Search Results

Search found 8258 results on 331 pages for 'sequence points'.

Page 54/331 | < Previous Page | 50 51 52 53 54 55 56 57 58 59 60 61  | Next Page >

  • How to determine where on a path my object will be at a given point in time?

    - by Dave
    I have map and an obj that is meant to move from start to end in X amount of time. The movements are all straight lines, as curves are beyond my ability at the moment. So I am trying to get the object to move from these points, but along the way there are way points which keep it on a given path. The speed of the object is determined by how long it will take to get from start to end (based on X). This is what i have so far: //get_now() returns seconds since epoch var timepassed = get_now() - myObj[id].start; //seconds since epoch for departure var timeleft = myObj[id].end - get_now(); //seconds since epoch for arrival var journey_time = 60; //this means 60 minutes total journey time var array = [[650,250]]; //way points along the straight paths if(step == 0 || step =< array.length){ var destinationx = array[step][0]; var destinationy = array[step][1]; }else if( step == array.length){ var destinationx = 250; var destinationy = 100; } else { var destinationx = myObj[id].startx; var destinationy = myObj[id].starty; } step++; When the user logs in at any given time, the object needs to be drawn in the correct place of the path, almost as if its been travelling along the path whilst the user has not been at the PC with the available information i have above. How do I do this? Note: The camera angle in the game is a birds eye view so its a straight forward X:Y rather than isometric angles.

    Read the article

  • Distinguishing the Transport Layer from the Session Layer

    In the OSI communications model, the Session layer manages the creation and removal of the association between two communicating network end points. This can also be called a connection. A connection is maintained while the network end points are communicated between each other in a conversation or session of some unknown length of time. Some connections and sessions only need to last long enough to send a message or a piece of data in one direction. In addition, some sessions may last longer, this typically occurs when one or both of the network end points are  able to terminate it the connection. The transport layer ensures that messages/data are delivered without errors, in sequence, and with no data content losses or data content duplications. It relieves the Session Layer from any concern with the transfer of data between them and their peers. Examples: Session Layer This layer acts like a manager and asks one of its employees (Transport Layer) to move a piece of data/message from one network end-point to another. Transportation Layer This layer takes the request of the Session Layer and moves the data as insturcted, it also double checks the data for any missing or corrupted information after it has been moved. If for some reason the new data does not match the old data then the Transport player will attempt to move the data gain until the data at both locations is in sync.

    Read the article

  • What is the best way to render a 2d game map?

    - by Deukalion
    I know efficiency is key in game programming and I've had some experiences with rendering a "map" earlier but probably not in the best of ways. For a 2D TopDown game: (simply render the textures/tiles of the world, nothing else) Say, you have a map of 1000x1000 (tiles or whatever). If the tile isn't in the view of the camera, it shouldn't be rendered - it's that simple. No need to render a tile that won't be seen. But since you have 1000x1000 objects in your map, or perhaps less you probably don't want to loop through all 1000*1000 tiles just to see if they're suppose to be rendered or not. Question: What is the best way to implement this efficiency? So that it "quickly/quicker" can determine what tiles are suppose to be rendered? Also, I'm not building my game around tiles rendered with a SpriteBatch so there's no rectangles, the shapes can be different sizes and have multiple points, say a curved object of 10 points and a texture inside that shape; Question: How do you determine if this kind of objects is "inside" the View of the camera? It's easy with a 48x48 rectangle, just see if it X+Width or Y+Height is in the view of the camera. Different with multiple points. Simply put, how to manage the code and the data efficiently to not having to run through/loop through a million of objects at the same time.

    Read the article

  • Adding tolerance to a point in polygon test

    - by David Gouveia
    I've been using this method which was taken from Game Coding Complete to detect whether a point is inside of a polygon. It works in almost every case, but is failing on a few edge cases, and I can't figure out the reason. For example, given a polygon with vertices at (0,0) (0,100) and (100,100), the algorithm is returning: True for any point strictly inside the polygon False for any of the vertices False for (0, 50) which lies on one of the edges of the polygon True (?) for (50,50) which is also on one of the edges of the polygon I'd actually like to relax the algorithm so that it returns true in all of these cases. In other words, it should return true for points that are strictly inside, for the vertices themselves, and for points on the edges of the polygon. If possible I'd also like to give it enough tolerance so that it always tend towards "true" in face of floating point fluctuations. For example, I have another method, that given a line segment and a point, returns the closest location on the line segment to the given point. Currently, given any point outside the polygon and one of its edges, there are cases where the result is categorized as being inside by the method above, while other points are considered outside. I'd like to give it enough tolerance so that it always returns true in this situation. The way I've currently solved the problem is an hack, which consists of using an external library to inflate the polygon by a few pixels, and performing the tests on the inflated polygon, but I'd really like to replace this with a proper solution.

    Read the article

  • Moving 2d camera in the y direction

    - by Alex
    I'm developing a simple game for the iphone and am struggling to work out the best way for the camera to follow the main character. The following picture hightlights the three main components: There are 3 components to this: Circle - the main character Green line - terrain Black background The terrain is simply made from an array of points (approx 20 points per screen width). The terrain is moved in the x direction relative to the black background in order to keep the circle in its position shown. The distance to move the terrain is simply: movex = circle.position.x - terrain.position.x with a constant to fix the circle at some distance from the left of the screen. I am struggling to determine the best way to position the terrain in the y plane keep the focus in the character. I want to move the terrain in the y direction smoothly and not fix it to the position of the circle, so the circle can move in the y plane. If I take the same approach as the x positioning, the character is fixed at a point on the screen and the terrain moves. I could sample some terrain points either side of the character and produce an average, but in my implementation this was not smooth. I thought another approach might be to create a camera 'line' that is a smooth version of the terrain line and make the camerea follow this, but I'm not sure if this is the optimum solution. Any advice is much appreciated!

