Search Results

Search found 19305 results on 773 pages for 'above the gods'.

Page 55/773 | < Previous Page | 51 52 53 54 55 56 57 58 59 60 61 62  | Next Page >

  • AJAX Autocomplete appears at a random vertical position, not touching the textbox

    - by Tim
    Hi, I am using the AJAX Autocomplete extender for ASP.NET 2. Everything works fine...I am calling a webservice which gets me the values to fill the drop down with after 3 letters are typed into certain es. I have set the maxheight attribute and am using a scrollbar in case there are more entries than would fit that height. However, I notice that in some cases, the drop down appears at a random position on the screen, i.e. rather than connected to the relevant textbox, sometimes it appears with its entries above the textbox, not touching it at all. Sometimes it would have just one entry and it would appear in the middle of the screen vertically above the textbox it is associated to. Is there a reason why this is happening?

    Read the article

  • ASP.NET Template Selector/Builder - Dynamic CMS

    - by Ugene
    I am currently building my own CMS for various reasons that could take a long to explain... However i am looking for a dynamic solution to create templates for pages within the CMS and all areas must be editable via the administration area, maybe large text areas broken into multiple areas, text and image area on a page etc. Following on from the above i would like to create the following: Create a new page (selecting a pre-defined template like below) http://img525.imageshack.us/img525/9872/nestedpages.png and then upon editing the page it would have created as many text editors required for each editable region or a file upload control for an image area for example. i am thinking of using nested masterpages for the design elements, just unsure the best-practice way to achieve the above (db structure etc) I somehow hope this provides enough information but are happy to answer any questions you may have. Thanks

    Read the article

  • python [lxml] - cleaning out html tags

    - by sadhu_
    from lxml.html.clean import clean_html, Cleaner def clean(text): try: cleaner = Cleaner(scripts=True, embedded=True, meta=True, page_structure=True, links=True, style=True, remove_tags = ['a', 'li', 'td']) print (len(cleaner.clean_html(text))- len(text)) return cleaner.clean_html(text) except: print 'Error in clean_html' print sys.exc_info() return text I put together the above (ugly) code as my initial forays into python land. I'm trying to use lxml cleaner to clean out a couple of html pages, so in the end i am just left with the text and nothing else - but try as i might, the above doesnt appear to work as such, i'm still left with a substial amount of markup (and it doesnt appear to be broken html), and particularly links, which aren't getting removed, despite the args i use in remove_tags and links=True any idea whats going on, perhaps im barking up the wrong tree with lxml ? i thought this was the way to go with html parsing in python?

    Read the article

  • String Object. Clarification needed

    - by mac
    Guys, help me clarify. Say i have the following line in my program: jobSetupErrors.append("abc"); In the case above where jobSetupErrors is a StringBuilder(), what i see happen is: New String Object is created and assigned value "abc" value of that String object is assigned to the existing StringBuilder object If that is correct, and I add 1 more line ... jobSetupErrors.append("abc"); logger.info("abc"); In the above example are we creating String object separately 2 times? If so, would it be more proper to do something like this? String a = "abc"; jobSetupErrors.append(a); logger.info(a); Is this a better approach? Please advise

    Read the article

  • C++ String pointers

    - by gnm
    In my previous app I had an object like this: class myType { public: int a; string b; } It had a lot of instances scattered everywhere and passed around to nearly every function. The app was slow. Profiling said that 95% of time is eaten by the string allocator function. I know how to work with the object above, but not how to work with string pointers. class myType { public: int a; string* b; } They told me to use pointers as above. How much faster is it with a string pointer? What is copied when I copy the object? How to the following using the class with the pointer: Access the string value Modify the string value without modifying the one in the object (copy?) General things that change if I use string pointers?

    Read the article

  • ActionScript Parameter Filtering

    - by TheDarkIn1978
    i'm setting up a custom class that accepts some Number parameters, but i need to limit those parameters and would like to know the best way of doing so. currently, i'm simply calling if statements, and throwing an error if the number is above or below what's accepted. for example, there is a parameter that accepts and angle, but only between 0 and 90. in the case i've typed it as a uint so now i only have to check to see if it's above 90. there's also a parameter Number typed parameter that only accepts values between the range of 0.0 and 1.0. is my method of using if statements and throwing erros the usual way of filtering parameters?

