Search Results

Search found 1472 results on 59 pages for 'harry len'.

Page 56/59 | < Previous Page | 52 53 54 55 56 57 58 59  | Next Page >

  • Optimizing tasks to reduce CPU in a trading application

    - by Joel
    Hello, I have designed a trading application that handles customers stocks investment portfolio. I am using two datastore kinds: Stocks - Contains unique stock name and its daily percent change. UserTransactions - Contains information regarding a specific purchase of a stock made by a user : the value of the purchase along with a reference to Stock for the current purchase. db.Model python modules: class Stocks (db.Model): stockname = db.StringProperty(multiline=True) dailyPercentChange=db.FloatProperty(default=1.0) class UserTransactions (db.Model): buyer = db.UserProperty() value=db.FloatProperty() stockref = db.ReferenceProperty(Stocks) Once an hour I need to update the database: update the daily percent change in Stocks and then update the value of all entities in UserTransactions that refer to that stock. The following python module iterates over all the stocks, update the dailyPercentChange property, and invoke a task to go over all UserTransactions entities which refer to the stock and update their value: Stocks.py # Iterate over all stocks in datastore for stock in Stocks.all(): # update daily percent change in datastore db.run_in_transaction(updateStockTxn, stock.key()) # create a task to update all user transactions entities referring to this stock taskqueue.add(url='/task', params={'stock_key': str(stock.key(), 'value' : self.request.get ('some_val_for_stock') }) def updateStockTxn(stock_key): #fetch the stock again - necessary to avoid concurrency updates stock = db.get(stock_key) stock.dailyPercentChange= data.get('some_val_for_stock') # I get this value from outside ... some more calculations here ... stock.put() Task.py (/task) # Amount of transaction per task amountPerCall=10 stock=db.get(self.request.get("stock_key")) # Get all user transactions which point to current stock user_transaction_query=stock.usertransactions_set cursor=self.request.get("cursor") if cursor: user_transaction_query.with_cursor(cursor) # Spawn another task if more than 10 transactions are in datastore transactions = user_transaction_query.fetch(amountPerCall) if len(transactions)==amountPerCall: taskqueue.add(url='/task', params={'stock_key': str(stock.key(), 'value' : self.request.get ('some_val_for_stock'), 'cursor': user_transaction_query.cursor() }) # Iterate over all transaction pointing to stock and update their value for transaction in transactions: db.run_in_transaction(updateUserTransactionTxn, transaction.key()) def updateUserTransactionTxn(transaction_key): #fetch the transaction again - necessary to avoid concurrency updates transaction = db.get(transaction_key) transaction.value= transaction.value* self.request.get ('some_val_for_stock') db.put(transaction) The problem: Currently the system works great, but the problem is that it is not scaling well… I have around 100 Stocks with 300 User Transactions, and I run the update every hour. In the dashboard, I see that the task.py takes around 65% of the CPU (Stock.py takes around 20%-30%) and I am using almost all of the 6.5 free CPU hours given to me by app engine. I have no problem to enable billing and pay for additional CPU, but the problem is the scaling of the system… Using 6.5 CPU hours for 100 stocks is very poor. I was wondering, given the requirements of the system as mentioned above, if there is a better and more efficient implementation (or just a small change that can help with the current implemntation) than the one presented here. Thanks!! Joel