    Read the article

  • Moving objects colliding when using unalligned collision avoidance (steering)

    - by James Bedford
    I'm having trouble with unaligned collision avoidance for what I think is a rare case. I have set two objects to move towards each other but with a slight offset, so one of the objects is moving slightly upwards, and one of the objects is moving slightly downwards. In my unaligned collision avoidance steering algorithm I'm finding the points on the object's forward line and the other object's forward line where these two lines are the closest. If these closest points are within a collision avoidance distance, and if the distance between them is smaller than the two radii of the two object's bounding spheres, then the objects should steer away in the appropriate direction. The problem is that for my case, the closest points on the lines are calculated to be really far away from the actual collision point. This is because the two forward lines for each object are moving away from each other as the objects pass. The problem is that because of this, no steering takes place, and the two objects partially collide. Does anyone have any suggestions as to how I can correctly calculate the point of collision? Perhaps by somehow taking into account the size of the two objects?

    Read the article

  • Which of these URL scenarios is best for big link menus? [seo /user friendly urls]

    - by Sam
    Hi folks, a question about urls... me and a good friend of mine are exploring the possibilities of either of the three scenarios for a website where each webpage has a menusystem with about 130 links.: SCENARIO 1 the pages menu system has SHORT non-descriptive hyperlinks as well as a SHORT canonical: <a href:"design">dutch design</a> the pages canonical url points to e.g.: "design" OR SCENARIO 2 the pages menu system has SHORT non-descriptive hyperlinks wwith LONG canonical urls: <a href="design">dutch design</a> the pages canonical url points to: dutch-design-crazy-yes-but-always-honest OR SCENARIO 3 the pages menu system has LONG descriptive hyperlinks with LONG canonical urls: <a href="dutch-design-crazy-yes-but-always-honest">dutch design</a> the pages canonical url points to: dutch-design-crazy-yes-but-always-honest Currently we have scenario 2... should we progress to scenario 3? All three work fine and point via RewriteMod to the same page which is fetched underwater. Now, my question is which of these is better in terms of: userfriendlyness (page loading times, full url visible in url bar or not) seo friendlyness (proper indexing due to the urls containing descriptive relevant tags) other concerns we forgot like possible penalties for so many words in link hrefs?? Thanks very much for your suggestions: much appreciated!

    Read the article

  • Characteristics, what's the inverse of (x*(x+1))/2? [closed]

    - by Valmond
    In my game you can spend points to upgrade characteristics. Each characteristic has a formula like: A) out = in : for one point spent, one pont gained (you spend 1 point on Force so your force goes from 5 to 6) B) out = last level (starting at 1) : so the first point spent earns you 1 point, the next point spent earns you an additional 2 and so on (+3,+4,+5...) C) The inverse of B) : You need to spend 1 point to earn one, then you need to spend 2 to earn another one and so on. I have already found the formula for calculating the actual level of B when points spent = x : charac = (x*(x+1))/2 But I'd like to know what the "reverse" version of B) (usable for C) is, ie. if I have spent x points, how many have I earned if 1 spent gives 1, 1+2=3 gives 2, 1+2+3=6 gives 3 and so on. I know I can just calculate the numbers but I'd like to have the formula because its neater and so that I can stick it in an excel sheet for example... Thanks! ps. I think I have nailed it down to something like charac = sqrt( x*m +k) but then I'm stuck doing number guessing for k and m and I feel I might be wrong anyway as I get close but never hits the spot.

    Read the article

  • Using Optical Flow in EmguCV

    - by Meko
    HI. I am trying to create simple touch game using EmguCV.Should I use optical flow to determine for interaction between images on screen and with my hand ,if changes of points somewhere on screen more than 100 where the image, it means my hand is over image? But how can I track this new points? I can draw on screen here the previous points and new points but It shows on my head more points then my hand and I can not track my hands movements. void Optical_Flow_Worker(object sender, EventArgs e) { { Input_Capture.SetCaptureProperty(Emgu.CV.CvEnum.CAP_PROP.CV_CAP_PROP_POS_FRAMES, ActualFrameNumber); ActualFrame = Input_Capture.QueryFrame(); ActualGrayFrame = ActualFrame.Convert<Gray, Byte>(); NextFrame = Input_Capture.QueryFrame(); NextGrayFrame = NextFrame.Convert<Gray, Byte>(); ActualFeature = ActualGrayFrame.GoodFeaturesToTrack(500, 0.01d, 0.01, 5); ActualGrayFrame.FindCornerSubPix(ActualFeature, new System.Drawing.Size(10, 10), new System.Drawing.Size(-1, -1), new MCvTermCriteria(20, 0.3d)); OpticalFlow.PyrLK(ActualGrayFrame, NextGrayFrame, ActualFeature[0], new System.Drawing.Size(10, 10), 3, new MCvTermCriteria(20, 0.03d), out NextFeature, out Status, out TrackError); OpticalFlowFrame = new Image<Bgr, Byte>(ActualFrame.Width, ActualFrame.Height); OpticalFlowFrame = NextFrame.Copy(); for (int i = 0; i < ActualFeature[0].Length; i++) DrawFlowVectors(i); ActualFrameNumber++; pictureBox1.Image = ActualFrame.Resize(320, 400).ToBitmap() ; pictureBox3.Image = OpticalFlowFrame.Resize(320, 400).ToBitmap(); } } private void DrawFlowVectors(int i) { System.Drawing.Point p = new Point(); System.Drawing.Point q = new Point(); p.X = (int)ActualFeature[0][i].X; p.Y = (int)ActualFeature[0][i].Y; q.X = (int)NextFeature[i].X; q.Y = (int)NextFeature[i].Y; p.X = (int)(q.X + 6 * Math.Cos(angle + Math.PI / 4)); p.Y = (int)(q.Y + 6 * Math.Sin(angle + Math.PI / 4)); p.X = (int)(q.X + 6 * Math.Cos(angle - Math.PI / 4)); p.Y = (int)(q.Y + 6 * Math.Sin(angle - Math.PI / 4)); OpticalFlowFrame.Draw(new Rectangle(q.X,q.Y,1,1), new Bgr(Color.Red), 1); OpticalFlowFrame.Draw(new Rectangle(p.X, p.Y, 1, 1), new Bgr(Color.Blue), 1); }

