (x:xs) = [(m,n) | m <- [x], n <- xs]

    Read the article

  • Splitting a list based on another list values in Mathematica

    - by Max
    In Mathematica I have a list of point coordinates size = 50; points = Table[{RandomInteger[{0, size}], RandomInteger[{0, size}]}, {i, 1, n}]; and a list of cluster indices these points belong to clusterIndices = {1, 1, 1, 1, 1, 1, 1, 2, 2, 1, 2, 1, 2, 1, 1, 1, 1, 1, 1, 1}; what is the easiest way to split the points into two separate lists based on the clusterIndices values?

    Read the article

  • Splitting up input using regular expressions in Java

    - by Joe24
    I am making a program that lets a user input a chemical for example C9H11N02. When they enter that I want to split it up into pieces so I can have it like C9, H11, N, 02. When I have it like this I want to make changes to it so I can make it C10H12N203 and then put it back together. This is what I have done so far. using the regular expression I have used I can extract the integer value, but how would I go about get C10, H11 etc..? System.out.println("Enter Data"); Scanner k = new Scanner( System.in ); String input = k.nextLine(); String reg = "\\s\\s\\s"; String [] data; data = input.split( reg ); int m = Integer.parseInt( data[0] ); int n = Integer.parseInt( data[1] );

    Read the article

  • Splitting a file before upload?

    - by Yevgeniy Brikman
    On a webpage, is it possible to split large files into chunks before the file is uploaded to the server? For example, split a 10MB file into 1MB chunks, and upload one chunk at a time while showing a progress bar? It sounds like JavaScript doesn't have any file manipulation abilities, but what about Flash and Java applets? This would need to work in IE6+, Firefox and Chrome. Update: forgot to mention that (a) we are using Grails and (b) this needs to run over https.

    Read the article

  • Splitting html string after so many words

    - by jimbo
    Hi all, I have a string that if it is longer than lets say 10 words, I want to split it into two parts. The second part will be included else-where after a 'more' link. The string will hold html tags too though. For an example the string could be: <p>This is just a test string with more words than the <strong>amount allow</strong> before split, blah blah blah</p> So in the case I would want: $string[0] // <p>This is just a test string with more words than</p>; $string[1] // <p>the <strong>amount allow</strong> before split, blah blah blah</p>; Thanks in advance

    Read the article

  • Splitting string into array upon token

    - by Gnutt
    I'm writing a script to perform an offsite rsync backup, and whenever the rsyncline recieves some output it goes into a single variable. I then want to split that variable into an array upon the ^M token, so that I can send them to two different logger-sessions (so I get them on seperate lines in the log). My current line to perform the rsync result=rsync --del -az -e "ssh -i $cert" $source $destination 2>&1 Result in the log, when the server is unavailable ssh: connect to host offsite port 22: Connection timed out^M rsync: connection unexpectedly closed (0 bytes received so far) [sender] rsync error: unexplained error (code 255) at io.c(601) [sender=3.0.7]

    Read the article

  • Splitting a double in two, C#

    - by Stacey
    I'm attempting to use a double to represent a bit of a dual-value type in a database that must sometimes accept two values, and sometimes accept only one (int). So the field is a float in the database, and in my C# code, it is a double (since mapping it via EF makes it a double for some reason... ) So basically what I want to do .. let's say 2.5 is the value. I want to separate that out into 2, and 5. Is there any implicit way to go about this?

    Read the article

  • Splitting values into groups evenly

    - by Paul Knopf
    Let me try to explain the situation the best I can. Lets say I have 3 values 1, 2, 3 I tell an algorithm to split this values into x columns. Lets say x = 2 for clarification. The algorithm determines that the group of values is best put into two columns the following way. 1st column 2nd column --------------------------- 1 3 2 Each column has an even number (totals, not literals) value. Now lets say I have the following values 7, 8, 3, 1, 4 I tell the algorithm that I want the values split into 3 columns. The algorithm now tells me that the following is the best fit. 1st column 2nd column 3rd column 8 7 3 1 4 Notice how the columns arent quiet even, but it is as close as it can get. A little over and a little under is considered ok, as long as the list is AS CLOSE TO EVEN AS IT CAN BE. Anybody got any suggestions? Know any good methods of doing this?

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Splitting a UL into three even lists

    - by Andy
    I am printing a menu using UL, the trouble is the order that is generated by my script is ignored because im printing the LI one after the other and they're spanning three across. So the order is 1 , 2 , 3 as opposed to 1 2 3 To counteract this i wanted to split my single UL into three that way the order would be maintained. Here is my code currently which works perfectly to print a single UL. //Category Drop Down Menu $this->CategoryDropDownMenu = '<ul id="subcatmenu">'; foreach($sitemap->CategoryMenu as $val) $this->CategoryDropDownMenu .= '<li><a href="'.$val[host].$val[link].'"><span>'.htmlspecialchars($val[title]).'</span></a></li>'; $this->CategoryDropDownMenu .= '</ul>';

    Read the article

  • How important do you find exception safety to be in your C++ code?