    Read the article

  • Multiprogramming in Django, writing to the Database

    - by Marcus Whybrow
    Introduction I have the following code which checks to see if a similar model exists in the database, and if it does not it creates the new model: class BookProfile(): # ... def save(self, *args, **kwargs): uniqueConstraint = {'book_instance': self.book_instance, 'collection': self.collection} # Test for other objects with identical values profiles = BookProfile.objects.filter(Q(**uniqueConstraint) & ~Q(pk=self.pk)) # If none are found create the object, else fail. if len(profiles) == 0: super(BookProfile, self).save(*args, **kwargs) else: raise ValidationError('A Book Profile for that book instance in that collection already exists') I first build my constraints, then search for a model with those values which I am enforcing must be unique Q(**uniqueConstraint). In addition I ensure that if the save method is updating and not inserting, that we do not find this object when looking for other similar objects ~Q(pk=self.pk). I should mention that I ham implementing soft delete (with a modified objects manager which only shows non-deleted objects) which is why I must check for myself rather then relying on unique_together errors. Problem Right thats the introduction out of the way. My problem is that when multiple identical objects are saved in quick (or as near as simultaneous) succession, sometimes both get added even though the first being added should prevent the second. I have tested the code in the shell and it succeeds every time I run it. Thus my assumption is if say we have two objects being added Object A and Object B. Object A runs its check upon save() being called. Then the process saving Object B gets some time on the processor. Object B runs that same test, but Object A has not yet been added so Object B is added to the database. Then Object A regains control of the processor, and has allready run its test, even though identical Object B is in the database, it adds it regardless. My Thoughts The reason I fear multiprogramming could be involved is that each Object A and Object is being added through an API save view, so a request to the view is made for each save, thus not a single request with multiple sequential saves on objects. It might be the case that Apache is creating a process for each request, and thus causing the problems I think I am seeing. As you would expect, the problem only occurs sometimes, which is characteristic of multiprogramming or multiprocessing errors. If this is the case, is there a way to make the test and set parts of the save() method a critical section, so that a process switch cannot happen between the test and the set?

