Search Results

Search found 13797 results on 552 pages for 'browser madness'.

Page 523/552 | < Previous Page | 519 520 521 522 523 524 525 526 527 528 529 530  | Next Page >

  • How do I update with a newly-created detached entity using NHibernate?

    - by Daniel T.
    Explanation: Let's say I have an object graph that's nested several levels deep and each entity has a bi-directional relationship with each other. A -> B -> C -> D -> E Or in other words, A has a collection of B and B has a reference back to A, and B has a collection of C and C has a reference back to B, etc... Now let's say I want to edit some data for an instance ofC. In Winforms, I would use something like this: var instanceOfC; using (var session = SessionFactory.OpenSession()) { // get the instance of C with Id = 3 instanceOfC = session.Linq<C>().Where(x => x.Id == 3); } SendToUIAndLetUserUpdateData(instanceOfC); using (var session = SessionFactory.OpenSession()) { // re-attach the detached entity and update it session.Update(instanceOfC); } In plain English, we grab a persistent instance out of the database, detach it, give it to the UI layer for editing, then re-attach it and save it back to the database. Problem: This works fine for Winform applications because we're using the same entity all throughout, the only difference being that it goes from persistent to detached to persistent again. The problem occurs when I'm using a web service and a browser, sending over JSON data. In this case, the data that comes back is no longer a detached entity, but rather a transient one that just happens to have the same ID as the persistent one. If I use this entity to update, it will wipe out the relationship to B and D unless I sent the entire object graph over to the UI and got it back in one piece. Question: My question is, how do I serialize detached entities over the web, receive them back, and save them, while preserving any relationships that I didn't explicitly change? I know about ISession.SaveOrUpdateCopy and ISession.Merge() (they seem to do the same thing?), but this will still wipe out the relationships if I don't explicitly set them. I could copy the fields from the transient entity to the persistent entity one by one, but this doesn't work too well when it comes to relationships and I'd have to handle version comparisons manually.

    Read the article

  • How do I pass the value of the previous form element into an "onchange" javascript function?

    - by Jen
    Hello, I want to make some UI improvements to a page I am developing. Specifically, I need to add another drop down menu to allow the user to filter results. This is my current code: HTML file: <select name="test_id" onchange="showGrid(this.name, this.value, 'gettestgrid')"> <option selected>Select a test--></option> <option value=1>Test 1</option> <option value=2>Test 2</option> <option value=3>Test 3</option> </select> This is pseudo code for what I want to happen: <select name="test_id"> <option selected>Select a test--></option> <option value=1>Test 1</option> <option value=2>Test 2</option> <option value=3>Test 3</option> </select> <select name="statistics" onchange="showGrid(PREVIOUS.name, PREVIOUS.VALUE, THIS.value)"> <option selected>Select a data display --></option> <option value='gettestgrid'>Show averages by student</option> <option value='gethomeroomgrid'>Show averages by homeroom</option> <option value='getschoolgrid'>Show averages by school</option> </select> How do I access the previous field's name and value? Any help much appreciated, thx! Also, JS function for reference: function showGrid(name, value, phpfile) { xmlhttp=GetXmlHttpObject(); if (xmlhttp==null) { alert ("Browser does not support HTTP Request"); return; } var url=phpfile+".php"; url=url+"?"+name+"="+value; url=url+"&sid="+Math.random(); xmlhttp.onreadystatechange=stateChanged; xmlhttp.open("GET",url,true); xmlhttp.send(null); }

    Read the article

  • error with redirect using listener JSF 2.0

    - by Ray
    I have a index.xhtml page <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml" xmlns:h="http://java.sun.com/jsf/html" xmlns:f="http://java.sun.com/jsf/core" xmlns:ui="http://java.sun.com/jsf/facelets"> <f:view> <ui:insert name="metadata" /> <f:event type="preRenderView" listener="#{item.show}" /> <h:body></h:body> </f:view> </html> And in bean class with scope session this method public void show() throws IOException, DAOException { ExternalContext externalContext = FacesContext.getCurrentInstance() .getExternalContext(); //smth String rootPath = externalContext.getRealPath("/"); String realPath = rootPath + "pages\\template\\body\\list.xhtml"; externalContext.redirect(realPath); } i think that I should redirect to next page but I have "browser can't show page" and list.xhtml (if I do this page as welcome-page I haven't error, it means that error connected with redirect) <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml" xmlns:h="http://java.sun.com/jsf/html" xmlns:f="http://java.sun.com/jsf/core" xmlns:ui="http://java.sun.com/jsf/facelets"> <h:body> <ui:composition template="/pages/layouts/mainLayout.xhtml"> <ui:define name="content"> <h:form></h:form></ui:define></ui:composition> </h:body> </html> in consol i didn't have any error. in web.xml <welcome-file-list> <welcome-file>index.xhtml</welcome-file> </welcome-file-list> <servlet> <servlet-name>Faces Servlet</servlet-name> <servlet-class>javax.faces.webapp.FacesServlet</servlet-class> <load-on-startup>1</load-on-startup> </servlet> <servlet-mapping> <servlet-name>Faces Servlet</servlet-name> <url-pattern>*.xhtml</url-pattern> </servlet-mapping> What can be the reason this problem?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Just a small problem regarding javscript BOM question

    - by caramel1991
    The question is this: Create a page with a number of links. Then write code that fires on the window onload event, displaying the href of each of the links on the page. And this is my solution <html> <body language="Javascript" onload="displayLink()"> <a href="http://www.google.com/">First link</a> <a href="http://www.yahoo.com/">Second link</a> <a href="http://www.msn.com/">Third link</a> <script type="text/javascript" language="Javascript"> function displayLink() { for(var i = 0;document.links[i];i++) { alert(document.links[i].href); } } </script> </body> </html> This is the answer provided by the book <html> <head> <script language=”JavaScript” type=”text/javascript”> function displayLinks() { var linksCounter; for (linksCounter = 0; linksCounter < document.links.length; linksCounter++) { alert(document.links[linksCounter].href); } } </script> </head> <body onload=”displayLinks()”> <A href=”link0.htm” >Link 0</A> <A href=”link1.htm”>Link 2</A> <A href=”link2.htm”>Link 2</A> </body> </html> Before I get into the javascript tutorial on how to check user browser version or model,I was using the same method as the example,by acessing the length property of the links array for the loop,but after I read through the tutorial,I find out that I can also use this alternative ways,by using the method that the test condition will evalute to true only if the document.links[i] return a valid value,so does my code is written using the valid method??If it's not,any comment regarding how to write a better code??Correct me if I'm wrong,I heard some of the people say "a good code is not evaluate solely on whether it works or not,but in terms of speed,the ability to comprehend the code,and could posssibly let others to understand the code easily".Is is true??