    - by Kai
    Every time I consider making my code strongly exception safe, I justify not doing it because it would be so time consuming. Consider this relatively simple snippet: Level::Entity* entity = new Level::Entity(); entity->id = GetNextId(); entity->AddComponent(new Component::Position(x, y)); entity->AddComponent(new Component::Movement()); entity->AddComponent(new Component::Render()); allEntities.push_back(entity); // std::vector entityById[entity->id] = entity; // std::map return entity; To implement a basic exception guarantee, I could use a scoped pointer on the new calls. This would prevent memory leaks if any of the calls were to throw an exception. However, let's say I want to implement a strong exception guarantee. At the least, I would need to implement a shared pointer for my containers (I'm not using Boost), a nothrow Entity::Swap for adding the components atomically, and some sort of idiom for atomically adding to both the Vector and Map. Not only would these be time consuming to implement, but they would be expensive since it involves a lot more copying than the exception unsafe solution. Ultimately, it feels to me like that time spent doing all of that wouldn't be justified just so that the a simple CreateEntity function is strongly exception safe. I probably just want the game to display an error and close at that point anyway. How far do you take this in your own game projects? Is it generally acceptable to write exception unsafe code for a program that can just crash when there is an exception?

    Read the article

  • ASP.NET MVC 2: Updating a Linq-To-Sql Entity with an EntitySet

    - by Simon
    I have a Linq to Sql Entity which has an EntitySet. In my View I display the Entity with it's properties plus an editable list for the child entites. The user can dynamically add and delete those child entities. The DefaultModelBinder works fine so far, it correctly binds the child entites. Now my problem is that I just can't get Linq To Sql to delete the deleted child entities, it will happily add new ones but not delete the deleted ones. I have enabled cascade deleting in the foreign key relationship, and the Linq To Sql designer added the "DeleteOnNull=true" attribute to the foreign key relationships. If I manually delete a child entity like this: myObject.Childs.Remove(child); context.SubmitChanges(); This will delete the child record from the DB. But I can't get it to work for a model binded object. I tried the following: // this does nothing public ActionResult Update(int id, MyObject obj) // obj now has 4 child entities { var obj2 = _repository.GetObj(id); // obj2 has 6 child entities if(TryUpdateModel(obj2)) //it sucessfully updates obj2 and its childs { _repository.SubmitChanges(); // nothing happens, records stay in DB } else ..... return RedirectToAction("List"); } and this throws an InvalidOperationException, I have a german OS so I'm not exactly sure what the error message is in english, but it says something along the lines of that the entity needs a Version (Timestamp row?) or no update check policies. I have set UpdateCheck="Never" to every column except the primary key column. public ActionResult Update(MyObject obj) { _repository.MyObjectTable.Attach(obj, true); _repository.SubmitChanges(); // never gets here, exception at attach } I've read alot about similar "problems" with Linq To Sql, but it seems most of those "problems" are actually by design. So am I right in my assumption that this doesn't work like I expect it to work? Do I really have to manually iterate through the child entities and delete, update and insert them manually? For such a simple object this may work, but I plan to create more complex objects with nested EntitySets and so on. This is just a test to see what works and what not. So far I'm disappointed with Linq To Sql (maybe I just don't get it). Would be the Entity Framework or NHibernate a better choice for this scenario? Or would I run into the same problem?

    Read the article

  • In NHIbernate, why does SaveOrUpdate() update the Version, but SaveOrUpdateCopy() doesn't?

    - by Daniel T.
    I have a versioned entity, and this is what happens when I use SaveOrUpdate() vs. SaveOrUpdateCopy(): // create new entity var entity = new Entity{ Id = Guid.Empty }); Console.WriteLine(entity.Version); // prints out 0 // save the new entity GetNewSession(); entity.SaveOrUpdate(); Console.WriteLine(entity.Version); // prints out 1 GetNewSession(); // loads the persistent entity into the session, so we have to use // SaveOrUpdateCopy() to merge the following transient entity var dbEntity = Database.GetAll<Entity>(); // new, transient entity used to update the persistent entity in the session var newEntity = new Entity{ Id = Guid.Empty }); newEntity.SaveOrUpdateCopy(); Console.WriteLine(entity.Version); // prints out 1, but should be 2 Why is the version number is not updated for SaveOrUpdateCopy()? As I understand it, the transient entity is merged with the persistent entity. The SQL calls confirm that the data is updated. At this point, shouldn't newEntity become persistent, and the version number incremented?