    Read the article

  • wxpython - Nested Notebooks

    - by madtowneast
    I have been trying to make my nested notebooks a little bit more appealing code wise. At the moment, I got this #!/usr/bin/env python import os import sys import datetime import numpy as np from readmonifile import MonitorFile from sortmonifile import sort import wx class NestedPanelOne(wx.Panel): #---------------------------------------------------------------------- # First notebook that creates the tab to select the component number #---------------------------------------------------------------------- def __init__(self, parent, label, data): wx.Panel.__init__(self, parent=parent, id=wx.ID_ANY) sizer = wx.BoxSizer(wx.VERTICAL) #Loop creating the tabs according to the component name nestedNotebook = wx.Notebook(self, wx.ID_ANY) for slabel in sorted(data[label].keys()): tab = NestedPanelTwo(nestedNotebook, label, slabel, data) nestedNotebook.AddPage(tab,slabel) sizer = wx.BoxSizer(wx.VERTICAL) sizer.Add(nestedNotebook, 1, wx.ALL|wx.EXPAND, 5) self.SetSizer(sizer) class NestedPanelTwo(wx.Panel): #------------------------------------------------------------------------------ # Second notebook that creates the tab to select the main monitoring variables #------------------------------------------------------------------------------ def __init__(self, parent, label, slabel, data): wx.Panel.__init__(self, parent=parent, id=wx.ID_ANY) sizer = wx.BoxSizer(wx.VERTICAL) nestedNotebook = wx.Notebook(self, wx.ID_ANY) for sslabel in sorted(data[label][slabel][data[label][slabel].keys()[0]].keys()): tab = NestedPanelThree(nestedNotebook, label, slabel, sslabel, data) nestedNotebook.AddPage(tab, sslabel) sizer.Add(nestedNotebook, 1, wx.ALL|wx.EXPAND, 5) self.SetSizer(sizer) class NestedPanelThree(wx.Panel): #------------------------------------------------------------------------------- # Third notebook that creates checkboxes to select the monitoring sub-variables #------------------------------------------------------------------------------- def __init__(self, parent, label, slabel, sslabel, data): wx.Panel.__init__(self, parent=parent, id=wx.ID_ANY) labels=[] chbox =[] chboxdict={} for ssslabel in sorted(data[label][slabel][data[label][slabel].keys()[0]][sslabel].keys()): labels.append(ssslabel) for item in list(set(labels)): cb = wx.CheckBox(self, -1, item) chbox.append(cb) chboxdict[item]=cb gridSizer = wx.GridSizer(np.shape(list(set(labels)))[0],3, 5, 5) gridSizer.AddMany(chbox) self.SetSizer(gridSizer) ######################################################################## class NestedNotebookDemo(wx.Notebook): #--------------------------------------------------------------------------------- # Main notebook creating tabs for the monitored components #--------------------------------------------------------------------------------- def __init__(self, parent, data): wx.Notebook.__init__(self, parent, id=wx.ID_ANY, style= wx.BK_DEFAULT ) for label in sorted(data.keys()): print label tab = NestedPanelOne(self,label, data) self.AddPage(tab, label) ######################################################################## class DemoFrame(wx.Frame): #---------------------------------------------------------------------- # Putting it all together #---------------------------------------------------------------------- def __init__(self,data): wx.Frame.__init__(self, None, wx.ID_ANY, "pDAQ monitoring plotting tool", size=(800,400) ) panel = wx.Panel(self) notebook = NestedNotebookDemo(panel, data) sizer = wx.BoxSizer(wx.VERTICAL) sizer.Add(notebook, 1, wx.ALL|wx.EXPAND, 5) panel.SetSizer(sizer) self.Layout() #Menu Bar to be added later ''' menubar = wx.MenuBar() file = wx.Menu() file.Append(1, '&Quit', 'Exit Tool') menubar.Append(file, '&File') self.SetMenuBar(menubar) self.Bind(wx.EVT_MENU, self.OnClose, id=1) ''' self.Show() #---------------------------------------------------------------------- if __name__ == "__main__": if len(sys.argv) == 1: raise SystemExit("Please specify a file to process") for f in sys.argv[1:]: data=sort.sorting(f) print data['stringHub'].keys() print data.keys() print data[data.keys()[0]].keys() print 'test' app = wx.PySimpleApp() frame = DemoFrame(data) app.MainLoop() print 'testend' and I would like to reduce this whole mess into something that only has three nested for loops, so something like for label in sorted(data.keys()): self.SubNoteBooks[label] = wx.Notebook(self.Notebook, wx.ID_ANY) self.Notebook.AddPage(self.SubNoteBooks[label], label) for slabel in sorted(data[label].keys()): self.SubNoteBooks[label][slabel] = wx.Notebook(self, wx.ID_ANY) self.SubNoteBooks[label].AddPage(self.SubNoteBooks[label][slabel], slabel) for sslabel in sorted(data[label][slabel][data[label][slabel].keys()[0]].keys()): self.SubNoteBooks[label][slabel][sslabel] = wx.Notebook(self.Notebook, wx.ID_ANY) self.Notebook.AddPage(self.SubNoteBooks[label][slabel][sslabel], sslabel) I have been trying to fiddle this around but the problem seems to be the line self.SubNoteBooks[label][slabel] = wx.Notebook(self, wx.ID_ANY) I get the error: Traceback (most recent call last): File "./reducelinenumbers.py", line 162, in <module> frame = DemoFrame(data) File "./reducelinenumbers.py", line 126, in __init__ self.SubNoteBooks[label][slabel] = wx.Notebook(self, wx.ID_ANY) TypeError: 'Notebook' object does not support item assignment I understand why notebook is being type raises a TypeError here. Is there a way around this? Thanks a bunch in advance.

    Read the article

  • How to get compatibility between C# and SQL2k8 AES Encryption?