    Read the article

  • If we don't like it for the presentation layer, then why do we tolerate it for the behavior layer?

    - by greim
    Suppose CSS as we know it had never been invented, and the closest we could get was to do this: <script> // this is the page's stylesheet $(document).ready(function(){ $('.error').css({'color':'red'}); $('a[href]').css({'textDecoration':'none'}); ... }); </script> If this was how we were forced to write code, would we put up with it? Or would every developer on Earth scream at browser vendors until they standardized upon CSS, or at least some kind of declarative style language? Maybe CSS isn't perfect, but hopefully it's obvious how it's better than the find things, do stuff method shown above. So my question is this. We've seen and tasted of the glory of declarative binding with CSS, so why, when it comes to the behavioral/interactive layer, does the entire JavaScript community seem complacent about continuing to use the kludgy procedural method described above? Why for example is this considered by many to be the best possible way to do things: <script> $(document).ready(function(){ $('.widget').append("<a class='button' href='#'>...</div>"); $('a[href]').click(function(){...}); ... }); </script> Why isn't there a massive push to get XBL2.0 or .htc files or some kind of declarative behavior syntax implemented in a standard way across browsers? Is this recognized as a need by other web development professionals? Is there anything on the horizon for HTML5? (Caveats, disclaimers, etc: I realize that it's not a perfect world and that we're playing the hand we've been dealt. My point isn't to criticize the current way of doing things so much as to criticize the complacency that exists about the current way of doing things. Secondly, event delegation, especially at the root level, is a step closer to having a declarative behavior layer. It solves a subset of the problem, but it can't create UI elements, so the overall problem remains.)

    Read the article

  • Rails 3 Atom Feed

    - by scud bomb
    Trying to create an atom feed in Rails 3. When i refresh my browser i see basic XML, not the Atom feed im looking for. class PostsController < ApplicationController # GET /posts # GET /posts.xml def index @posts = Post.all respond_to do |format| format.html # index.html.erb format.xml { render :xml => @posts } format.atom end end index.atom.builder atom_feed do |feed| feed.title "twoconsortium feed" @posts.each do |post| feed.entry(post) do |entry| entry.title post.title entry.content post.text end end end localhost:3000/posts.atom looks like this: <?xml version="1.0" encoding="UTF-8"?> <feed xml:lang="en-US" xmlns="http://www.w3.org/2005/Atom"> <id>tag:localhost,2005:/posts</id> <link rel="alternate" type="text/html" href="http://localhost:3000"/> <link rel="self" type="application/atom+xml" href="http://localhost:3000/posts.atom"/> <title>my feed</title> <entry> <id>tag:localhost,2005:Post/1</id> <published>2012-03-27T18:26:13Z</published> <updated>2012-03-27T18:26:13Z</updated> <link rel="alternate" type="text/html" href="http://localhost:3000/posts/1"/> <title>First post</title> <content>good stuff</content> </entry> <entry> <id>tag:localhost,2005:Post/2</id> <published>2012-03-27T19:51:18Z</published> <updated>2012-03-27T19:51:18Z</updated> <link rel="alternate" type="text/html" href="http://localhost:3000/posts/2"/> <title>Second post</title> <content>its that second post type stuff</content> </entry> </feed>

    Read the article

  • Simple html page using Bootstrap

    - by Athashri
    I am writing a simple HTML page using the Twitter Bootstrap. But the navbar and links are rendered as normal HTML on the browser. I have referred to multiple sites but the same steps are given everywhere. I am not sure where I am going wrong. Code: <!DOCTYPE HTML> <html> <head> <meta charset="utf-8"> <link rel= "stylesheet" href= "css/bootstrap.css" type="text/css"> <title> Bootstrap example</title> </head> <body> <script src="https://ajax.googleapis.com/ajax/libs/jquery/1.11.0/jquery.min.js"></script> <script src="js/bootstrap.js"></script> <h1>Hello, world!</h1> <div class ="container"> <h1><a href="#">Bootstrap Site</a></h1> <div class="navbar"> <div class="navbar-inner"> <div class="container"> <ul class="nav"> <li class="active"><a href="#">Home</a></li> <li><a href="#">Projects</a></li> <li><a href="#">Services</a></li> <li><a href="#">Downloads</a></li> <li><a href="#">About</a></li> <li><a href="#">Contact</a></li> </ul> </div> </div> </div> </div> </body> </html>

    Read the article

  • Trouble passing a string as a SQLite ExecSQL command

    - by Hackbrew
    I keep getting the ERROR: near "PassWord": syntax error when trying to execute the ExecSQL() statement. The command looks good in the output of the text file. In fact, I copied & pasted the command directly into SQLite Database Browser and the commend executed properly. Here's the code that's producing the error: procedure TForm1.Button1Click(Sender: TObject); var i, iFieldSize: integer; sFieldName, sFieldType, sFieldList, sExecSQL: String; names: TStringList; f1: Textfile; begin //Open Source table - Table1 has 8 fields but has only two different field types ftString and Boolean Table1.TableName:= 'PWFile'; Table1.Open; //FDConnection1.ExecSQL('drop table PWFile'); sFieldList := ''; names := TStringList.Create; for i := 0 to Table1.FieldCount - 1 do begin sFieldName := Table1.FieldDefList.FieldDefs[i].Name; sFieldType := GetEnumName(TypeInfo(TFieldType),ord(Table1.FieldDefList.FieldDefs[i].DataType)); iFieldSize := Table1.FieldDefList.FieldDefs[i].Size; if sFieldType = 'ftString' then sFieldType := 'NVARCHAR' + '(' + IntToStr(iFieldSize) + ')'; if sFieldType = 'ftBoolean' then sFieldType := 'INTEGER'; names.Add(sFieldName + ' ' + sFieldType); if sFieldList = '' then sFieldList := sFieldName + ' ' + sFieldType else sFieldList := sFieldList + ', ' + sFieldName + ' ' + sFieldType; end; ListBox1.Items.Add(sFieldList); sExecSQL := 'create table IF NOT EXISTS PWFile (' + sFieldList + ')'; // 08/18/2014 - Entered this to log the SQLite FDConnection1.ExecSQL Command to a file AssignFile(f1, 'C:\Users\Test User\Documents\SQLite_Command.txt'); Rewrite(f1); Writeln(f1, sExecSQL); { insert code here that would require a Flush before closing the file } Flush(f1); { ensures that the text was actually written to file } CloseFile(f1); FDConnection1.ExecSQL(sFieldList); Table1.Close; end; Here's the actual command that gets executed: create table IF NOT EXISTS PWFile (PassWord NVARCHAR(10), PassName NVARCHAR(10), Dept NVARCHAR(10), Active NVARCHAR(1), Admin INTEGER, Shred INTEGER, Reports INTEGER, Maintain INTEGER)