    Read the article

  • Neural Networks in C# using NeuronDotNet

    - by kingrichard2005
    Hello, I'm testing the NeuronDotNet library for a class assignment using C#. I have a very simple console application that I'm using to test some of the code snippets provided in the manual fro the library, the goal of the assignment is to teach the program how to distinguish between random points in a square which may or may not be within a circle that is also inside the square. So basically, which points inside the square are also inside the circle. Here is what I have so far: namespace _469_A7 { class Program { static void Main(string[] args) { //Initlaize the backpropogation network LinearLayer inputLayer = new LinearLayer(2); SigmoidLayer hiddenLayer = new SigmoidLayer(8); SigmoidLayer outputLayer = new SigmoidLayer(2); new BackpropagationConnector(inputLayer, hiddenLayer); new BackpropagationConnector(hiddenLayer, outputLayer); BackpropagationNetwork network = new BackpropagationNetwork(inputLayer, outputLayer); //Generate a training set for the ANN TrainingSet trainingSet = new TrainingSet(2, 2); //TEST: Generate random set of points and add to training set, //for testing purposes start with 10 samples; Point p; Program program = new Program(); //Used to access randdouble function Random rand = new Random(); for(int i = 0; i < 10; i++) { //These points will be within the circle radius Type A if(rand.NextDouble() > 0.5) { p = new Point(rand.NextDouble(), rand.NextDouble()); trainingSet.Add(new TrainingSample(new double[2] { p.getX(), p.getY() }, new double[2] { 1, 0 })); continue; } //These points will either be on the border or outside the circle Type B p = new Point(program.randdouble(1.0, 4.0), program.randdouble(1.0, 4.0)); trainingSet.Add(new TrainingSample(new double[2] { p.getX(), p.getY() }, new double[2] { 0, 1 })); } //Start network learning network.Learn(trainingSet, 100); //Stop network learning //network.StopLearning(); } //generates a psuedo-random double between min and max public double randdouble(double min, double max) { Random rand = new Random(); if (min > max) { return rand.NextDouble() * (min - max) + max; } else { return rand.NextDouble() * (max - min) + min; } } } //Class defines a point in X/Y coordinates public class Point { private double X; private double Y; public Point(double xVal, double yVal) { this.X = xVal; this.Y = yVal; } public double getX() { return X; } public double getY() { return Y; } } } This is basically all that I need, the only question I have is how to handle output?? More specifically, I need to output the value of the "step size" and the momentum, although it would be nice to output other information as well. Anyone with experience using NeuronDotNet, your input is appreciated.

    Read the article

  • Vector math, finding coördinates on a planar between 2 vectors

    - by Will Kru
    I am trying to generate a 3d tube along a spline. I have the coördinates of the spline (x1,y1,z1 - x2,y2,z2 - etc) which you can see in the illustration in yellow. At those points I need to generate circles, whose vertices are to be connected at a later stadium. The circles need to be perpendicular to the 'corners' of two line segments of the spline to form a correct tube. Note that the segments are kept low for illustration purpose. [apparently I'm not allowed to post images so please view the image at this link] http://img191.imageshack.us/img191/6863/18720019.jpg I am as far as being able to calculate the vertices of each ring at each point of the spline, but they are all on the same planar ie same angled. I need them to be rotated according to their 'legs' (which A & B are to C for instance). I've been thinking this over and thought of the following: two line segments can be seen as 2 vectors (in illustration A & B) the corner (in illustraton C) is where a ring of vertices need to be calculated I need to find the planar on which all of the vertices will reside I then can use this planar (=vector?) to calculate new vectors from the center point, which is C and find their x,y,z using radius * sin and cos However, I'm really confused on the math part of this. I read about the dot product but that returns a scalar which I don't know how to apply in this case. Can someone point me into the right direction? [edit] To give a bit more info on the situation: I need to construct a buffer of floats, which -in groups of 3- describe vertex positions and will be connected by OpenGL ES, given another buffer with indices to form polygons. To give shape to the tube, I first created an array of floats, which -in groups of 3- describe control points in 3d space. Then along with a variable for segment density, I pass these control points to a function that uses these control points to create a CatmullRom spline and returns this in the form of another array of floats which -again in groups of 3- describe vertices of the catmull rom spline. On each of these vertices, I want to create a ring of vertices which also can differ in density (amount of smoothness / vertices per ring). All former vertices (control points and those that describe the catmull rom spline) are discarded. Only the vertices that form the tube rings will be passed to OpenGL, which in turn will connect those to form the final tube. I am as far as being able to create the catmullrom spline, and create rings at the position of its vertices, however, they are all on a planars that are in the same angle, instead of following the splines path. [/edit] Thanks!