    Read the article

  • Building a Repository Pattern against an EF 5 EDMX Model - Part 1

    - by Juan
    I am part of a year long plus project that is re-writing an existing application for a client.  We have decided to develop the project using Visual Studio 2012 and .NET 4.5.  The project will be using a number of technologies and patterns to include Entity Framework 5, WCF Services, and WPF for the client UI.This is my attempt at documenting some of the successes and failures that I will be coming across in the development of the application.In building the data access layer we have to access a database that has already been designed by a dedicated dba. The dba insists on using Stored Procedures which has made the use of EF a little more difficult.  He will not allow direct table access but we did manage to get him to allow us to use Views.  Since EF 5 does not have good support to do Code First with Stored Procedures, my option was to create a model (EDMX) against the existing database views.   I then had to go select each entity and map the Insert/Update/Delete functions to their respective stored procedure. The next step after I had completed mapping the stored procedures to the entities in the EDMX model was to figure out how to build a generic repository that would work well with Entity Framework 5.  After reading the blog posts below, I adopted much of their code with some changes to allow for the use of Ninject for dependency injection.http://www.tcscblog.com/2012/06/22/entity-framework-generic-repository/ http://www.tugberkugurlu.com/archive/generic-repository-pattern-entity-framework-asp-net-mvc-and-unit-testing-triangle IRepository.cs public interface IRepository : IDisposable where T : class { void Add(T entity); void Update(T entity, int id); T GetById(object key); IQueryable Query(Expression> predicate); IQueryable GetAll(); int SaveChanges(); int SaveChanges(bool validateEntities); } GenericRepository.cs public abstract class GenericRepository : IRepository where T : class { public abstract void Add(T entity); public abstract void Update(T entity, int id); public abstract T GetById(object key); public abstract IQueryable Query(Expression> predicate); public abstract IQueryable GetAll(); public int SaveChanges() { return SaveChanges(true); } public abstract int SaveChanges(bool validateEntities); public abstract void Dispose(); } One of the issues I ran into was trying to do an update. I kept receiving errors so I posted a question on Stack Overflow http://stackoverflow.com/questions/12585664/an-object-with-the-same-key-already-exists-in-the-objectstatemanager-the-object and came up with the following hack. If someone has a better way, please let me know. DbContextRepository.cs public class DbContextRepository : GenericRepository where T : class { protected DbContext Context; protected DbSet DbSet; public DbContextRepository(DbContext context) { if (context == null) throw new ArgumentException("context"); Context = context; DbSet = Context.Set(); } public override void Add(T entity) { if (entity == null) throw new ArgumentException("Cannot add a null entity."); DbSet.Add(entity); } public override void Update(T entity, int id) { if (entity == null) throw new ArgumentException("Cannot update a null entity."); var entry = Context.Entry(entity); if (entry.State == EntityState.Detached) { var attachedEntity = DbSet.Find(id); // Need to have access to key if (attachedEntity != null) { var attachedEntry = Context.Entry(attachedEntity); attachedEntry.CurrentValues.SetValues(entity); } else { entry.State = EntityState.Modified; // This should attach entity } } } public override T GetById(object key) { return DbSet.Find(key); } public override IQueryable Query(Expression> predicate) { return DbSet.Where(predicate); } public override IQueryable GetAll() { return Context.Set(); } public override int SaveChanges(bool validateEntities) { Context.Configuration.ValidateOnSaveEnabled = validateEntities; return Context.SaveChanges(); } #region IDisposable implementation public override void Dispose() { if (Context != null) { Context.Dispose(); GC.SuppressFinalize(this); } } #endregion IDisposable implementation } At this point I am able to start creating individual repositories that are needed and add a Unit of Work.  Stay tuned for the next installment in my path to creating a Repository Pattern against EF5.

    Read the article

  • HTTP Error: 413 Request Entity Too Large

    - by Torben Gundtofte-Bruun
    What I have: I have an iPhone app that sends HTTP POST requests (XML format) to a web service written in PHP. This is on a hosted virtual private server so I can edit httpd.conf and other files on the server, and restart Apache. The problem: The web service works perfectly as long as the request is not too large, but around 1MB is the limit. After that, the server responds with: <!DOCTYPE HTML PUBLIC "-//IETF//DTD HTML 2.0//EN"> <html><head> <title>413 Request Entity Too Large</title> </head><body> <h1>Request Entity Too Large</h1> The requested resource<br />/<br /> does not allow request data with POST requests, or the amount of data provided in the request exceeds the capacity limit. </body></html> The web service writes its own log file, and I can see that small messages are processed fine. Larger messages are not logged at all so I guess that something in Apache rejects them before they even reach the web service? Things I've tried without success: (I've restarted Apache after every change. These steps are incremental.) hosting provider's web-based configuration panel: disable mod_security httpd.conf: LimitXMLRequestBody 0 and LimitRequestBody 0 httpd.conf: LimitXMLRequestBody 100000000 and LimitRequestBody 100000000 httpd.conf: SecRequestBodyLimit 100000000 At this stage, Apache's error.log contains a message: ModSecurity: Request body no files data length is larger than the configured limit (1048576) It looks like my step #4 didn't really take, which is consistent with step #1 but does not explain why mod_security appears to be active after all. What more can I try, to get the web service to receive large messages?