    Read the article

  • Securing paths in PHP

    - by tjm
    I'm writing some PHP which takes some paths to different content directories, and uses these to include various parts of pages later. I'm trying to ensure that the paths are as they seem, and none of them break the rules of the application. I have PRIVATEDIR which must lie above DOCUMENT_ROOT (aka) PUBLICDIR. CONTENTDIR which must lie within PRIVATEDIR and not go back below PUBLICDIR and some other *DIR's which must remain within CONTENTDIR. Currently I set up some defaults, and then override the ones the user specifies and then sanity check them with the following. private function __construct($options) { error_reporting(0); if(is_array($options)) { $this->opts = array_merge($this->opts, $options); } if($this->opts['STATUS']==='debug') { error_reporting(E_ALL | E_NOTICE | E_STRICT); } $this->opts['PUBLICDIR'] = realpath($_SERVER['DOCUMENT_ROOT']) .DIRECTORY_SEPARATOR; $this->opts['PRIVATEDIR'] = realpath($this->opts['PUBLICDIR'] .$this->opts['PRIVATEDIR']) .DIRECTORY_SEPARATOR; $this->opts['CONTENTDIR'] = realpath($this->opts['PRIVATEDIR'] .$this->opts['CONTENTDIR']) .DIRECTORY_SEPARATOR; $this->opts['CACHEDIR'] = realpath($this->opts['PRIVATEDIR'] .$this->opts['CACHEDIR']) .DIRECTORY_SEPARATOR; $this->opts['ERRORDIR'] = realpath($this->opts['CONTENTDIR'] .$this->opts['ERRORDIR']) .DIRECTORY_SEPARATOR; $this->opts['TEMPLATEDIR' = realpath($this->opts['CONTENTDIR'] .$this->opts['TEMPLATEDIR']) .DIRECTORY_SEPARATOR; // then here I have to check that PRIVATEDIR is above PUBLICDIR // and that all the rest remain within private dir and don't drop // down into (or below) PUBLICDIR again. And die with an error if // they don't conform. } The thing is this seems like a lot of work to do, especially as it must be run, every time a page is accessed, before I can do anything else, e.g check for a cached version of the page I'm serving. Part of me is thinking, since all of these paths are predefined by the maintainer of the site, they SHOULD be aware of what paths they are allowing access to and ensuring they are secure. But, I think I'm thinking that because currently I am said maintainer, and I KNOW my paths conform to the rules. That said, I do want to secure this thing from any accidental errors by future maintainers (and I bet, now I've said above "I KNOW...", probably from myself somewhere down the line). This just feels like a suboptimal solution. I wonder how fast this would really be and what you would suggest to improve it or as an alternative? Thanks.

    Read the article

  • How to model a relationship that NHibernate (or Hibernate) doesn’t easily support

    - by MylesRip
    I have a situation in which the ideal relationship, I believe, would involve Value Object Inheritance. This is unfortunately not supported in NHibernate so any solution I come up with will be less than perfect. Let’s say that: “Item” entities have a “Location” that can be in one of multiple different formats. These formats are completely different with no overlapping fields. We will deal with each Location in the format that is provided in the data with no attempt to convert from one format to another. Each Item has exactly one Location. “SpecialItem” is a subtype of Item, however, that is unique in that it has exactly two Locations. “Group” entities aggregate Items. “LocationGroup” is as subtype of Group. LocationGroup also has a single Location that can be in any of the formats as described above. Although I’m interested in Items by Group, I’m also interested in being able to find all items with the same Location, regardless of which group they are in. I apologize for the number of stipulations listed above, but I’m afraid that simplifying it any further wouldn’t really reflect the difficulties of the situation. Here is how the above could be diagrammed: Mapping Dilemma Diagram: (http://www.freeimagehosting.net/uploads/592ad48b1a.jpg) (I tried placing the diagram inline, but Stack Overflow won't allow that until I have accumulated more points. I understand the reasoning behind it, but it is a bit inconvenient for now.) Hmmm... Apparently I can't have multiple links either. :-( Analyzing the above, I make the following observations: I treat Locations polymorphically, referring to the supertype rather than the subtype. Logically, Locations should be “Value Objects” rather than entities since it is meaningless to differentiate between two Location objects that have all the same values. Thus equality between Locations should be based on field comparisons, not identifiers. Also, value objects should be immutable and shared references should not be allowed. Using NHibernate (or Hibernate) one would typically map value objects using the “component” keyword which would cause the fields of the class to be mapped directly into the database table that represents the containing class. Put another way, there would not be a separate “Locations” table in the database (and Locations would therefore have no identifiers). NHibernate (or Hibernate) do not currently support inheritance for value objects. My choices as I see them are: Ignore the fact that Locations should be value objects and map them as entities. This would take care of the inheritance mapping issues since NHibernate supports entity inheritance. The downside is that I then have to deal with aliasing issues. (Meaning that if multiple objects share a reference to the same Location, then changing values for one object’s Location would cause the location to change for other objects that share the reference the same Location record.) I want to avoid this if possible. Another downside is that entities are typically compared by their IDs. This would mean that two Location objects would be considered not equal even if the values of all their fields are the same. This would be invalid and unacceptable from the business perspective. Flatten Locations into a single class so that there are no longer inheritance relationships for Locations. This would allow Locations to be treated as value objects which could easily be handled by using “component” mapping in NHibernate. The downside in this case would be that the domain model becomes weaker, more fragile and less maintainable. Do some “creative” mapping in the hbm files in order to force Location fields to be mapped into the containing entities’ tables without using the “component” keyword. This approach is described by Colin Jack here. My situation is more complicated than the one he describes due to the fact that SpecialItem has a second Location and the fact that a different entity, LocatedGroup, also has Locations. I could probably get it to work, but the mappings would be non-intuitive and therefore hard to understand and maintain by other developers in the future. Also, I suspect that these tricky mappings would likely not be possible using Fluent NHibernate so I would use the advantages of using that tool, at least in that situation. Surely others out there have run into similar situations. I’m hoping someone who has “been there, done that” can share some wisdom. :-) So here’s the question… Which approach should be preferred in this situation? Why?