    - by Victor Rodrigues
    I have an AES encryption being made on two columns: one of these columns is stored at a SQL Server 2000 database; the other is stored at a SQL Server 2008 database. As the first column's database (2000) doesn't have native functionality for encryption / decryption, we've decided to do the cryptography logic at application level, with .NET classes, for both. But as the second column's database (2008) allow this kind of functionality, we'd like to make the data migration using the database functions to be faster, since the data migration in SQL 2k is much smaller than this second and it will last more than 50 hours because of being made at application level. My problem started at this point: using the same key, I didn't achieve the same result when encrypting a value, neither the same result size. Below we have the full logic in both sides.. Of course I'm not showing the key, but everything else is the same: private byte[] RijndaelEncrypt(byte[] clearData, byte[] Key) { var memoryStream = new MemoryStream(); Rijndael algorithm = Rijndael.Create(); algorithm.Key = Key; algorithm.IV = InitializationVector; var criptoStream = new CryptoStream(memoryStream, algorithm.CreateEncryptor(), CryptoStreamMode.Write); criptoStream.Write(clearData, 0, clearData.Length); criptoStream.Close(); byte[] encryptedData = memoryStream.ToArray(); return encryptedData; } private byte[] RijndaelDecrypt(byte[] cipherData, byte[] Key) { var memoryStream = new MemoryStream(); Rijndael algorithm = Rijndael.Create(); algorithm.Key = Key; algorithm.IV = InitializationVector; var criptoStream = new CryptoStream(memoryStream, algorithm.CreateDecryptor(), CryptoStreamMode.Write); criptoStream.Write(cipherData, 0, cipherData.Length); criptoStream.Close(); byte[] decryptedData = memoryStream.ToArray(); return decryptedData; } This is the SQL Code sample: open symmetric key columnKey decryption by password = N'{pwd!!i_ll_not_show_it_here}' declare @enc varchar(max) set @enc = dbo.VarBinarytoBase64(EncryptByKey(Key_GUID('columnKey'), 'blablabla')) select LEN(@enc), @enc This varbinaryToBase64 is a tested sql function we use to convert varbinary to the same format we use to store strings in the .net application. The result in C# is: eg0wgTeR3noWYgvdmpzTKijkdtTsdvnvKzh+uhyN3Lo= The same result in SQL2k8 is: AI0zI7D77EmqgTQrdgMBHAEAAACyACXb+P3HvctA0yBduAuwPS4Ah3AB4Dbdj2KBGC1Dk4b8GEbtXs5fINzvusp8FRBknF15Br2xI1CqP0Qb/M4w I just didn't get yet what I'm doing wrong. Do you have any ideas? EDIT: One point I think is crucial: I have one Initialization Vector at my C# code, 16 bytes. This IV is not set at SQL symmetric key, could I do this? But even not filling the IV in C#, I get very different results, both in content and length.

    Read the article

  • How to display the data of DOM parsed attributes in the listView display ?

    - by Praween k
    Hi, I am building a test output for DOM parser with node "Rider" and within that 7 attributes are there.URL://http://ps700.pranasystems.com/tours/8/xml/results/stage1results.xml. I want to display only the "name" and the "team" attributes output in the listview mode of the device.I am not getting clear where to store the output to display. Please help me someone for how to store and display that data to the output of the device in List view. Thanks in advance //-------------------------------// Here is my code------------// public String getSearch(String strURL) { URL url; URLConnection urlConn = null; NamedNodeMap nnm = null; int len; try { url = new URL(strURL); urlConn = url.openConnection(); } catch (IOException ioe) { Log.e("Could not Connect: "+ioe.getMessage(), "."); } DocumentBuilder builder = null ; Document doc = null ; try { DocumentBuilderFactory dbf = DocumentBuilderFactory.newInstance(); DocumentBuilder db = dbf.newDocumentBuilder(); doc = db.parse(urlConn.getInputStream()); Node thisNode, currentNode, node,theAttribute ; NodeList nchild, nodeList; String name; ArrayList<Node> result = new ArrayList<Node>(); nodeList = doc.getElementsByTagName("rider"); int length = nodeList.getLength(); for (int i = 0; i < length; i++) { currentNode = nodeList.item(i); NamedNodeMap attributes = currentNode.getAttributes(); Log.i("TAG", attributes.toString()); for (int a = 0; a < attributes.getLength(); a++) { theAttribute = attributes.item(a); } // s1.setAdapter(new ArrayAdapter<Node>(this, // android.R.layout.simple_list_item_1,result)); }catch(ParserConfigurationException pce ){ Log.e("Could not Parse XML:" +pce.getMessage() ,"."); } catch (SAXException se) {Log.e("Could not Parse XML: "+se.getMessage(), ".");} catch (IOException ioe) {Log.e("Invalid XML: "+ioe.getMessage(), ".");} return strURL; }

    Read the article

  • Why does extend() engage in bizarre behaviour when passed the same list twice?