    Read the article

  • Exception showing a erroneous web page in a WPF frame

    - by H4mm3rHead
    I have a small application where i need to navigate to an url, I use this method to get the Frame: public override System.Windows.UIElement GetPage(System.Windows.UIElement container) { XmlDocument doc = new XmlDocument(); doc.Load(Location); string webSiteUrl = doc.SelectSingleNode("website").InnerText; Frame newFrame = new Frame(); if (!webSiteUrl.StartsWith("http://")) { webSiteUrl = "http://" + webSiteUrl; } newFrame.Source = new Uri(webSiteUrl); return newFrame; } My problem is now that the page im trying to show generates a error (or so i think), when i load the page in a browser it never fully loads, keeps saying "loading1 element" in the load bar and the green progress line (IE 8) keeps showing. When i attach my debugger i get this error: System.ArgumentException was unhandled Message="Parameter and value pair is not valid. Expected form is parameter=value." Source="WindowsBase" StackTrace: at MS.Internal.ContentType.ParseParameterAndValue(String parameterAndValue) at MS.Internal.ContentType..ctor(String contentType) at MS.Internal.WpfWebRequestHelper.GetContentType(WebResponse response) at System.Windows.Navigation.NavigationService.GetObjectFromResponse(WebRequest request, WebResponse response, Uri destinationUri, Object navState) at System.Windows.Navigation.NavigationService.HandleWebResponse(IAsyncResult ar) at System.Windows.Navigation.NavigationService.<>c__DisplayClassc.<HandleWebResponseOnRightDispatcher>b__8(Object unused) at System.Windows.Threading.ExceptionWrapper.InternalRealCall(Delegate callback, Object args, Boolean isSingleParameter) at System.Windows.Threading.ExceptionWrapper.TryCatchWhen(Object source, Delegate callback, Object args, Boolean isSingleParameter, Delegate catchHandler) at System.Windows.Threading.DispatcherOperation.InvokeImpl() at System.Threading.ExecutionContext.runTryCode(Object userData) at System.Runtime.CompilerServices.RuntimeHelpers.ExecuteCodeWithGuaranteedCleanup(TryCode code, CleanupCode backoutCode, Object userData) at System.Threading.ExecutionContext.Run(ExecutionContext executionContext, ContextCallback callback, Object state) at System.Windows.Threading.DispatcherOperation.Invoke() at System.Windows.Threading.Dispatcher.ProcessQueue() at System.Windows.Threading.Dispatcher.WndProcHook(IntPtr hwnd, Int32 msg, IntPtr wParam, IntPtr lParam, Boolean& handled) at MS.Win32.HwndWrapper.WndProc(IntPtr hwnd, Int32 msg, IntPtr wParam, IntPtr lParam, Boolean& handled) at MS.Win32.HwndSubclass.DispatcherCallbackOperation(Object o) at System.Windows.Threading.ExceptionWrapper.InternalRealCall(Delegate callback, Object args, Boolean isSingleParameter) at System.Windows.Threading.ExceptionWrapper.TryCatchWhen(Object source, Delegate callback, Object args, Boolean isSingleParameter, Delegate catchHandler) ved System.Windows.Threading.Dispatcher.InvokeImpl(DispatcherPriority priority, TimeSpan timeout, Delegate method, Object args, Boolean isSingleParameter) at MS.Win32.HwndSubclass.SubclassWndProc(IntPtr hwnd, Int32 msg, IntPtr wParam, IntPtr lParam) at MS.Win32.UnsafeNativeMethods.DispatchMessage(MSG& msg) at System.Windows.Threading.Dispatcher.TranslateAndDispatchMessage(MSG& msg) at System.Windows.Threading.Dispatcher.PushFrameImpl(DispatcherFrame frame) at System.Windows.Application.RunInternal(Window window) at GreenWebPlayerWPF.App.Main() i C:\Development\Hvarregaard\GWDS\GreenWeb\GreenWebPlayerWPF\obj\Debug\App.g.cs:linje 0 at System.AppDomain._nExecuteAssembly(Assembly assembly, String[] args) at Microsoft.VisualStudio.HostingProcess.HostProc.RunUsersAssembly() at System.Threading.ExecutionContext.Run(ExecutionContext executionContext, ContextCallback callback, Object state) at System.Threading.ThreadHelper.ThreadStart() InnerException: Anyone? Or any way to capture it and respond to it, tried a try/catch around my code, but its not caught - seems something deep inside the guts of the CLR is failing.

    Read the article

  • JQuery $.ajax doesn't return anything, but only in Google Chrome!?