    Read the article

  • Rotation Matrix calculates by column not by row

    - by pinnacler
    I have a class called forest and a property called fixedPositions that stores 100 points (x,y) and they are stored 250x2 (rows x columns) in MatLab. When I select 'fixedPositions', I can click scatter and it will plot the points. Now, I want to rotate the plotted points and I have a rotation matrix that will allow me to do that. The below code should work: theta = obj.heading * pi/180; apparent = [cos(theta) -sin(theta) ; sin(theta) cos(theta)] * obj.fixedPositions; But it wont. I get this error. ??? Error using == mtimes Inner matrix dimensions must agree. Error in == landmarkslandmarks.get.apparentPositions at 22 apparent = [cos(theta) -sin(theta) ; sin(theta) cos(theta)] * obj.fixedPositions; When I alter forest.fixedPositions to store the variables 2x250 instead of 250x2, the above code will work, but it wont plot. I'm going to be plotting fixedPositions constantly in a simulation, so I'd prefer to leave it as it, and make the rotation work instead. Any ideas? Also, fixed positions, is the position of the xy points as if you were looking straight ahead. i.e. heading = 0. heading is set to 45, meaning I want to rotate points clockwise 45 degrees. Here is my code: classdef landmarks properties fixedPositions %# positions in a fixed coordinate system. [x, y] heading = 45; %# direction in which the robot is facing end properties (Dependent) apparentPositions end methods function obj = landmarks(numberOfTrees) %# randomly generates numberOfTrees amount of x,y coordinates and set %the array or matrix (not sure which) to fixedPositions obj.fixedPositions = 100 * rand([numberOfTrees,2]) .* sign(rand([numberOfTrees,2]) - 0.5); end function obj = set.apparentPositions(obj,~) theta = obj.heading * pi/180; [cos(theta) -sin(theta) ; sin(theta) cos(theta)] * obj.fixedPositions; end function apparent = get.apparentPositions(obj) %# rotate obj.positions using obj.facing to generate the output theta = obj.heading * pi/180; apparent = [cos(theta) -sin(theta) ; sin(theta) cos(theta)] * obj.fixedPositions; end end end P.S. If you change one line to this: obj.fixedPositions = 100 * rand([2,numberOfTrees]) .* sign(rand([2,numberOfTrees]) - 0.5); Everything will work fine... it just wont plot.

    Read the article

  • open layers LineString not working

    - by AlexS
    Sorry to bother you guys, but I'm stuck with his problem for half a day. I want to draw poly line in OpenLayers using LineString object, so I've copied the example from documentation. It runs ok but i can't see the line on the screen Code looks like this <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.0 Transitional//EN"> var map; var lineLayer ; var points; var style; var polygonFeature function test() { lineLayer = new OpenLayers.Layer.Vector("Line Layer"); style = { strokeColor: '#0000ff', strokeOpacity: 1, strokeWidth: 10 }; map.addLayer(lineLayer); points = new Array(); points[0] =new OpenLayers.LonLat(-2.460181,27.333984 ).transform(new OpenLayers.Projection("EPSG:4326"), map.getProjectionObject());; points[1] = new OpenLayers.LonLat(-3.864255,-22.5 ).transform(new OpenLayers.Projection("EPSG:4326"), map.getProjectionObject());; var linear_ring = new OpenLayers.Geometry.LinearRing(points); polygonFeature = new OpenLayers.Feature.Vector( new OpenLayers.Geometry.Polygon([linear_ring]), null, style); lineLayer.addFeatures([polygonFeature]); alert("1"); } function initialize() { map = new OpenLayers.Map ("map_canvas", { controls:[ new OpenLayers.Control.Navigation(), new OpenLayers.Control.PanZoomBar(), new OpenLayers.Control.LayerSwitcher(), new OpenLayers.Control.Attribution()], maxExtent: new OpenLayers.Bounds(-20037508.34,-20037508.34,20037508.34,20037508.34), maxResolution: 156543.0399, numZoomLevels: 19, units: 'm', projection: new OpenLayers.Projection("EPSG:900913"), displayProjection: new OpenLayers.Projection("EPSG:4326") }); // Define the map layer // Here we use a predefined layer that will be kept up to date with URL changes layerMapnik = new OpenLayers.Layer.OSM.Mapnik("Mapnik"); map.addLayer(layerMapnik); var lonLat = new OpenLayers.LonLat(0, 0).transform(new OpenLayers.Projection("EPSG:4326"), map.getProjectionObject()); map.zoomTo(3); map.setCenter(lonLat, 19); test(); } </head> <body onload="initialize()" > <div id="map_canvas" style="width: 828px; height: 698px"></div> I'm sure I'm missing some parameter in creation of map or something but I really can't figure which one.

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Oracle WebCenter - Well Connected

    - by Brian Dirking
    800x600 Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin:0in; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:10.0pt; font-family:"Calibri","sans-serif"; mso-bidi-font-family:"Times New Roman";} An good post from Dan Elam on the state of the ECM industry (http://www.aiim.org/community/blogs/community/ECM-Vendors-go-to-War) . For those of you who don’t know Dan, he is one of the major forces in the content management industry. He founded eVisory and IMERGE Consulting, he is an AIIM Fellow and a former US Technical Expert to the International Standards Organization (ISO), and has been a driving force behind EmTag, AIIM’s Emerging Technologies Group. His post is interesting – it starts out talking about our Moveoff Documentum campaign, but then it becomes a much deeper insight into the ECM industry. Dan points out that Oracle has been making quiet strides in the ECM industry. In fact, analysts share this view Oracle, pointing out Oracle is growing greater than 20% annually while many of the big vendors are shrinking. And as Dan points out, this cements Oracle as one of the big five in the ECM space – the same week that Autonomy was removed from the Gartner Magic Quadrant for ECM. One of the key things points out is that Oracle WebCenter is well connected. WebCenter has out-of-the-box connections to key enterprise applications such as E-Business Suite, PeopleSoft, Siebel and JD Edwards. Those out-of-the-box integrations make it easy for organizations to drive content right into the places where it is needed, in the midst of business processes. At the same time, WebCenter provides composite interface capabilities to bring together two or more of these enterprise applications onto the same screen. Combine that with the capabilities of Oracle Social Network, you start to see how Oracle is providing a full platform for user engagement. But beyond those connections, WebCenter can also connect to other content management systems. It can index and search those systems from a single point of search, bringing back results in a single combined hitlist. WebCenter can also extend records management capabilities into Documentum, SharePoint, and email archiving systems. From a single console, records managers can define a series, set a retention schedule, and place holds – without having to go to each system to make these updates. Dan points out that there are some new competitive dynamics – to be sure. And it is interesting when a system can interact with another system, enforce dispositions and holds, and enable users to search and retrieve content. Oracle WebCenter is providing the infrastructure to build on, and the interfaces to drive user engagement. It’s an interesting time.