    - by intuited
    I'm pretty confused by one of the subtleties of the vimscript extend() function. If you use it to extend a list with another list, it does pretty much what you'd expect, which is to insert the second list into the first list at the index given by the third parameter: let list1 = [1,2,3,4,5,6] | echo extend(list1,[1,2,3,4,5,6],5) " [1, 2, 3, 4, 5, 1, 2, 3, 4, 5, 6, 6] However if you give it the same list twice it starts tripping out a bit. let list1 = [1,2,3,4,5,6] | echo extend(list1,list1,0) " [1, 2, 3, 4, 5, 6, 1, 2, 3, 4, 5, 6] let list1 = [1,2,3,4,5,6] | echo extend(list1,list1,1) " [1, 1, 1, 1, 1, 1, 1, 2, 3, 4, 5, 6] let list1 = [1,2,3,4,5,6] | echo extend(list1,list1,2) " [1, 2, 1, 2, 1, 2, 1, 2, 3, 4, 5, 6] let list1 = [1,2,3,4,5,6] | echo extend(list1,list1,3) " [1, 2, 3, 1, 2, 3, 1, 2, 3, 4, 5, 6] let list1 = [1,2,3,4,5,6] | echo extend(list1,list1,4) " [1, 2, 3, 4, 1, 2, 3, 4, 1, 2, 5, 6] let list1 = [1,2,3,4,5,6] | echo extend(list1,list1,5) " [1, 2, 3, 4, 5, 1, 2, 3, 4, 5, 1, 6] let list1 = [1,2,3,4,5,6] | echo extend(list1,list1,6) " [1, 2, 3, 4, 5, 6, 1, 2, 3, 4, 5, 6] Extra-confusingly, this behaviour applies when the list is referenced with two different variables: let list1 = [1,2,3,4,5,6] | let list2 = list1 | echo extend(list1,list2,4) " [1, 2, 3, 4, 1, 2, 3, 4, 1, 2, 5, 6] This is totally bizarre to me. I can't fathom a use for this functionality, and it seems like it would be really easy to invoke it by accident when you just wanted to insert one list into another and didn't realize that the variables were referencing the same array. The documentation says the following: If they are |Lists|: Append {expr2} to {expr1}. If {expr3} is given insert the items of {expr2} before item {expr3} in {expr1}. When {expr3} is zero insert before the first item. When {expr3} is equal to len({expr1}) then {expr2} is appended. Examples: :echo sort(extend(mylist, [7, 5])) :call extend(mylist, [2, 3], 1) When {expr1} is the same List as {expr2} then the number of items copied is equal to the original length of the List. E.g., when {expr3} is 1 you get N new copies of the first item (where N is the original length of the List). Does this make sense in a way that I'm not getting, or is it just an eccentricity?

    Read the article

  • Yes, another thread question...