    Read the article

  • Render multiple layers in XNA

    - by Charles
    I'm using XNA, and I've run into a little problem. I need to support multiple layers, each with a distinct z order (I call these "viewports"). A picture is worth a thousand words, so here's what it should look like: There are several things to notice here. Sprites do not render outside of their viewport, as you can see with Sprite B. Also, notice how the viewports are rendered - it's very similar to "layers" in Photoshop. Although Sprite C is has a z order of -1000, C still renders above Sprite A because its viewport's z-order is a greater than A's viewport's z-order. There's one last detail that I couldn't display very well in the above picture. Each viewport needs to optionally render a color over its region of the screen - you could think of it as a "tinting" affect. I'm completely at a loss when it comes to doing this the best way in XNA, so I could really use a short snippet of C#/VB.NET code that demonstrates this in action. Any help would be greatly appreciated.

    Read the article

  • Click event of buttons is not fired when it causes onChange event of textbox is fired first

    - by bakkujp
    Hi All, I have a textbox like below <h:inputText value="#{bean.strQuantite}"> <a4j:support actionListener="#{tabacListCommandeAltadisDetailBean.actionListenerQuantity}" event="onchange" /> </h:inputText> I input some value into the textbox above and keep the caret inside the textbox. After that, when I continue to click a other button, the event onchange of the input text above is fired. I want to when clicking the button, the click event is fired before. Can anyone help me to solve this problem ?

    Read the article

  • HashMap "WriteOnce" Implementation .. need help

    - by JavaNewbie
    import java.util.*; public class HashMapExample { public static class WriteOnceMap<K, V> extends HashMap<K, V> { public V put(K key, V value) { /* WriteOnceMap is a map that does not allow changing value for a particular key. It means that put() method should throw IllegalArgumentException if the key is already assosiated with some value in the map. Please implement this method to conform to the above description of WriteOnceMap. */ } public void putAll(Map<? extends K, ? extends V> m) { /* Pleaase implement this method to conform to the description of WriteOnceMap above. It should either (1) copy all of the mappings from the specified map to this map or (2) throw IllegalArgumentException and leave this map intact if the parameter already contains some keys from this map. */ } } }

    Read the article

  • Is possible to set generic type by another class?

    - by Soul_Master
    I use ASP.NET MVC for serving web application and I want to create something like the following code. <% using(HTML.Form(Model)) { %> <% HTML.CreateTextBox('txt1', x => x.Property1); <% } From the above code, Form extension method will receive object that represent type of current Model object in current View page. Next, CreateTextBox method will receive type from Form method and I can bind textbox to some property of this model. Update 1 The following code is code of CreateTextBox method that will create instance of TextBox class. public static CreateTextBox(string value, Expression<Func<object>> bindedProperty) { // T should be receive from HTML.Form method or class return new TextBox<T>(value); } Is it possible to creating some code that doing something like the above code? Thanks,

    Read the article

  • MySQL column names and aliases

    - by user329820
    hi, I have read that after select we use column-names but I have found a statement that was like this: SELECT 'A' FROM T WHERE A = NULL; would you lease help me? thanks (A is a column- name here?) my DBMS is MySQL EDITED : the exact question is this that: Will the above statement produce a row (select all that apply)? Notice that ANSI_NULLS is OFF. I want to know that the above statement will work? because some of you said that we should write IS NULL instead of =null