    Read the article

  • CascadingDropDown jQuery Plugin for ASP.NET MVC

    - by rajbk
    CascadingDropDown is a jQuery plugin that can be used by a select list to get automatic population using AJAX. A sample ASP.NET MVC project is attached at the bottom of this post.   Usage The code below shows two select lists : <select id="customerID" name="customerID"> <option value="ALFKI">Maria Anders</option> <option value="ANATR">Ana Trujillo</option> <option value="ANTON">Antonio Moreno</option> </select>   <select id="orderID" name="orderID"> </select> When a customer is selected in the first select list, the second list will auto populate itself with the following code: $("#orderID").CascadingDropDown("#customerID", '/Sales/AsyncOrders'); Internally, an AJAX post is made to ‘/Sales/AsyncOrders’ with the post body containing  customerID=[selectedCustomerID]. This executes the action AsyncOrders on the SalesController with signature AsyncOrders(string customerID).  The AsyncOrders method returns JSON which is then used to populate the select list. The JSON format expected is shown below : [{ "Text": "John", "Value": "10326" }, { "Text": "Jane", "Value": "10801" }] Details $(targetID).CascadingDropDown(sourceID, url, settings) targetID The ID of the select list that will auto populate.  sourceID The ID of the select list, which, on change, causes the targetID to auto populate. url The url to post to Options promptText Text for the first item in the select list Default : -- Select -- loadingText Optional text to display in the select list while it is being loaded. Default : Loading.. errorText Optional text to display if an error occurs while populating the list Default: Error loading data. postData Data you want posted to the url in place of the default Example : { postData : { customerID : $(‘#custID’), orderID : $(‘#orderID’) }} will cause customerID=ALFKI&orderID=2343 to be sent as the POST body. Default: A text string obtained by calling serialize on the sourceID onLoading (event) Raised before the list is populated. onLoaded (event) Raised after the list is populated, The code below shows how to “animate” the  select list after load. Example using custom options: $("#orderID").CascadingDropDown("#customerID", '/Sales/AsyncOrders', { promptText: '-- Pick an Order--', onLoading: function () { $(this).css("background-color", "#ff3"); }, onLoaded: function () { $(this).animate({ backgroundColor: '#ffffff' }, 300); } }); To return JSON from our action method, we use the Json ActionResult passing in an IEnumerable<SelectListItem>. public ActionResult AsyncOrders(string customerID) { var orders = repository.GetOrders(customerID).ToList().Select(a => new SelectListItem() { Text = a.OrderDate.HasValue ? a.OrderDate.Value.ToString("MM/dd/yyyy") : "[ No Date ]", Value = a.OrderID.ToString(), }); return Json(orders); } Sample Project using VS 2010 RTM NorthwindCascading.zip

    Read the article

  • Creating an ASP.NET report using Visual Studio 2010 - Part 3

    - by rajbk
    We continue building our report in this three part series. Creating an ASP.NET report using Visual Studio 2010 - Part 1 Creating an ASP.NET report using Visual Studio 2010 - Part 2 Adding the ReportViewer control and filter drop downs. Open the source code for index.aspx and add a ScriptManager control. This control is required for the ReportViewer control. Add a DropDownList for the categories and suppliers. Add the ReportViewer control. The markup after these steps is shown below. <div> <asp:ScriptManager ID="smScriptManager" runat="server"> </asp:ScriptManager> <div id="searchFilter"> Filter by: Category : <asp:DropDownList ID="ddlCategories" runat="server" /> and Supplier : <asp:DropDownList ID="ddlSuppliers" runat="server" /> </div> <rsweb:ReportViewer ID="rvProducts" runat="server"> </rsweb:ReportViewer> </div> The design view for index.aspx is shown below. The dropdowns will display the categories and suppliers in the database. Changing the selection in the drop downs will cause the report to be filtered by the selections in the dropdowns. You will see how to do this in the next steps.   Attaching the RDLC to the ReportViewer control by clicking on the top right of the control, going to Report Viewer tasks and selecting Products.rdlc.   Resize the ReportViewer control by dragging at the bottom right corner. I set mine to 800px x 500px. You can also set this value in source view. Defining the data sources. We will now define the Data Source used to populate the report. Go back to the “ReportViewer Tasks” and select “Choose Data Sources” Select a “New data source..” Select “Object” and name your Data Source ID “odsProducts”   In the next screen, choose “ProductRepository” as your business object. Choose “GetProductsProjected” in the next screen.   The method requires a SupplierID and CategoryID. We will set these so that our data source gets the values from the drop down lists we defined earlier. Set the parameter source to be of type “Control” and set the ControlIDs to be ddlSuppliers and ddlCategories respectively. Your screen will look like this: We are now going to define the data source for our drop downs. Select the ddlCategory drop down and pick “Choose Data Source”. Pick “Object” and give it an id “odsCategories”   In the next screen, choose “ProductRepository” Select the GetCategories() method in the next screen.   Select “CategoryName” and “CategoryID” in the next screen. We are done defining the data source for the Category drop down. Perform the same steps for the Suppliers drop down.   Select each dropdown and set the AppendDataBoundItems to true and AutoPostback to true.     The AppendDataBoundItems is needed because we are going to insert an “All“ list item with a value of empty. Go to each drop down and add this list item markup as shown below> Finally, double click on each drop down in the designer and add the following code in the code behind. This along with the “Autopostback= true” attribute refreshes the report anytime a drop down is changed. protected void ddlCategories_SelectedIndexChanged(object sender, EventArgs e) { rvProducts.LocalReport.Refresh(); }   protected void ddlSuppliers_SelectedIndexChanged(object sender, EventArgs e) { rvProducts.LocalReport.Refresh(); } Compile your report and run the page. You should see the report rendered. Note that the tool bar in the ReportViewer control gives you a couple of options including the ability to export the data to Excel, PDF or word.   Conclusion Through this three part series, we did the following: Created a data layer for use by our RDLC. Created an RDLC using the report wizard and define a dataset for the report. Used the report design surface to design our report including adding a chart. Used the ReportViewer control to attach the RDLC. Connected our ReportWiewer to a data source and take parameter values from the drop downlists. Used AutoPostBack to refresh the reports when the dropdown selection was changed. RDLCs allow you to create interactive reports including drill downs and grouping. For even more advanced reports you can use Microsoft® SQL Server™ Reporting Services with RDLs. With RDLs, the report is rendered on the report server instead of the web server. Another nice thing about RDLs is that you can define a parameter list for the report and it gets rendered automatically for you. RDLCs and RDLs both have their advantages and its best to compare them and choose the right one for your requirements. Download VS2010 RTM Sample project NorthwindReports.zip   Alfred Borden: Are you watching closely?