    - by Michael
    I can't understand why I am loosing control of my GUI even though I am implementing a thread to play a .wav file. Can someone pin point what is incorrect? #!/usr/bin/env python import wx, pyaudio, wave, easygui, thread, time, os, sys, traceback, threading import wx.lib.delayedresult as inbg isPaused = False isStopped = False class Frame(wx.Frame): def __init__(self): print 'Frame' wx.Frame.__init__(self, parent=None, id=-1, title="Jasmine", size=(720, 300)) #initialize panel panel = wx.Panel(self, -1) #initialize grid bag sizer = wx.GridBagSizer(hgap=20, vgap=20) #initialize buttons exitButton = wx.Button(panel, wx.ID_ANY, "Exit") pauseButton = wx.Button(panel, wx.ID_ANY, 'Pause') prevButton = wx.Button(panel, wx.ID_ANY, 'Prev') nextButton = wx.Button(panel, wx.ID_ANY, 'Next') stopButton = wx.Button(panel, wx.ID_ANY, 'Stop') #add widgets to sizer sizer.Add(pauseButton, pos=(1,10)) sizer.Add(prevButton, pos=(1,11)) sizer.Add(nextButton, pos=(1,12)) sizer.Add(stopButton, pos=(1,13)) sizer.Add(exitButton, pos=(5,13)) #initialize song time gauge #timeGauge = wx.Gauge(panel, 20) #sizer.Add(timeGauge, pos=(3,10), span=(0, 0)) #initialize menuFile widget menuFile = wx.Menu() menuFile.Append(0, "L&oad") menuFile.Append(1, "E&xit") menuBar = wx.MenuBar() menuBar.Append(menuFile, "&File") menuAbout = wx.Menu() menuAbout.Append(2, "A&bout...") menuAbout.AppendSeparator() menuBar.Append(menuAbout, "Help") self.SetMenuBar(menuBar) self.CreateStatusBar() self.SetStatusText("Welcome to Jasime!") #place sizer on panel panel.SetSizer(sizer) #initialize icon self.cd_image = wx.Image('cd_icon.png', wx.BITMAP_TYPE_PNG) self.temp = self.cd_image.ConvertToBitmap() self.size = self.temp.GetWidth(), self.temp.GetHeight() wx.StaticBitmap(parent=panel, bitmap=self.temp) #set binding self.Bind(wx.EVT_BUTTON, self.OnQuit, id=exitButton.GetId()) self.Bind(wx.EVT_BUTTON, self.pause, id=pauseButton.GetId()) self.Bind(wx.EVT_BUTTON, self.stop, id=stopButton.GetId()) self.Bind(wx.EVT_MENU, self.loadFile, id=0) self.Bind(wx.EVT_MENU, self.OnQuit, id=1) self.Bind(wx.EVT_MENU, self.OnAbout, id=2) #Load file usiing FileDialog, and create a thread for user control while running the file def loadFile(self, event): foo = wx.FileDialog(self, message="Open a .wav file...", defaultDir=os.getcwd(), defaultFile="", style=wx.FD_MULTIPLE) foo.ShowModal() self.queue = foo.GetPaths() self.threadID = 1 while len(self.queue) != 0: self.song = myThread(self.threadID, self.queue[0]) self.song.start() while self.song.isAlive(): time.sleep(2) self.queue.pop(0) self.threadID += 1 def OnQuit(self, event): self.Close() def OnAbout(self, event): wx.MessageBox("This is a great cup of tea.", "About Jasmine", wx.OK | wx.ICON_INFORMATION, self) def pause(self, event): global isPaused isPaused = not isPaused def stop(self, event): global isStopped isStopped = not isStopped class myThread (threading.Thread): def __init__(self, threadID, wf): self.threadID = threadID self.wf = wf threading.Thread.__init__(self) def run(self): global isPaused global isStopped self.waveFile = wave.open(self.wf, 'rb') #initialize stream self.p = pyaudio.PyAudio() self.stream = self.p.open(format = self.p.get_format_from_width(self.waveFile.getsampwidth()), channels = self.waveFile.getnchannels(), rate = self.waveFile.getframerate(), output = True) self.data = self.waveFile.readframes(1024) isPaused = False isStopped = False #main play loop, with pause event checking while self.data != '': # while isPaused != True: # if isStopped == False: self.stream.write(self.data) self.data = self.waveFile.readframes(1024) # elif isStopped == True: # self.stream.close() # self.p.terminate() self.stream.close() self.p.terminate() class App(wx.App): def OnInit(self): self.frame = Frame() self.frame.Show() self.SetTopWindow(self.frame) return True def main(): app = App() app.MainLoop() if __name__=='__main__': main()

    Read the article

  • Python/Biomolecular Physics- Trying to code a simple stochastic simulation of a system exhibiting co