    - by Shawson
    Hi All, I'm hoping someone can help me with this as I'm at a loss. I'm trying to simply load a plain text file into a page at runtime using jquery- everything works fine in IE8 (8.0.7600.16385), Firefox 3.6.3, however in Google Chrome 5.0.375.55 the "data" comes back as nothing- i get an empty alert box. This is the code i'm using; <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <title>Animation Test</title> <script type="text/javascript" language="javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script> <script type="text/javascript" language="javascript"> $(document).ready(function () { $.ajax({ url: 'level1.txt', success: function (data) { alert(data); }, async: true, type: 'GET' }); }); </script> </head> <body> <canvas id="canvas" width="640" height="480"> Unsupported Browser </canvas> </body> </html> The file I'm loading in is a plain text file containing this; Central Cavern 100 O.........1.C....C...........1.O O................1.............O O..............................O O..............................O O......................B1..B...O O=============~~~~=~~~~========O O.............................1O O===...........................O O............A..OOO.B..........O O====...<<<<<<<<<<<<<<<<<<<<...O O............................==O O..............................O O..........B........OOO.....===O O....===============...........O O%............................XO O==============================O (Yes- it's the first level from Manic Miner! I'm making a javascript version using the html5 canvas to get my head around using it.) I'm at a total loss- it can't be the code because it runs in the other 2 browsers- is there an issue with jquery and this version of Chrome? Thanks for reading!! Shaw.

    Read the article

  • How to Fix my jQuery code in IE?? Works in Firefox..

    - by scott jarvis
    I am using jQuery to show/hide a div container (#pluginOptionsContainer), and load a page (./plugin_options.php) inside it with the required POST vars sent. What POST data is sent is based on the value of a select list (#pluginDD) and the click of a button (#pluginOptionsBtn)... It works fine in Firefox, but doesn't work in IE.. The '$("#pluginOptionsContainer").load()' request never seems to finish in IE - I only see the loading message forever... bind(), empty() and append() all seem to work fine in IE.. But not load().. Here is my code: // wait for the DOM to be loaded $(document).ready(function() { // hide the plugin options $('#pluginOptionsContainer').hide(); // This is the hack for IE if ($.browser.msie) { $("#pluginDD").click(function() { this.blur(); this.focus(); }); } // set the main function $(function() { // the button shows hides the plugin options page (and its container) $("#pluginOptionsBtn") .click(function() { // show the container of the plugin options page $('#pluginOptionsContainer').empty().append('<div style="text-align:center;width:99%;">Loading...</div>'); $('#pluginOptionsContainer').toggle(); }); // set the loading message if user changes selection with either the dropdown or button $("#pluginDD,#pluginOptionsBtn").bind('change', function() { $('#pluginOptionsContainer').empty().append('<div style="text-align:center;width:99%;">Loading...</div>'); }); // then update the page when the plugin is changed when EITHER the plugin button or dropdown or clicked or changed $("#pluginDD,#pluginOptionsBtn").bind('change click', function() { // set form fields as vars in js var pid = <?=$pid;?>; var cid = <?=$contentid;?>; var pDD = $("#pluginDD").val(); // add post vars (must use JSON) to be sent into the js var 'dataString' var dataString = {plugin_options: true, pageid: pid, contentid: cid, pluginDD: pDD }; // include the plugin option page inside the container, with the required values already added into the query string $("#pluginOptionsContainer").load("/admin/inc/edit/content/plugin_options.php#pluginTop", dataString); // add this to stop page refresh return false; }); // end submit function }); // end main function }); // on DOM load Any help would be GREATLY appreciated! I hate IE!

    Read the article

  • Stored procedure performance randomly plummets; trivial ALTER fixes it. Why?

    - by gWiz
    I have a couple of stored procedures on SQL Server 2005 that I've noticed will suddenly take a significantly long time to complete when invoked from my ASP.NET MVC app running in an IIS6 web farm of four servers. Normal, expected completion time is less than a second; unexpected anomalous completion time is 25-45 seconds. The problem doesn't seem to ever correct itself. However, if I ALTER the stored procedure (even if I don't change anything in the procedure, except to perhaps add a space to the script created by SSMS Modify command), the completion time reverts to expected completion time. IIS and SQL Server are running on separate boxes, both running Windows Server 2003 R2 Enterprise Edition. SQL Server is Standard Edition. All machines have dual Xeon E5450 3GHz CPUs and 4GB RAM. SQL Server is accessed using its TCP/IP protocol over gigabit ethernet (not sure what physical medium). The problem is present from all web servers in the web farm. When I invoke the procedure from a query window in SSMS on my development machine, the procedure completes in normal time. This is strange because I was under the impression that SSMS used the same SqlClient driver as in .NET. When I point my development instance of the web app to the production database, I again get the anomalous long completion time. If my SqlCommand Timeout is too short, I get System.Data.SqlClient.SqlException: Timeout expired. The timeout period elapsed prior to completion of the operation or the server is not responding. Question: Why would performing ALTER on the stored procedure, without actually changing anything in it, restore the completion time to less than a second, as expected? Edit: To clarify, when the procedure is running slow for the app, it simultaneously runs fine in SSMS with the same parameters. The only difference I can discern is login credentials (next time I notice the behavior, I'll be checking from SSMS with the same creds). The ultimate goal is to get the procs to sustainably run with expected speed without requiring occasional intervention. Resolution: I wanted to to update this question in case others are experiencing this issue. Following the leads of the answers below, I was able to consistently reproduce this behavior. In order to test, I utilize sp_recompile and pass it one of the susceptible sprocs. I then initiate a website request from my browser that will invoke the sproc with atypical parameters. Lastly, I initiate a website request to a page that invokes the sproc with typical parameters, and observe that the request does not complete because of a SQL timeout on the sproc invocation. To resolve this on SQL Server 2005, I've added OPTIMIZE FOR hints to my SELECT. The sprocs that were vulnerable all have the "all-in-one" pattern described in this article. This pattern is certainly not ideal but was a necessary trade-off given the timeframe for the project.