    Read the article

  • Creating an ASP.NET report using Visual Studio 2010 - Part 2

    - by rajbk
    We continue building our report in this three part series. Creating an ASP.NET report using Visual Studio 2010 - Part 1 Creating an ASP.NET report using Visual Studio 2010 - Part 3 Creating the Client Report Definition file (RDLC) Add a folder called “RDLC”. This will hold our RDLC report.   Right click on the RDLC folder, select “Add new item..” and add an “RDLC” name of “Products”. We will use the “Report Wizard” to walk us through the steps of creating the RDLC.   In the next dialog, give the dataset a name called “ProductDataSet”. Change the data source to “NorthwindReports.DAL” and select “ProductRepository(GetProductsProjected)”. The fields that are returned from the method are shown on the right. Click next.   Drag and drop the ProductName, CategoryName, UnitPrice and Discontinued into the Values container. Note that you can create much more complex grouping using this UI. Click Next.   Most of the selections on this screen are grayed out because we did not choose a grouping in the previous screen. Click next. Choose a style for your report. Click next. The report graphic design surface is now visible. Right click on the report and add a page header and page footer. With the report design surface active, drag and drop a TextBox from the tool box to the page header. Drag one more textbox to the page header. We will use the text boxes to add some header text as shown in the next figure. You can change the font size and other properties of the textboxes using the formatting tool bar (marked in red). You can also resize the columns by moving your cursor in between columns and dragging. Adding Expressions Add two more text boxes to the page footer. We will use these to add the time the report was generated and page numbers. Right click on the first textbox in the page footer and select “Expression”. Add the following expression for the print date (note the = sign at the left of the expression in the dialog below) "© Northwind Traders " & Format(Now(),"MM/dd/yyyy hh:mm tt") Right click on the second text box and add the following for the page count.   Globals.PageNumber & " of " & Globals.TotalPages Formatting the page footer is complete.   We are now going to format the “Unit Price” column so it displays the number in currency format.  Right click on the [UnitPrice] column (not header) and select “Text Box Properties..” Under “Number”, select “Currency”. Hit OK. Adding a chart With the design surface active, go to the toolbox and drag and drop a chart control. You will need to move the product list table down first to make space for the chart contorl. The document can also be resized by dragging on the corner or at the page header/footer separator. In the next dialog, pick the first chart type. This can be changed later if needed. Click OK. The chart gets added to the design surface.   Click on the blue bars in the chart (not legend). This will bring up drop locations for dropping the fields. Drag and drop the UnitPrice and CategoryName into the top (y axis) and bottom (x axis) as shown below. This will give us the total unit prices for a given category. That is the best I could come up with as far as what report to render, sorry :-) Delete the legend area to get more screen estate. Resize the chart to your liking. Change the header, x axis and y axis text by double clicking on those areas. We made it this far. Let’s impress the client by adding a gradient to the bar graph :-) Right click on the blue bar and select “Series properties”. Under “Fill”, add a color and secondary color and select the Gradient style. We are done designing our report. In the next section you will see how to add the report to the report viewer control, bind to the data and make it refresh when the filter criteria are changed.   Creating an ASP.NET report using Visual Studio 2010 - Part 3