    Read the article

  • Loop function works first time, not second time

    - by user1483101
    I'm creating a parsing program to look for certain strings in a a text file and count them. However, I'm having some trouble with one spot. def callbrowse(): filename = tkFileDialog.askopenfilename(filetypes = (("Text files", "*.txt"),("HTML files", ".html;*.htm"),("All files", "*.*"))) print filename try: global filex global writefile filex = open(filename, 'r') print "Success!!" print filename except: print "Failed to open file" ######This returns the correct count only the first time it is run. The next time it ######returns 0. If the browse button is clicked again, then this function returns the ######correct count again. def count_errors(error_name): count = 0 for line in filex: if error_name == "CPU > 79%": stringparse = "Utilization is above" elif error_name == "Stuck touchscreen": stringparse = "Stuck touchscreen" if re.match("(.*)" + "Utilization is above" + "(.*)",line): count = count + 1 return count Thanks for any help. I can't seem to get this to work right.

    Read the article

  • need to changed markup with jquery

    - by user357034
    I have the following markup which I do not have direct access to... <a href="javascript:void(0);" onclick="window.open('/BulkDiscounts.asp?ProductID=318&ProductCode=' + escape('LB30X40ES') + '&Orig_Price=22.95', 'Discounts', 'scrollbars,status,resizable,width=330,height=300');"><iimg src="/v/vspfiles/templates/100/images/buttons/btn_quantitydiscounts.gif" border="0" align="absmiddle"></a> I need to "rewrite" the above as follows... A few things to point out is that the title is coming from a variable escape(global_Current_ProductCode) variable=productcode in the case above it is LB30X40ES The height and weight, price and product id used in the second markup must be from the first markup. Note that these change depending on the product loaded. These are not constants. I would guess the first thing to do was to add the thickbox class. Then I am lost as to what to do next. Basically I need to open up an thickbox iframe with the modified markup.

    Read the article

  • finding the numbers in a given range?

    - by Jamis
    Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

    Read the article

  • Database Documentation with `SQL Doc 2`

    - by mehdi lotfi
    I use SQL Doc 2 for documentation my database. But this tools not support following expect : Add diagrams in documentation. Add Additional description for each object such as tables, columns and etc. Customize output format. Add custom link for each object. Add Analyze business description of created tables, columns and etc Some time need to explain records of each table such as records of literal tables. How Can support above request in SQL Doc 2? Do exists a tools for documentation database with above request?

    Read the article

  • Error " Index exceeds Matrix dimensions"

    - by Mola
    Hi experts, I am trying to read an excel 2003 file which consist of 62 columns and 2000 rows and then draw 2d dendrogram from 2000 pattern of 2 categories of a data as my plot in matlab. When i run the script, it gives me the above error. I don't know why. Anybody has any idea why i have the above error? My data is here: http://rapidshare.com/files/383549074/data.xls Please delete the 2001 column if you want to use the data for testing. and my code is here: % Script file: cluster_2d_data.m d=2000; n1=22; n2=40; N=62 Data=xlsread('data.xls','A1:BJ2000'); X=Data'; R=1:2000; C=1:2; clustergram(X,'Pdist','euclidean','Linkage','complete','Dimension',2,... 'ROWLABELS',R,'COLUMNLABELS',C,'Dendrogram',{'color',5})

    Read the article

  • MYSQL - SQL query Getting single record for the similar records and populating other columns with which has more length

    - by Bujji
    Here is my case , I have a database table with below fields name place_code email phone address details estd others and example data if you look at the above example table First three records are talking about XYZ and place code 1020 . I want create a single record for these three records based on substring(name,1,4) place_code ( I am lucky here for all the similar records satisfies this condition and unique in the table .) For the other columns which record column length has max . For example again for the above 3 records email should be [email protected] , phone should be 657890 and details should be "testdetails" This should be done for all the table . (Some has single records and some has max 10 records ) Any help on query that helps me to get the desired result ? Thank You Regards Kiran

    Read the article

  • AngularJS: Better way to display success messages

    - by Sup
    $('body').on('click', '#save-btn', function () { $('#greetingsModal').modal('show'); }); <div id="greetingsModal" class="modal hide fade" tabindex="-1" role="dialog" aria- labelledby="myModalLabel" aria-hidden="true"> <div class="alert alert-success"> <a href="../admin/Supplier" class="close" data-dismiss="alert">x</a> <strong>Well done!</strong>. </div> I want to display a popup message using the above styles whenever 'save-btn' is clicked. The above code works fine but there is a lot of time delay by doing it this way. Is there any way to display such a alert message using angular?