    Read the article

  • WPF ClickOnce Bootstrap Dection Failure on One Machine

    - by Dexter Morgan
    Hello Friend, I've decided to use ClickOnce technology to deploy my new WPF application. By and large, ClickOnce works as advertised but I've hit a minor glitch regarding Bootstrapping and framework detection. Some background: - I'm using the standard Visual Studio-generated publish.htm page as my launch page. - The only prerequisite is the .NET Framework 4.0 Client Profile. - All clients using IE 8. - All clients already have the .NET 4.0 Client Profile installed. ClickOnce works as advertised on the vast majority of machines. The VS-generated JScript correctly detects that the framework is installed and presents the user with a Run button. The app launches just fine. I'm getting odd results on one of the machines, however. On the offending machine, the VS-generated JScript tells the user that the prereqs may not be installed -- or rather, it FAILS to detect that the framework is already installed. The "launch" link successfully launches the application but the Run link points to the bootstrapper setup.exe. Why is it failing to detect the framework on this one machine? It occurred to me that framework detection is largely a matter of examining the useragent string that's submitted by the browser. So, what you see below are two UserAgent strings. The first is from a machine where things are working properly. The second is from the offending machine. THIS ONE WORKS: 2011-01-11 15:14:14 W3SVC1 192.168.0.36 GET /publish.htm - 80 - 72.130.187.100 Mozilla/4.0+(compatible;+MSIE+8.0;+Windows+NT+6.0;+Trident/4.0;+SLCC1;+.NET+CLR+2.0.50727;+Media+Center+PC+5.0;+.NET+CLR+3.5.21022;+.NET+CLR+3.5.30729;+.NET+CLR+3.0.30729;+.NET4.0C) 304 0 0 THIS ONE DOESN'T: 2011-01-11 18:49:12 W3SVC1 192.168.0.36 GET /publish.htm - 80 - 76.212.204.169 Mozilla/4.0+(compatible;+MSIE+8.0;+Windows+NT+6.1;+WOW64;+Trident/4.0;+GTB6.6;+SLCC2;+.NET+CLR+2.0.50727;+.NET+CLR+3.5.30729;+.NET+CLR+3.0.30729;+Media+Center+PC+6.0;+.NET4.0C) 200 0 0 The useragent string of both machines clearly states, "hey the .NET 4.0 client profile is installed here" -- yet the second machine seems unable to detect it. I don't know enough about useragent strings to understand why the former works and the latter fails. The only difference as far as I can tell is that the offending machine is running 64bit. But that shouldn't make a difference. Should it? Any ideas? Dexter Morgan

    Read the article

  • Mac Safari randomly recreating cookie when I refresh my login screen. Very bizarre

    - by mcintyre321
    We have found an issue in our app where Safari on the Mac randomly recreates a login cookie from a logged off session. I have a fiddler archive with this behaviour here. Note that some stuff has been removed from this to make it easier to get, but nothing which sets a cookie or anything has been taken out - only repetitions of requests 3-8. I'll talk you through the running order Request 1: user logs out via call to /logout.aspx - Set-Cookie returned setting cookie expiry date to 1999 Requests 2-8: user refreshes login page sending calls to root or /res/en-US/s.js - no cookie is sent to server or received back, and access is denied. I have cut out a lot of requests of this nature from the log as they are boring Request 9: request for /res/en-US/s.js - Hv3 authentication cookie has mysteriously reappeared! Wat. There was NO set-cookie! WTFF! Request 10+ : now the cookie has reappeared, the site logs the user in AGAIN The cookie, when examined in Safari looks like <dict> <key>Created</key> <real>259603523.26834899</real> <key>Domain</key> <string>.mysite.dev</string> <key>Expires</key> <date>2010-03-24T16:05:22Z</date> <key>HttpOnly</key> <string>TRUE</string> <key>Name</key> <string>.Hv3</string> <key>Path</key> <string>/</string> </dict> One thing to note is that in Safari, the cookie domain is .mysite.dev not mysite.dev (which is the cookie domain specified in web.config) - however, given that access is denied in requests 2-8, it looks like the cookie has expired OK. If you look in the list of cookies in the browser during 2-8, the .Hv3 cookie is not there. Is this our bug or Safari's? What can I do to stop it happening?

    Read the article

  • PHP: Displaying Dom object and Creating xml file

    - by pavun_cool
    <?php $books = array(); $books [] = array( 'title' => 'PHP Hacks', 'author' => 'Jack Herrington', 'publisher' => "O'Reilly" ); $books [] = array( 'title' => 'Podcasting Hacks', 'author' => 'Jack Herrington', 'publisher' => "O'Reilly" ); $doc = new DOMDocument(); $doc->formatOutput = true; $r = $doc->createElement( "books" ); $doc->appendChild( $r ); foreach( $books as $book ) { $b = $doc->createElement( "book" ); $author = $doc->createElement( "author" ); $author->appendChild( $doc->createTextNode( $book['author'] ) ); #$author->appendChild( $doc->createTextNode( 'pavunkumar')); $new = $doc->createElement("Developer"); $a=$doc->createTextNode('I am developer ' ); $new->appendChild($a); $b->appendChild( $author ); $b->appendChild($new); $b->appendChild($new); $title = $doc->createElement( "title" ); $title->appendChild( $doc->createTextNode( $book['title'] ) ); $b->appendChild( $title ); $publisher = $doc->createElement( "publisher" ); $publisher->appendChild( $doc->createTextNode( $book['publisher'] ) ); $b->appendChild( $publisher ); $r->appendChild( $b ); } echo $doc->SaveXml() ; ?> When I run this code in command line. I am getting following things <?xml version="1.0"?> <books> <book> <author>Jack Herrington</author> <Developer>I am developer </Developer> <title>PHP Hacks</title> <publisher>O'Reilly</publisher> </book> <book> <author>Jack Herrington</author> <Developer>I am developer </Developer> <title>Podcasting Hacks</title> <publisher>O'Reilly</publisher> </book> </books> When I run the code in web browser it gives me following things Jack Herrington I am developer O'Reilly Jack Herrington I am developer O'Reilly I want to above output to be like command line output. And one more things is that instead of displaying , how could I create a xml file using $doc Dom object.

    Read the article

  • How to use Mozilla ActiveX Control without registry

    - by Andrew McKinlay
    I've been using the IE Browser component that is part of Windows. But I'm running into problems with security settings. For example, users get security warnings on pages with Javascript. So I'm looking at using the Mozilla ActiveX control instead. It's especially nice because it has a compatible interface. It works well if I let it install the control in the registry. But my users don't always have administrator rights to install things in the registry. So I'm trying to figure out how to use the control without registry changes. I'm using DllGetClassObject to get the class factory (IID_ICLASSFACTORY) and then CoRegisterClassObject to register it. All the API calls appear to succeed. And when I create an AtlAxWin window with the CLSID, it also appears to work. But when I try to call Navigate on the AtlAxGetControl it doesn't work - the interface doesn't have Navigate. I would show the code but it's in an obscure language (Suneido) so it wouldn't mean much. An example in C or C++ would be easy for me to translate. Or an example in another dynamic language like Python or Ruby might be helpful. Obviously I'm doing something wrong. Maybe I'm passing the wrong thing to CoRegisterClassObject? The MSDN documentation isn't very clear on what to pass and I haven't found any good examples. Or if there is another approach, I'm ok with that too. Note: I'm using the AtlAxWin window class so I'm not directly creating the control and can't use this approach. Another option is registry free com with a manifest. But again, I couldn't find a good example, especially since I'm not using Visual Studio. I tried to use the MT manifest tool, but couldn't figure it out. I don't think I can use DLL redirection since that doesn't get around the registry issue AFAIK. Another possibility is using WebKit but it seems even harder to use.