    Read the article

  • Daily tech links for .net and related technologies - Apr 5-7, 2010

    - by SanjeevAgarwal
    Daily tech links for .net and related technologies - Apr 5-7, 2010 Web Development HTML 5 is Born Old - Quake in HTML 5 Example Image Preview in ASP.NET MVC - Imran Advanced ASP.NET MVC 2 - Brad Wilson How to Serialize/Deserialize Complex XML in ASP.Net / C# - Impact Works Ban HTML comments from your pages and views - Bertrand Le Roy Measuring ASP.NET and SharePoint output cache - Gunnar Peipman Web Design Eye Candy vs. Bare-Bones in UI Design - Max Steenbergen Empathizing Color Psychology in Web...(read more)

    Read the article

  • Daily tech links for .net and related technologies - Mar 26-28, 2010

    - by SanjeevAgarwal
    Daily tech links for .net and related technologies - Mar 26-28, 2010 Web Development Creating Rich View Components in ASP.NET MVC - manzurrashid Diagnosing ASP.NET MVC Problems - Brad Wilson Templated Helpers & Custom Model Binders in ASP.NET MVC 2 - gshackles The jQuery Templating Plugin and Why You Should Be Excited! - Chris Love Web Deployment Made Awesome: If You're Using XCopy, You're Doing It Wrong - Scott Hansleman Dynamic User Specific CSS Selection at Run Time - Misfit Geek Sending email...(read more)

    Read the article

  • Daily tech links for .net and related technologies - Mar 18-21, 2010

    - by SanjeevAgarwal
    Daily tech links for .net and related technologies - Mar 18-21, 2010 Web Development TDD kata for ASP.NET MVC controllers (part 2) -David Take Control Of Web Control ClientID Values in ASP.NET 4.0 - Scott Mitchell Inside the ASP.NET MVC Controller Factory - Dino Esposito Microsoft, jQuery, and Templating - stephen walther Cross Domain AJAX Request with YQL and jQuery - Jeffrey Way T4MVC Add-In to auto run template -Wayne Web Design Website Content Planning The Right Way - Kristin Wemmer Microsoft...(read more)

    Read the article

  • HUGE EF4 Inheritance Bug

    - by djsolid
    Well maybe not for everyone but for me is definitely really important. That is why I get straight into the point. We have the following model: Which maps to the following database: We are using EF4.0 and we want to load all Burgers including BurgerDetails. So we write the following query: But it fails. The error is : “The ResultType of the specified expression is not compatible with the required type. The expression ResultType is 'Transient.reference[SampleEFDBModel.Food]' but the required type is 'Transient.reference[SampleEFDBModel.Burger]'.Parameter name: arguments[0]”   So in the new version of EF there is no way to eager load data through Navigation Properties with 1-1 relationships defined in subclasses. Here is the relevant Microsoft Connect Issue. It is described through an other example but the result is the same.  Please if you think this is important vote up on Microsoft Connect.   EF 4.0 has many improvements. I am using it since v1 in large-scale projects and this version is faster,produces cleaner sql, more reliable and can be used for complicated business scenarios. That is why I believe this issue should be solved as soon as possible. I understand that release cycles are slow but I am hoping atleast for a hotfix. I also have uploaded the example project so you can test it. Download it from here. If anyone has found any workarounds please post it in the comments section. Thanks!

    Read the article

  • ORM Profiler v1.1 has been released!

    - by FransBouma
    We've released ORM Profiler v1.1, which has the following new features: Real time profiling A real time viewer (RTV) has been added, which gives insight in the activity as it is received by the client, in two views: a chronological connection overview and an activity graph overview. This RTV allows the user to directly record to a snapshot using record buttons, pause the view, mark a range to create a snapshot from that range, and view graphs about the # of connection open actions and # of commands per second. The RTV has a 'range' in which it keeps live data and auto-cleans data that's older than this range. Screenshot of the activity graphs part of the real-time viewer: Low-level activity tab A new tab has been added to the Application tabs: the Low-level activity tab. This tab shows the main activity as it has been received over the named pipe. It can help to get insight in the chronological activity without the grouping over connections, so multiple connections at the same time per thread are easier to spot. Clicking a command will sync the rest of the application tabs, clicking a row will show the details below the splitter bar, as it is done with the other application tabs as well. Default application name in interceptor When an empty string or null is passed for application name to the Initialize method of the interceptor, the AppDomain's friendly name is used instead. Copy call stack to clipboard A call stack viewed in a grid in various parts of the UI is now copyable to the clipboard by clicking a button. Enable/Disable interceptor from the config file It's now possible to enable/disable the interceptor Initialization from the application's config file, using: Code: <appSettings> <add key="ORMProfilerEnabled" value="true"/> </appSettings> if value is true, the interceptor's Initialize method will proceed. If the value is false, the interceptor's Initialize method will not proceed and initialization won't be performed, meaning no interception will take place. If the setting is absent, or misconfigured, the Initialize method will proceed as normal and perform the initialization. Stored procedure calls for select databases are now properly displayed as a call For the databases: SQL Server, Oracle, DB2, Sybase ASA, Sybase ASE and Informix a stored procedure call is displayed as an execute/call statement and copy to clipboard works as-is. I'm especially happy with the new real-time profiling feature in ORM Profiler, which is the flagship feature for this release: it offers a completely new way to use the profiler, namely directly during debugging: you can immediately see what's going on without the necessity of a snapshot. The activity graph feature combined with the auto-cleanup of older data, allows you to keep the profiler open for a long period of time and see any spike of activity on the profiled application.