    Read the article

  • Database table schema design - varchar(n). Suitable choice of N

    - by morpheous
    Coming from a C background, I may be getting too anal about this and worrying unnecessarily about bits and bytes here. Still, I cant help thinking how the data is actually stored and that if I choose an N which is easily factorizable into a power of 2, the database will be more effecient in how it packs data etc. Using this "logic", I have a string field in a table which is a variable length up to 21 chars. I am tempted to use 32 instead of 21, for the reason given above - however now I am thinking that I am wasting disk space because there will be space allocated for 11 extra chars that are guaranteed to be never used. Since I envisage storing several tens of thousands of rows a day, it all adds up. Question: Mindful of all of the above, Should I declare varchar(21) or varchar(32) and why?

    Read the article

  • How does unbundle work

    - by Ashithraj
    Before explaining my problem let me tell you the Mercurial setup, We have the following repos, RELEASE DEVELOPMENT BUGFIX All the above repo are running on a central server using IIS and hgwebdir.cgi Now coming to the problem, I clone a local repo from DEVELOPMENT repo. I make changes to the clone and commit (Not push). I make a bundle from the clone and pass the bundle to QA who has cloned the RELEASE repo. Now I try to apply the bundle to the RELEASE repo clone using hg unbundle I get an error, abort: error: ftp error: no host given What am I doing wrong? Can you give solution to the above problem keeping a Windows setup in mind?

    Read the article

  • Calling a webservice synchronously from a Silverlight 3 application?

    - by Lasse V. Karlsen
    I am trying to reuse some .NET code that performs some calls to a data-access-layer type service. I have managed to package up both the input to the method and the output from the method, but unfortunately the service is called from inside code that I really don't want to rewrite in order to be asynchronous. Unfortunately, the webservice code generated in Silverlight only produces asynchronous methods, so I was wondering if anyone had working code that managed to work around this? I tried the recipe found here: The Easy Way To Synchronously Call WCF Services In Silverlight, but unfortunately it times out and never completes the call. Or rather, what seems to happen is that the completed event handler is called, but only after the method returns. I am suspecting that the event handler is called from a dispatcher or similar, and since I'm blocking the main thread here, it never completes until the code is actually back into the GUI loop. Or something like that. Here's my own version that I wrote before I found the above recipe, but it suffers from the same problem: public static object ExecuteRequestOnServer(Type dalInterfaceType, string methodName, object[] arguments) { string securityToken = "DUMMYTOKEN"; string input = "DUMMYINPUT"; object result = null; Exception resultException = null; object evtLock = new object(); var evt = new System.Threading.ManualResetEvent(false); try { var client = new MinGatServices.DataAccessLayerServiceSoapClient(); client.ExecuteRequestCompleted += (s, e) => { resultException = e.Error; result = e.Result; lock (evtLock) { if (evt != null) evt.Set(); } }; client.ExecuteRequestAsync(securityToken, input); try { var didComplete = evt.WaitOne(10000); if (!didComplete) throw new TimeoutException("A data access layer web service request timed out (" + dalInterfaceType.Name + "." + methodName + ")"); } finally { client.CloseAsync(); } } finally { lock (evtLock) { evt.Close(); evt = null; } } if (resultException != null) throw resultException; else return result; } Basically, both recipes does this: Set up a ManualResetEvent Hook into the Completed event The event handler grabs the result from the service call, and signals the event The main thread now starts the web service call asynchronously It then waits for the event to become signalled However, the event handler is not called until the method above has returned, hence my code that checks for evt != null and such, to avoid TargetInvocationException from killing my program after the method has timed out. Does anyone know: ... if it is possible at all in Silverlight 3 ... what I have done wrong above?

    Read the article

  • Best of both worlds: arrow keys for cursor movement or flipping through buffers.

    - by dreeves
    I really like this vim trick to use the left and right arrows to flip between buffers: "left/right arrows to switch buffers in normal mode map <right> :bn<cr> map <left> :bp<cr> (Put that in ~/.vimrc) But sometimes I'm munching on a sandwich or something when scrolling around a file and I really want the arrow keys to work normally. I think what would make most sense is for the arrow keys to have the above buffer-flipping functionality only if there are actually multiple buffers open. Is there a way to extend the above to accomplish that?

    Read the article

< Previous Page | 51 52 53 54 55 56 57 58 59 60 61 62  | Next Page >