    Read the article

  • How to download file into string with progress callback?

    - by Kaminari
    I would like to use the WebClient (or there is another better option?) but there is a problem. I understand that opening up the stream takes some time and this can not be avoided. However, reading it takes a strangely much more amount of time compared to read it entirely immediately. Is there a best way to do this? I mean two ways, to string and to file. Progress is my own delegate and it's working good. FIFTH UPDATE: Finally, I managed to do it. In the meantime I checked out some solutions what made me realize that the problem lies elsewhere. I've tested custom WebResponse and WebRequest objects, library libCURL.NET and even Sockets. The difference in time was gzip compression. Compressed stream lenght was simply half the normal stream lenght and thus download time was less than 3 seconds with the browser. I put some code if someone will want to know how i solved this: (some headers are not needed) public static string DownloadString(string URL) { WebClient client = new WebClient(); client.Headers["User-Agent"] = "Mozilla/5.0 (Windows; U; Windows NT 6.1; en-US) AppleWebKit/532.5 (KHTML, like Gecko) Chrome/4.1.249.1045 Safari/532.5"; client.Headers["Accept"] = "application/xml,application/xhtml+xml,text/html;q=0.9,text/plain;q=0.8,image/png,*/*;q=0.5"; client.Headers["Accept-Encoding"] = "gzip,deflate,sdch"; client.Headers["Accept-Charset"] = "ISO-8859-2,utf-8;q=0.7,*;q=0.3"; Stream inputStream = client.OpenRead(new Uri(URL)); MemoryStream memoryStream = new MemoryStream(); const int size = 32 * 4096; byte[] buffer = new byte[size]; if (client.ResponseHeaders["Content-Encoding"] == "gzip") { inputStream = new GZipStream(inputStream, CompressionMode.Decompress); } int count = 0; do { count = inputStream.Read(buffer, 0, size); if (count > 0) { memoryStream.Write(buffer, 0, count); } } while (count > 0); string result = Encoding.Default.GetString(memoryStream.ToArray()); memoryStream.Close(); inputStream.Close(); return result; } I think that asyncro functions will be almost the same. But i will simply use another thread to fire this function. I dont need percise progress indication.

    Read the article

  • Use HTTP PUT to create new cache (ehCache) running on the same Tomcat?

    - by socal_javaguy
    I am trying to send a HTTP PUT (in order to create a new cache and populate it with my generated JSON) to ehCache using my webservice which is on the same local tomcat instance. Am new to RESTful Web Services and am using JDK 1.6, Tomcat 7, ehCache, and JSON. I have my POJOs defined like this: Person POJO: import javax.xml.bind.annotation.XmlRootElement; @XmlRootElement public class Person { private String firstName; private String lastName; private List<House> houses; // Getters & Setters } House POJO: import javax.xml.bind.annotation.XmlRootElement; @XmlRootElement public class House { private String address; private String city; private String state; // Getters & Setters } Using a PersonUtil class, I hardcoded the POJOs as follows: public class PersonUtil { public static Person getPerson() { Person person = new Person(); person.setFirstName("John"); person.setLastName("Doe"); List<House> houses = new ArrayList<House>(); House house = new House(); house.setAddress("1234 Elm Street"); house.setCity("Anytown"); house.setState("Maine"); houses.add(house); person.setHouses(houses); return person; } } Am able to create a JSON response per a GET request: @Path("") public class MyWebService{ @GET @Produces(MediaType.APPLICATION_JSON) public Person getPerson() { return PersonUtil.getPerson(); } } When deploying the war to tomcat and pointing the browser to http://localhost:8080/personservice/ Generated JSON: { "firstName" : "John", "lastName" : "Doe", "houses": [ { "address" : "1234 Elmstreet", "city" : "Anytown", "state" : "Maine" } ] } So far, so good, however, I have a different app which is running on the same tomcat instance (and has support for REST): http://localhost:8080/ehcache/rest/ While tomcat is running, I can issue a PUT like this: echo "Hello World" | curl -S -T - http://localhost:8080/ehcache/rest/hello/1 When I "GET" it like this: curl http://localhost:8080/ehcache/rest/hello/1 Will yield: Hello World What I need to do is create a POST which will put my entire Person generated JSON and create a new cache: http://localhost:8080/ehcache/rest/person And when I do a "GET" on this previous URL, it should look like this: { "firstName" : "John", "lastName" : "Doe", "houses": [ { "address" : "1234 Elmstreet", "city" : "Anytown", "state" : "Maine" } ] } So, far, this is what my PUT looks like: @PUT @Path("/ehcache/rest/person") @Produces(MediaType.APPLICATION_JSON) @Consumes(MediaType.APPLICATION_JSON) public Response createCache() { ResponseBuilder response = Response.ok(PersonUtil.getPerson(), MediaType.APPLICATION_JSON); return response.build(); } Question(s): (1) Is this the correct way to write the PUT? (2) What should I write inside the createCache() method to have it PUT my generated JSON into: http://localhost:8080/ehcache/rest/person (3) What would the command line CURL comment look like to use the PUT? Thanks for taking the time to read this...