    Read the article

  • Daily tech links for .net and related technologies - June 1-3, 2010

    - by SanjeevAgarwal
    Daily tech links for .net and related technologies - June 1-3, 2010 Web Development Anti-Forgery Request Recipes For ASP.NET MVC And AJAX - Dixin ASP.NET MVC 2 Localization Complete Guide - Alex Adamyan Dynamically Structured ViewModels in ASP.NET MVC - Keith Brown ASP.NET MVC Time Planner is available at CodePlex - Gunnar Peipman Part 2 – A Cascading Hierarchical Field Template & Filter for Dynamic Data - Steve SharePoint Server 2010 Enterprise Content Management Resources - Andrew Connell Web...(read more)

    Read the article

  • Nesting Linq-to-Objects query within Linq-to-Entities query –what is happening under the covers?

    - by carewithl
    var numbers = new int[] { 1, 2, 3, 4, 5 }; var contacts = from c in context.Contacts where c.ContactID == numbers.Max() | c.ContactID == numbers.FirstOrDefault() select c; foreach (var item in contacts) Console.WriteLine(item.ContactID); Linq-to-Entities query is first translated into Linq expression tree, which is then converted by Object Services into command tree. And if Linq-to-Entities query nests Linq-to-Objects query, then this nested query also gets translated into an expression tree. a) I assume none of the operators of the nested Linq-to-Objects query actually get executed, but instead data provider for particular DB (or perhaps Object Services) knows how to transform the logic of Linq-to-Objects operators into appropriate SQL statements? b) Data provider knows how to create equivalent SQL statements only for some of the Linq-to-Objects operators? c) Similarly, data provider knows how to create equivalent SQL statements only for some of the non-Linq methods in the Net Framework class library? EDIT: I know only some Sql so I can't be completely sure, but reading Sql query generated for the above code it seems data provider didn't actually execute numbers.Max method, but instead just somehow figured out that numbers.Max should return the maximum value and then proceed to include in generated Sql query a call to TSQL's build-in MAX function. It also put all the values held by numbers array into a Sql query. SELECT CASE WHEN (([Project1].[C1] = 1) AND ([Project1].[C1] IS NOT NULL)) THEN '0X0X' ELSE '0X1X' END AS [C1], [Extent1].[ContactID] AS [ContactID], [Extent1].[FirstName] AS [FirstName], [Extent1].[LastName] AS [LastName], [Extent1].[Title] AS [Title], [Extent1].[AddDate] AS [AddDate], [Extent1].[ModifiedDate] AS [ModifiedDate], [Extent1].[RowVersion] AS [RowVersion], CASE WHEN (([Project1].[C1] = 1) AND ([Project1].[C1] IS NOT NULL)) THEN [Project1].[CustomerTypeID] END AS [C2], CASE WHEN (([Project1].[C1] = 1) AND ([Project1].[C1] IS NOT NULL)) THEN [Project1].[InitialDate] END AS [C3], CASE WHEN (([Project1].[C1] = 1) AND ([Project1].[C1] IS NOT NULL)) THEN [Project1].[PrimaryDesintation] END AS [C4], CASE WHEN (([Project1].[C1] = 1) AND ([Project1].[C1] IS NOT NULL)) THEN [Project1].[SecondaryDestination] END AS [C5], CASE WHEN (([Project1].[C1] = 1) AND ([Project1].[C1] IS NOT NULL)) THEN [Project1].[PrimaryActivity] END AS [C6], CASE WHEN (([Project1].[C1] = 1) AND ([Project1].[C1] IS NOT NULL)) THEN [Project1].[SecondaryActivity] END AS [C7], CASE WHEN (([Project1].[C1] = 1) AND ([Project1].[C1] IS NOT NULL)) THEN [Project1].[Notes] END AS [C8], CASE WHEN (([Project1].[C1] = 1) AND ([Project1].[C1] IS NOT NULL)) THEN [Project1].[RowVersion] END AS [C9], CASE WHEN (([Project1].