    Read the article

  • Part 14: Execute a PowerShell script

    In the series the following parts have been published Part 1: Introduction Part 2: Add arguments and variables Part 3: Use more complex arguments Part 4: Create your own activity Part 5: Increase AssemblyVersion Part 6: Use custom type for an argument Part 7: How is the custom assembly found Part 8: Send information to the build log Part 9: Impersonate activities (run under other credentials) Part 10: Include Version Number in the Build Number Part 11: Speed up opening my build process template Part 12: How to debug my custom activities Part 13: Get control over the Build Output Part 14: Execute a PowerShell script Part 15: Fail a build based on the exit code of a console application With PowerShell you can add powerful scripting to your build to for example execute a deployment. If you want more information on PowerShell, please refer to http://technet.microsoft.com/en-us/library/aa973757.aspx For this example we will create a simple PowerShell script that prints “Hello world!”. To create the script, create a new text file and name it “HelloWorld.ps1”. Add to the contents of the script: Write-Host “Hello World!” To test the script do the following: Open the command prompt To run the script you must change the execution policy. To do this execute in the command prompt: powershell set-executionpolicy remotesigned Now go to the directory where you have saved the PowerShell script Execute the following command powershell .\HelloWorld.ps1 In this example I use a relative path, but when the path to the PowerShell script contains spaces, you need to change the syntax to powershell "& '<full path to script>' " for example: powershell "& ‘C:\sources\Build Customization\SolutionToBuild\PowerShell Scripts\HellloWorld.ps1’ " In this blog post, I create a new solution and that solution includes also this PowerShell script. I want to create an argument on the Build Process Template that holds the path to the PowerShell script. In the Build Process Template I will add an InvokeProcess activity to execute the PowerShell command. This InvokeProcess activity needs the location of the script as an argument for the PowerShell command. Since you don’t know the full path at the build server of this script, you can either specify in the argument the relative path of the script, but it is hard to find out what the relative path is. I prefer to specify the location of the script in source control and then convert that server path to a local path. To do this conversion you can use the ConvertWorkspaceItem activity. So to complete the task, open the Build Process Template CustomTemplate.xaml that we created in earlier parts, follow the following steps Add a new argument called “DeploymentScript” and set the appropriate settings in the metadata. See Part 2: Add arguments and variables  for more information. Scroll down beneath the TryCatch activity called “Try Compile, Test, and Associate Changesets and Work Items” Add a new If activity and set the condition to "Not String.IsNullOrEmpty(DeploymentScript)" to ensure it will only run when the argument is passed. Add in the Then branch of the If activity a new Sequence activity and rename it to “Start deployment” Click on the activity and add a new variable called DeploymentScriptFilename (scoped to the “Start deployment” Sequence Add a ConvertWorkspaceItem activity on the “Start deployment” Sequence Add a InvokeProcess activity beneath the ConvertWorkspaceItem activity in the “Start deployment” Sequence Click on the ConvertWorkspaceItem activity and change the properties DisplayName = Convert deployment script filename Input = DeploymentScript Result = DeploymentScriptFilename Workspace = Workspace Click on the InvokeProcess activity and change the properties Arguments = String.Format(" ""& '{0}' "" ", DeploymentScriptFilename) DisplayName = Execute deployment script FileName = "PowerShell" To see results from the powershell command drop a WriteBuildMessage activity on the "Handle Standard Output" and pass the stdOutput variable to the Message property. Do the same for a WriteBuildError activity on the "Handle Error Output" To publish it, check in the Build Process Template This leads to the following result We now go to the build definition that depends on the template and set the path of the deployment script to the server path to the HelloWorld.ps1. (If you want to see the result of the PowerShell script, change the Logging verbosity to Detailed or Diagnostic). Save and run the build. A lot of the deployment scripts you have will have some kind of arguments (like username / password or environment variables) that you want to define in the Build Definition. To make the PowerShell configurable, you can follow the following steps. Create a new script and give it the name "HelloWho.ps1". In the contents of the file add the following lines: param (         $person     ) $message = [System.String]::Format(“Hello {0}!", $person) Write-Host $message When you now run the script on the command prompt, you will see the following So lets change the Build Process Template to accept one parameter for the deployment script. You can of course make it configurable to add a for-loop that reads through a collection of parameters but that is out of scope of this blog post. Add a new Argument called DeploymentScriptParameter In the InvokeProcess activity where the PowerShell command is executed, modify the Arguments property to String.Format(" ""& '{0}' '{1}' "" ", DeploymentScriptFilename, DeploymentScriptParameter) Check in the Build Process Template Now modify the build definition and set the Parameter of the deployment to any value and run the build. You can download the full solution at BuildProcess.zip. It will include the sources of every part and will continue to evolve.