    Read the article

  • Javascript: Writing a firefox extension with sockets

    - by Johnny Grass
    I need to write a firefox extension that creates a server socket (I think that's what it's called) and returns the browser's current url when a client application (running on the same computer) sends it a request. The thing is that I have no Java/Javascript background at all and I'm pressed for time so I am trying to hack something together from code samples. So far I've been mildly successful. I've been working with code from this question which is used in the open source Firefox exension PolyChrome I have the following code: var reader = { onInputStreamReady : function(input) { var input_stream = Components.classes["@mozilla.org/scriptableinputstream;1"] .createInstance(Components.interfaces.nsIScriptableInputStream); input_stream.init(input); input_stream.available(); var request = ''; while (input_stream.available()) { request = request + input_stream.read(512); } var checkString = "foo" if (request.toString() == checkString.toString()) { output_console('URL: ' + content.location.href); } else output_console("nothing"); var thread_manager = Components.classes["@mozilla.org/thread-manager;1"].getService(); input.asyncWait(reader,0,0,thread_manager.mainThread); } } var listener = { onSocketAccepted: function(serverSocket, clientSocket) { output_console("Accepted connection on "+clientSocket.host+":"+clientSocket.port); input = clientSocket.openInputStream(0, 0, 0).QueryInterface(Components.interfaces.nsIAsyncInputStream); output = clientSocket.openOutputStream(Components.interfaces.nsITransport.OPEN_BLOCKING, 0, 0); var thread_manager = Components.classes["@mozilla.org/thread-manager;1"].getService(); input.asyncWait(reader,0,0,thread_manager.mainThread); } } var serverSocket = Components.classes["@mozilla.org/network/server-socket;1"]. createInstance(Components.interfaces.nsIServerSocket); serverSocket.init(9999, true, 5); output_console("Opened socket on " + serverSocket.port); serverSocket.asyncListen(listener); I have a few questions. So far I can telnet into localhost and get a response, but my string comparison in the reader seems to fail even if I enter "foo". I don't get why. What am I missing? The sample code I'm using opens up a console window and prints output when I telnet into localhost. Ideally I would like the output to be returned as a response when the client sends a request to the server socket with a passphrase. How do I go about doing that? Is doing this a good idea? Does it create security vulnerabilities on the computer? How can I block connections to the socket from other computers? What is a good place to read about javascript sockets? My google searches have been pretty fruitless but then maybe I'm not using the right keywords.

    Read the article

  • highlighting search results in php error

    - by fusion
    i'm trying to figure out what is wrong in this code. it either doesn't highlight the search result OR it outputs html tags surrounding the highlighted text. . $search_result = ""; $search_result = trim($search_result); $special_cases = array( '%', '_', '+' ); $search_result = str_replace( $special_cases, '', $_GET["q"] ); //Check if the string is empty if ($search_result == "") { echo "<p>Search Error</p><p>Please enter a search...</p>" ; exit(); } $result = mysql_query('SELECT cQuotes, vAuthor, cArabic, vReference FROM thquotes WHERE cQuotes LIKE "%' . mysql_real_escape_string($search_result) .'%" ORDER BY idQuotes DESC', $conn) or die ('Error: '.mysql_error()); //eliminating special characters function h($s) { echo htmlspecialchars($s, ENT_QUOTES); } function highlightWords($string, $word) { $string = str_replace($word, "<span style='background-color: #FFE066;font-weight:bold;'>".$word."</span>", $string); /*** return the highlighted string ***/ return $string; } ?> <div class="caption">Search Results</div> <div class="center_div"> <table> <?php while ($row= mysql_fetch_array($result, MYSQL_ASSOC)) { $cQuote = highlightWords($row['cQuotes'], $search_result); ?> <tr> <td style="text-align:right; font-size:15px;"><?php h($row['cArabic']); ?></td> <td style="font-size:16px;"><?php h($cQuote); ?></td> <td style="font-size:12px;"><?php h($row['vAuthor']); ?></td> <td style="font-size:12px; font-style:italic; text-align:right;"><?php h($row['vReference']); ?></td> </tr> <?php } ?> </table> </div> on the browser, it is outputted as: A good <span style='background-color: #FFE066;font-weight:bold;'>action</span> is an ever-remaining store and a pure yield or if a div is used with class: A good <div class='highlight'>action</div> is an ever-remaining store and a pure yield

    Read the article

  • Unable to decode hex values in javascript tooltip

    - by staudk27
    Hi all, I have quite the process that we go through in order to display some e-mail communications in our application. Trying to keep it as general as possible... -We make a request to a service via XML -Get the XML reply string, send the string to a method to encode any invalid characters as follows: public static String convertUTF8(String value) { char[] chars = value.toCharArray(); StringBuffer retVal = new StringBuffer(chars.length); for (int i = 0; i < chars.length; i++) { char c = chars[i]; int chVal = (int)c; if (chVal > Byte.MAX_VALUE) { retVal.append("&#x").append(Integer.toHexString(chVal)).append(";"); } else { retVal.append(c); } } return retVal.toString(); } We then send that result of a string to another method to remove any other invalid characters: public static String removeInvalidCharacters(String inString) { if (inString == null){ return null; } StringBuffer newString = new StringBuffer(); char ch; char c[] = inString.toCharArray(); for (int i = 0; i < c.length; i++) { ch = c[i]; // remove any characters outside the valid UTF-8 range as well as all control characters // except tabs and new lines if ((ch < 0x00FD && ch > 0x001F) || ch == '\t' || ch == '\n' || ch == '\r') { newString.append(ch); } } return newString.toString(); } This string is then "unmarshal'ed" via the SaxParser The object is then sent back to our Display action which generated the response to the calling jsp/javascript to create the page. The issue is some text can contain characters which can't be processed correctly. The following is eventually rendered on the JSP just fine: <PrvwCommTxt>This is a new test. Have a*&amp;#xc7;&amp;#xb4;)&amp;#xa1;.&amp;#xf1;&amp;#xc7;&amp;#xa1;.&amp;#xf1;*&amp;#xc7;&amp;#xb4;)...</PrvwCommTxt> Which shows up as "This is a new test. Have a*Ç´)¡.ñÇ¡." in the browser. -The following shows up in a tooltip while hovering over the above text: <CommDetails>This is a new test. Have a*Ç´)¡.ñÇ¡.ñ*Ç´)¡.ñ*´)(¡.ñÇ(¡.ñÇ* Wonderful Day!</CommDetails> This then shows up incorrectly when rendered in the tooltip javascript with all the HEX values and not being rendered correctly. Any suggestions on how to make the unknown characters show correctly in javascript?

    Read the article

  • How can I stop Flash from changing indent when user Clicks on hyperlink in TextField?