[C1] = 1) AND ([Project1].[C1] IS NOT NULL)) THEN [Project1].[BirthDate] END AS [C10], CASE WHEN (([Project1].[C1] = 1) AND ([Project1].[C1] IS NOT NULL)) THEN [Project1].[HeightInches] END AS [C11], CASE WHEN (([Project1].[C1] = 1) AND ([Project1].[C1] IS NOT NULL)) THEN [Project1].[WeightPounds] END AS [C12], CASE WHEN (([Project1].[C1] = 1) AND ([Project1].[C1] IS NOT NULL)) THEN [Project1].[DietaryRestrictions] END AS [C13] FROM [dbo].[Contact] AS [Extent1] LEFT OUTER JOIN (SELECT [Extent2].[ContactID] AS [ContactID], [Extent2].[BirthDate] AS [BirthDate], [Extent2].[HeightInches] AS [HeightInches], [Extent2].[WeightPounds] AS [WeightPounds], [Extent2].[DietaryRestrictions] AS [DietaryRestrictions], [Extent3].[CustomerTypeID] AS [CustomerTypeID], [Extent3].[InitialDate] AS [InitialDate], [Extent3].[PrimaryDesintation] AS [PrimaryDesintation], [Extent3].[SecondaryDestination] AS [SecondaryDestination], [Extent3].[PrimaryActivity] AS [PrimaryActivity], [Extent3].[SecondaryActivity] AS [SecondaryActivity], [Extent3].[Notes] AS [Notes], [Extent3].[RowVersion] AS [RowVersion], cast(1 as bit) AS [C1] FROM [dbo].[ContactPersonalInfo] AS [Extent2] INNER JOIN [dbo].[Customers] AS [Extent3] ON [Extent2].[ContactID] = [Extent3].[ContactID]) AS [Project1] ON [Extent1].[ContactID] = [Project1].[ContactID] LEFT OUTER JOIN (SELECT TOP (1) [c].[C1] AS [C1] FROM (SELECT [UnionAll3].[C1] AS [C1] FROM (SELECT [UnionAll2].[C1] AS [C1] FROM (SELECT [UnionAll1].[C1] AS [C1] FROM (SELECT 1 AS [C1] FROM (SELECT 1 AS X) AS [SingleRowTable1] UNION ALL SELECT 2 AS [C1] FROM (SELECT 1 AS X) AS [SingleRowTable2]) AS [UnionAll1] UNION ALL SELECT 3 AS [C1] FROM (SELECT 1 AS X) AS [SingleRowTable3]) AS [UnionAll2] UNION ALL SELECT 4 AS [C1] FROM (SELECT 1 AS X) AS [SingleRowTable4]) AS [UnionAll3] UNION ALL SELECT 5 AS [C1] FROM (SELECT 1 AS X) AS [SingleRowTable5]) AS [c]) AS [Limit1] ON 1 = 1 LEFT OUTER JOIN (SELECT TOP (1) [c].[C1] AS [C1] FROM (SELECT [UnionAll7].[C1] AS [C1] FROM (SELECT [UnionAll6].[C1] AS [C1] FROM (SELECT [UnionAll5].[C1] AS [C1] FROM (SELECT 1 AS [C1] FROM (SELECT 1 AS X) AS [SingleRowTable6] UNION ALL SELECT 2 AS [C1] FROM (SELECT 1 AS X) AS [SingleRowTable7]) AS [UnionAll5] UNION ALL SELECT 3 AS [C1] FROM (SELECT 1 AS X) AS [SingleRowTable8]) AS [UnionAll6] UNION ALL SELECT 4 AS [C1] FROM (SELECT 1 AS X) AS [SingleRowTable9]) AS [UnionAll7] UNION ALL SELECT 5 AS [C1] FROM (SELECT 1 AS X) AS [SingleRowTable10]) AS [c]) AS [Limit2] ON 1 = 1 CROSS JOIN (SELECT MAX([UnionAll12].[C1]) AS [A1] FROM (SELECT [UnionAll11].[C1] AS [C1] FROM (SELECT [UnionAll10].[C1] AS [C1] FROM (SELECT [UnionAll9].[C1] AS [C1] FROM (SELECT 1 AS [C1] FROM (SELECT 1 AS X) AS [SingleRowTable11] UNION ALL SELECT 2 AS [C1] FROM (SELECT 1 AS X) AS [SingleRowTable12]) AS [UnionAll9] UNION ALL SELECT 3 AS [C1] FROM (SELECT 1 AS X) AS [SingleRowTable13]) AS [UnionAll10] UNION ALL SELECT 4 AS [C1] FROM (SELECT 1 AS X) AS [SingleRowTable14]) AS [UnionAll11] UNION ALL SELECT 5 AS [C1] FROM (SELECT 1 AS X) AS [SingleRowTable15]) AS [UnionAll12]) AS [GroupBy1] WHERE [Extent1].[ContactID] IN ([GroupBy1].[A1], (CASE WHEN ([Limit1].[C1] IS NULL) THEN 0 ELSE [Limit2].[C1] END)) Based on this, is it possible that Linq2Entities provider indeed doesn't execute non-Linq and Linq-to-Object methods, but instead creates equivalent SQL statements for some of them ( and for others it throws an exception )? Thank you in advance

    Read the article

< Previous Page | 48 49 50 51 52 53 54 55 56 57 58 59  | Next Page >