    Read the article

  • I can't start mysql in ubuntu 11.04

    - by shomid
    I downloaded following files of Oracle.com: MySQL-server-5.5.28-1.linux2.6.i386.rpm<br/> MySQL-client-5.5.28-1.linux2.6.i386.rpm<br/> MySQL-shared-5.5.28-1.linux2.6.i386.rpm<br/> then with "alien -i" command installing rpm packages and when starting mysql get following error: Starting MySQL<br/> .... * The server quit without updating PID file (/var/lib/mysql/omid-desktop.pid). error log: 121117 13:21:30 mysqld_safe Starting mysqld daemon with databases from /var/lib/mysql 121117 13:21:30 [Note] Plugin 'FEDERATED' is disabled. /usr/sbin/mysqld: Table 'mysql.plugin' doesn't exist 121117 13:21:30 [ERROR] Can't open the mysql.plugin table. Please run mysql_upgrade to create it. 121117 13:21:30 InnoDB: The InnoDB memory heap is disabled 121117 13:21:30 InnoDB: Mutexes and rw_locks use InnoDB's own implementation 121117 13:21:30 InnoDB: Compressed tables use zlib 1.2.3 121117 13:21:30 InnoDB: Using Linux native AIO 121117 13:21:30 InnoDB: Initializing buffer pool, size = 128.0M 121117 13:21:30 InnoDB: Completed initialization of buffer pool 121117 13:21:30 InnoDB: highest supported file format is Barracuda. 121117 13:21:30 InnoDB: Waiting for the background threads to start 121117 13:21:31 InnoDB: 1.1.8 started; log sequence number 1595675 121117 13:21:31 [Note] Recovering after a crash using mysql-bin 121117 13:21:31 [Note] Starting crash recovery... 121117 13:21:31 [Note] Crash recovery finished. 121117 13:21:31 [Note] Server hostname (bind-address): '0.0.0.0'; port: 3306 121117 13:21:31 [Note] - '0.0.0.0' resolves to '0.0.0.0'; 121117 13:21:31 [Note] Server socket created on IP: '0.0.0.0'. 121117 13:21:31 [ERROR] Fatal error: Can't open and lock privilege tables: Table 'mysql.host' doesn't exist 121117 13:21:31 mysqld_safe mysqld from pid file /var/lib/mysql/omid-desktop.pid ended 121117 13:25:38 mysqld_safe Starting mysqld daemon with databases from /var/lib/mysql 121117 13:25:38 [Note] Plugin 'FEDERATED' is disabled. /usr/sbin/mysqld: Table 'mysql.plugin' doesn't exist 121117 13:25:38 [ERROR] Can't open the mysql.plugin table. Please run mysql_upgrade to create it. 121117 13:25:38 InnoDB: The InnoDB memory heap is disabled 121117 13:25:38 InnoDB: Mutexes and rw_locks use InnoDB's own implementation 121117 13:25:38 InnoDB: Compressed tables use zlib 1.2.3 121117 13:25:38 InnoDB: Using Linux native AIO 121117 13:25:38 InnoDB: Initializing buffer pool, size = 128.0M 121117 13:25:38 InnoDB: Completed initialization of buffer pool 121117 13:25:38 InnoDB: highest supported file format is Barracuda. 121117 13:25:38 InnoDB: Waiting for the background threads to start 121117 13:25:39 InnoDB: 1.1.8 started; log sequence number 1595675 /usr/sbin/mysqld: Too many arguments (first extra is 'start'). Use --verbose --help to get a list of available options 121117 13:25:39 [ERROR] Aborting 121117 13:25:39 InnoDB: Starting shutdown... 121117 13:25:40 InnoDB: Shutdown completed; log sequence number 1595675 121117 13:25:40 [Note] /usr/sbin/mysqld: Shutdown complete

    Read the article

  • Books or help on OO Analysis

    - by Pat
    I have this course where we learn about the domain model, use cases, contracts and eventually leap into class diagrams and sequence diagrams to define good software classes. I just had an exam and I got trashed, but part of the reason is we barely have any practical material, I spent at least two good months without drawing a single class diagram by myself from a case study. I'm not here to blame the system or the class I'm in, I'm just wondering if people have some exercise-style books that either provide domain models with glossaries, system sequence diagrams and ask you to use GRASP to make software classes? I could really use some alone-time practicing going from analysis to conception of software entities. I'm almost done with Larman's book called "Applying UML and Patterns An Introduction to Object-Oriented Analysis and Design and Iterative Development, Third Edition". It's a good book, but I'm not doing anything by myself since it doesn't come with exercises. Thanks.

    Read the article

  • Is it possible to have multiple sets of key columns in a table?

    - by Peter Larsson
    Filtered indexes is one of my new favorite things with SQL Server 2008. I am currently working on designing a new datawarehouse. There are two restrictions doing this It has to be fed from the old legacy system with both historical data and new data It has to be fed from the new business system with new data When we incorporate the new business system, we are going to do that for one market only. It means the old legacy business system still will produce new data for other markets (together with historical data for all markets) and the new business system produce new data to that one market only. Sounds interesting this far? To accomplish this I did a thorough research about the business requirements about the business intelligence needs. Then I went on to design the sucker. How does this relate to filtered indexes you ask? I'll give one example, the Stock transaction table. Well, the key columns for the old legacy system are different from the key columns from the new business system. The old legacy system has a key of 5 columns Movement date Movement time Product code Order number Sequence number within shipment And to all thing, I found out that the Movement Time column is not really a time. It starts out like a time HH:MM:SS but seconds are added for each delivery within the shipment, so a Movement Time can look like "12:11:68". The sequence number is ordered over the distributors for shipment. As I said, it is a legacy system. The new business system has one key column, the Movement DateTime (accuracy down to 100th of nanosecond). So how to deal with this? On thing would be to have two stock transaction tables, one for legacy system and one for the new business system. But that would lead to a maintenance overhead and using partitioned views for getting data out of the warehouse. Filtered index will be of a great use here. MovementDate DATETIME2(7) MovementTime CHAR(8) NULL ProductCode VARCHAR(15) NOT NULL OrderNumber VARCHAR(30) NULL SequenceNumber INT NULL The sequence number is not even used in the new system, so I created a clustered index for a new IDENTITY column to make a new identity column which can be shared by both systems. Then I created one unique filtered index for old system like this CREATE UNIQUE NONCLUSTERED INDEX IX_Legacy (MovementDate, MovementTime, ProductCode, SequenceNumber) INCLUDE (OrderNumber, Col5, Col6, ... ) WHERE SequenceNumber IS NOT NULL And then I created a new unique filtered index for the new business system like this CREATE UNIQUE NONCLUSTERED INDEX IX_Business (MovementDate) INCLUDE (ProductCode, OrderNumber, Col12, ... ) WHERE SequenceNumber IS NULL This way I can have multiple sets of key columns on same base table which is shared by both systems.