    - by Paul Chernoch
    I have a TextField which I initialize by setting htmlText. The text has anchor tags (hyperlinks). When a user clicks on the hyperlink, the indentation of the second and subsequent lines in the paragraph changes. Why? How do I stop it? My html has an image at the beginning of the line, followed by the tag, followed by more text. To style the hyper links to look blue always and underlined when the mouse is over them, I do this: var css:StyleSheet = new StyleSheet(); css.parseCSS("a {color: #0000FF;} a:hover {text-decoration: underline;}"); stepText.styleSheet = css; stepText.htmlText = textToUse; stepText.visible = true; Here is a fragment of the html text (with newlines and exrta whitespace added to improve readability - originally it was one long line): <textformat indent="-37" blockindent="37" > <img src="media/interface/level-1-bullets/solid-circle.png" align="left" hspace="8" vspace="1"/> American Dental Association. (n.d.). <i>Cleaning your teeth and gums (oral hygiene)</i>. Retrieved 11/24/08, from <a href="http://www.ada.org/public/topics/cleaning_faq.asp" target="_blank">http://www.ada.org/public/topics/cleaning_faq.asp </a> </textformat> <br/> As it turns out, the text field is of a width such that it wraps and the second line starts with "Retrieved 11/24/08". Clicking on the hyper link causes this particular line to be indented. Subsequent paragraphs are not affected. ASIDE: The image is a list bullet about 37 pixels wide. (I used images instead of li tags because Flash does not allow nested lists, so I faked it using a series of images with varying amounts of whitespace to simulate three levels of indentation.) IDEA: I was thinking of changing all hyperlinks to use "event:" as the URL protocol, which causes a TextEvent.LINK event to be triggered instead of following the link. Then I would have to open the browser in a second call. I could use this event handler to set the html text to itself, which might clear the problem. (When I switch pages in my application and then come back to the page, everything is OKAY again.) PROBLEM: If I use the "event:" protocol and user tries the right-mouse button click, they will get an error, or so I am told. (See http://www.blog.lessrain.com/as3-texteventlink-and-contextmenu-incompatibilities/ ) I do not like this trade-off.

    Read the article

  • ajaxSubmit and Other Code. Can someone help me determine what this code is doing?

    - by Matt Dawdy
    I've inherited some code that I need to debug. It isn't working at present. My task is to get it to work. No other requirements have been given to me. No, this isn't homework, this is a maintenance nightmare job. ASP.Net (framework 3.5), C#, jQury 1.4.2. This project makes heavy use of jQuery and AJAX. There is a drop down on a page that, when an item is chosen, is supposed to add that item (it's a user) to an object in the database. To accomplish this, the previous programmer first, on page load, dynamically loads the entire page through AJAX. To do this, he's got 5 div's, and each one is loaded from a jquery call to a different full page in the website. Somehow, the HTML and BODY and all the other stuff is stripped out and the contents of the div are loaded with the content of the aspx page. Which seems incredibly wrong to me since it relies on the browser to magically strip out html, head, body, form tags and merge with the existing html head body form tags. Also, as the "content" page is returned as a string, the previous programmer has this code running on it before it is appended to the div: function CleanupResponseText(responseText, uniqueName) { responseText = responseText.replace("theForm.submit();", "SubmitSubForm(theForm, $(theForm).parent());"); responseText = responseText.replace(new RegExp("theForm", "g"), uniqueName); responseText = responseText.replace(new RegExp("doPostBack", "g"), "doPostBack" + uniqueName); return responseText; } When the dropdown itself fires it's onchange event, here is the code that gets fired: function SubmitSubForm(form, container) { //ShowLoading(container); $(form).ajaxSubmit( { url: $(form).attr("action"), success: function(responseText) { $(container).html(CleanupResponseText(responseText, form.id)); $("form", container).css("margin-top", "0").css("padding-top", "0"); //HideLoading(container); } } ); } This blows up in IE, with the message that "Microsoft JScript runtime error: Object doesn't support this property or method" -- which, I think, has to be that $(form).ajaxSubmit method doesn't exist. What is this code really trying to do? I am so turned around right now that I think my only option is to scrap everything and start over. But I'd rather not do that unless necessary. Is this code good? Is it working against .Net, and is that why we are having issues?

    Read the article

  • Using Selenium-IDE with a rich Javascript application?

    - by Darien
    Problem At my workplace, we're trying to find the best way to create automated-tests for an almost wholly javascript-driven intranet application. Right now we're stuck trying to find a good tradeoff between: Application code in reusable and nest-able GUI components. Tests which are easily created by the testing team Tests which can be recorded once and then automated Tests which do not break after small cosmetic changes to the site XPath expressions (or other possible expressions, like jQuery selectors) naively generated from Selenium-IDE are often non-repeatable and very fragile. Conversely, having the JS code generate special unique ID values for every important DOM-element on the page... well, that is its own headache, complicated by re-usable GUI components and IDs needing to be consistent when the test is re-run. What successes have other people had with this kind of thing? How do you do automated application-level testing of a rich JS interface? Limitations We are using JavascriptMVC 2.0, hopefully 3.0 soon so that we can upgrade to jQuery 1.4.x. The test-making folks are mostly trained to use Selenium IDE to directly record things. The test leads would prefer a page-unique HTML ID on each clickable element on the page... Training the testers to write or alter special expressions (such as telling them which HTML class-names are important branching points) is a no-go. We try to make re-usable javascript components, but this means very few GUI components can treat themselves (or what they contain) as unique. Some of our components already use HTML ID values in their operation. I'd like to avoid doing this anyway, but it complicates the idea of ID-based testing. It may be possible to add custom facilities (like a locator-builder or new locator method) to the Selenium-IDE installation testers use. Almost everything that goes on occurs within a single "page load" from a conventional browser perspective, even when items are saved Current thoughts I'm considering a system where a custom locator-builder (javascript code) for Selenium-IDE will talk with our application code as the tester is recording. In this way, our application becomes partially responsible for generating a mostly-flexible expression (XPath or jQuery) for any given DOM element. While this can avoid requiring more training for testers, I worry it may be over-thinking things.

    Read the article

< Previous Page | 519 520 521 522 523 524 525 526 527 528 529 530  | Next Page >