    Read the article

  • NetBeans, JSF, and MySQL Primary Keys using AUTO_INCREMENT

    - by MarkH
    I recently had the opportunity to spin up a small web application using JSF and MySQL. Having developed JSF apps with Oracle Database back-ends before and possessing some small familiarity with MySQL (sans JSF), I thought this would be a cakewalk. Things did go pretty smoothly...but there was one little "gotcha" that took more time than the few seconds it really warranted. The Problem Every DBMS has its own way of automatically generating primary keys, and each has its pros and cons. For the Oracle Database, you use a sequence and point your Java classes to it using annotations that look something like this: @GeneratedValue(strategy=GenerationType.SEQUENCE, generator="POC_ID_SEQ") @SequenceGenerator(name="POC_ID_SEQ", sequenceName="POC_ID_SEQ", allocationSize=1) Between creating the actual sequence in the database and making sure you have your annotations right (watch those typos!), it seems a bit cumbersome. But it typically "just works", without fuss. Enter MySQL. Designating an integer-based field as PRIMARY KEY and using the keyword AUTO_INCREMENT makes the same task seem much simpler. And it is, mostly. But while NetBeans cranks out a superb "first cut" for a basic JSF CRUD app, there are a couple of small things you'll need to bring to the mix in order to be able to actually (C)reate records. The (RUD) performs fine out of the gate. The Solution Omitting all design considerations and activity (!), here is the basic sequence of events I followed to create, then resolve, the JSF/MySQL "Primary Key Perfect Storm": Fire up NetBeans. Create JSF project. Create Entity Classes from Database. Create JSF Pages from Entity Classes. Test run. Try to create record and hit error. It's a simple fix, but one that was fun to find in its completeness. :-) Even though you've told it what to do for a primary key, a MySQL table requires a gentle nudge to actually generate that new key value. Two things are needed to make the magic happen. First, you need to ensure the following annotation is in place in your Java entity classes: @GeneratedValue(strategy = GenerationType.IDENTITY) All well and good, but the real key is this: in your controller class(es), you'll have a create() function that looks something like this, minus the comment line and the setId() call in bold red type:     public String create() {         try {             // Assign 0 to ID for MySQL to properly auto_increment the primary key.             current.setId(0);             getFacade().create(current);             JsfUtil.addSuccessMessage(ResourceBundle.getBundle("/Bundle").getString("CategoryCreated"));             return prepareCreate();         } catch (Exception e) {             JsfUtil.addErrorMessage(e, ResourceBundle.getBundle("/Bundle").getString("PersistenceErrorOccured"));             return null;         }     } Setting the current object's primary key attribute to zero (0) prior to saving it tells MySQL to get the next available value and assign it to that record's key field. Short and simple…but not inherently obvious if you've never used that particular combination of NetBeans/JSF/MySQL before. Hope this helps! All the best, Mark

    Read the article

  • Oracle Sequences

    - by jkrebsbach
    Reminder to myself - SQL Server has nice index columns directly tied to their tables. Oracle has sequences that are islands to themselves. select seq_name.currval from dual; select seq_name.nextval from dual; currval - return current number at top of sequence nextval - increment sequence by 1, return new number   therefore - to create functionality in oracle similar to an index column - OPTION A) - Create insert trigger: CREATE OR REPLACE TRIGGER dept_bir BEFORE INSERT ON departments FOR EACH ROW WHEN (new.id IS NULL) BEGIN SELECT dept_seq.NEXTVAL INTO :new.id FROM dual; END; This will handle creating a unique identity, but will not necessarily inform process flow of identity without additional logic. OPTION B) - Select indentity into temp variable, insert whole item into tab **** When attemptint to query currval, the below error was being thrown - SELECT seq_name.currval from dual; ERROR : TABLE OR VIEW DOES NOT EXIST *** Although Oracle sys tables may have access to the sequences, that isn't to say the Oracle user may have access to those sequences - verify permissions when the system can't see object that are being reported in the object explorer.

    Read the article

  • USB Drive Warm Boot Issue. Cold boot = Perfect. Warm boot = "No boot sector found on USB device"

    - by Dan
    I'm experiencing a boot/reboot quirk similar to, yet somewhat different from others posted here. I have two Western Digital "Passport" external USB2 drives (160GB and 320GB) with Ubuntu 11.10 installed. The BIOS on my laptop is set to boot USB drives before the internal drive, and it works well. Either drive will cold-boot Ubuntu 11.10 perfectly. However, at times the computer must be restarted (warm boot) to have software updates or other changes take effect. When I warm-boot the computer, the computer goes through its normal shutdown/restart, then the usual BIOS tests, at which time the USB drive is selected momentarily (as normal), and that's when the trouble starts. I get a "No boot sector found on USB device", and the computer proceeds to boot Windows from the internal drive. If I press F12 early during the restart sequence (allows manual selection of the boot sequence), USB is still shown before the internal drive on the sequence list (as it should be). If I highlight "USB" and press ENTER, I still get a "No boot sector..." error message, but the external USB drive then proceeds to boot Ubuntu normally. I have a third external USB drive (Western Digital 160 GB Media Center) that cold-boots and warm-boots perfectly, so I know everything in the computer is set up properly. It also tells me Ubuntu is set up correctly on the drives, as all three drives were done identically, and at the same time. I've tried formatting the Passport drives NTFS and FAT32, but it didn't change anything. If I power-down the computer, then start it up again, it will boot Ubuntu from either of the Passport drives perfectly - every time. It's as if during a warm boot the Passport drives are somehow looking for the boot loader in the wrong location on the drive - yet either drives works when booting from a cold start. Not a show-stopper .. but frustrating. Computer is a Dell XPS M1530, A12 BIOS (latest), but I don't think the computer plays into the issue because one of the three drives works at all times. It's only the two WD Passport models at issue here. Thanks!

    Read the article

  • Loading XML file containing leading zeros with SSIS preserving the zeros

    - by Compudicted
    Visiting the MSDN SQL Server Integration Services Forum oftentimes I could see that people would pop up asking this question: “why I am not able to load an element from an XML file that contains zeros so the leading/trailing zeros would remain intact?”. I started to suspect that such a trivial and often-required operation perhaps is being misunderstood by the developer community. I would also like to add that the whole state of affairs surrounding the XML today is probably also going to be increasingly affected by a motion of people who dislike XML in general and many aspects of it as XSD and XSLT invoke a negative reaction at best. Nevertheless, XML is in wide use today and its importance as a bridge between diverse systems is ever increasing. Therefore, I deiced to write up an example of loading an arbitrary XML file that contains leading zeros in one of its elements using SSIS so the leading zeros would be preserved keeping in mind the goal on simplicity into a table in SQL Server database. To start off bring up your BIDS (running as admin) and add a new Data Flow Task (DFT). This DFT will serve as container to adding our XML processing elements (besides, the XML Source is not available anywhere else other than from within the DFT). Double-click your DFT and drag and drop the XMS Source component from the Tool Box’s Data Flow Sources. Now, let the fun begin! Being inspired by the upcoming Christmas I created a simple XML file with one set of data that contains an imaginary SSN number of Rudolph containing several leading zeros like 0000003. This file can be viewed here. To configure the XML Source of course it is quite intuitive to point it to our XML file, next what the XML source needs is either an embedded schema (XSD) or it can generate one for us. In lack of the one I opted to auto-generate it for me and I ended up with an XSD that looked like: <?xml version="1.0"?> <xs:schema attributeFormDefault="unqualified" elementFormDefault="qualified" xmlns:xs="http://www.w3.org/2001/XMLSchema"> <xs:element name="XMasEvent"> <xs:complexType> <xs:sequence> <xs:element minOccurs="0" name="CaseInfo"> <xs:complexType> <xs:sequence> <xs:element minOccurs="0" name="ID" type="xs:unsignedByte" /> <xs:element minOccurs="0" name="CreatedDate" type="xs:unsignedInt" /> <xs:element minOccurs="0" name="LastName" type="xs:string" /> <xs:element minOccurs="0" name="FirstName" type="xs:string" /> <xs:element minOccurs="0" name="SSN" type="xs:unsignedByte" /> <!-- Becomes string -- > <xs:element minOccurs="0" name="DOB" type="xs:unsignedInt" /> <xs:element minOccurs="0" name="Event" type="xs:string" /> <xs:element minOccurs="0" name="ClosedDate" /> </xs:sequence> </xs:complexType> </xs:element> </xs:sequence> </xs:complexType> </xs:element> </xs:schema> As an aside on the XML file: if your XML file does not contain the outer node (<XMasEvent>) then you may end up in a situation where you see just one field in the output. Now please note that the SSN element’s data type was chosen to be of unsignedByte (and this is for a reason). The reason is stemming from the fact all our figures in the element are digits, this is good, but this is not exactly what we need, because if we will attempt to load the data with this XSD then we are going to either get errors on the destination or most typically lose the leading zeros. So the next intuitive choice is to change the data type to string. Besides, if a SSIS package was already created based on this XSD and the data type change was done thereafter, one should re-set the metadata by right-clicking the XML Source and choosing “Advanced Editor” in which there is a refresh button at the bottom left which will do the trick. So far so good, we are ready to load our XML file, well actually yes, and no, in my experience typically some data conversion may be required. So depending on your data destination you may need to tweak the data types targeted. Let’s add a Data Conversion Task to our DFT. Your package should look like: To make the story short I only will cover the SSN field, so in my data source the target SQL Table has it as nchar(10) and we chose string in our XSD (yes, this is a big difference), under such circumstances the SSIS will complain. So will go and manipulate on the data type of SSN by making it Unicode String (DT_WSTR), World String per se. The conversion should look like: The peek at the Metadata: We are almost there, now all we need is to configure the destination. For simplicity I chose SQL Server Destination. The mapping is a breeze, F5 and I am able to insert my data into SQL Server now! Checking the zeros – they are all intact!

    Read the article

  • Trying to make a universe [on hold]

    - by caters
    I am wanting to program a universe so that it starts with a big bang and atoms form and then molecules form and stars start to form and planets start to form and then moons around those planets. I have a few questions. If 400 IPMUs(In Program Mass Units) = 1 solar mass than how would I calculate the number of IPMUs for a spectral class of star given the range of solar masses for a main sequence star in that spectral class? How can I have planets not look like stars? Since whether it is a subdwarf, main sequence star, subgiant, giant, bright giant, supergiant, or hypergiant is mainly dependent on the radius and luminosity how can I have the radius and luminosity independent of the mass?

    Read the article

  • Why is there a 20 and not 21 in some versions of Planning Poker?

    - by SuffixTreeMonkey
    In Planning Poker, cards usually contain numbers of the Fibonacci sequence, which is 0,1,1,2,3,5,8,13,21,34,55 etc. However, you can see on the Wikipedia page (and this has been confirmed to me by people that work at several positions where Planning Poker is applied) in some editions the cards stray away from Fibonacci sequence after 13. They lower 21 to 20 and then continue with 40 and 100. Is there some rationale on why these values have been changed, specifically 21 to 20? (Also note that some other cards are added, such as ? and 1/2, but these are easier for me to understand, compared to the 21 - 20 shift.)

    Read the article

< Previous Page | 50 51 52 53 54 55 56 57 58 59 60 61  | Next Page >