    - by user359597
    *edited 6/17/10 I'm trying to understand how to improve my code (make it more pythonic). Also, I'm interested in writing more intuitive 'conditionals' that would describe scenarios that are commonplace in biochemistry. The conditional criteria in the below program is explained in Answer #2, but I am not satisfied with it- it is correct, but isn't obvious and isn't easy to implement for more complicated conditional scenarios. Ideas welcome. Comments/criticisms welcome. First posting experience @ stackoverflow- please comment on etiquette if needed. The code generates a list of values that are the solution to the following exercise: "In a programming language of your choice, implement Gillespie’s First Reaction Algorithm to study the temporal behaviour of the reaction A---B in which the transition from A to B can only take place if another compound, C, is present, and where C dynamically interconverts with D, as modelled in the Petri-net below. Assume that there are 100 molecules of A, 1 of C, and no B or D present at the start of the reaction. Set kAB to 0.1 s-1 and both kCD and kDC to 1.0 s-1. Simulate the behaviour of the system over 100 s." def sim(): # Set the rate constants for all transitions kAB = 0.1 kCD = 1.0 kDC = 1.0 # Set up the initial state A = 100 B = 0 C = 1 D = 0 # Set the start and end times t = 0.0 tEnd = 100.0 print "Time\t", "Transition\t", "A\t", "B\t", "C\t", "D" # Compute the first interval transition, interval = transitionData(A, B, C, D, kAB, kCD, kDC) # Loop until the end time is exceded or no transition can fire any more while t <= tEnd and transition >= 0: print t, '\t', transition, '\t', A, '\t', B, '\t', C, '\t', D t += interval if transition == 0: A -= 1 B += 1 if transition == 1: C -= 1 D += 1 if transition == 2: C += 1 D -= 1 transition, interval = transitionData(A, B, C, D, kAB, kCD, kDC) def transitionData(A, B, C, D, kAB, kCD, kDC): """ Returns nTransition, the number of the firing transition (0: A->B, 1: C->D, 2: D->C), and interval, the interval between the time of the previous transition and that of the current one. """ RAB = kAB * A * C RCD = kCD * C RDC = kDC * D dt = [-1.0, -1.0, -1.0] if RAB > 0.0: dt[0] = -math.log(1.0 - random.random())/RAB if RCD > 0.0: dt[1] = -math.log(1.0 - random.random())/RCD if RDC > 0.0: dt[2] = -math.log(1.0 - random.random())/RDC interval = 1e36 transition = -1 for n in range(len(dt)): if dt[n] > 0.0 and dt[n] < interval: interval = dt[n] transition = n return transition, interval if __name__ == '__main__': sim()

    Read the article

  • What's Wrong With My VB.NET Code Of Windows Forms Application?

    - by Krishanu Dey
    I've to forms frmPrint & frmEmail and a dataset(MyDataset) with some DataTable and DataTable Adapters. In frmPrint I've the following Sub Public Sub StartPrinting() try adapterLettersInSchedules.Fill(ds.LettersInSchedules) adapterLetters.Fill(ds.Letters) adapterClients.Fill(ds.Clients) adapterPrintJobs.GetPrintJobsDueToday(ds.PrintJobs, False, DateTime.Today) For Each prow As MyDataSet.PrintJobsRow In ds.PrintJobs Dim lisrow As MyDataSet.LettersInSchedulesRow = ds.LettersInSchedules.FindByID(prow.LetterInScheduleID) If lisrow.Isemail = False Then Dim clientrow As MyDataSet.ClientsRow = ds.Clients.FindByClientID(prow.ClientID) Dim letterrow As MyDataSet.LettersRow = ds.Letters.FindByID(lisrow.LetterID) 'prow. 'lisrow.is Label1.SuspendLayout() Label1.Refresh() Label1.Text = "Printing letter" txt.Rtf = letterrow.LetterContents txt.Rtf = txt.Rtf.Replace("<%Firstname%>", clientrow.FirstName) txt.Rtf = txt.Rtf.Replace("<%Lastname%>", clientrow.LastName) txt.Rtf = txt.Rtf.Replace("<%Title%>", clientrow.Title) txt.Rtf = txt.Rtf.Replace("<%Street%>", clientrow.Street) txt.Rtf = txt.Rtf.Replace("<%City%>", clientrow.City) txt.Rtf = txt.Rtf.Replace("<%State%>", clientrow.State) txt.Rtf = txt.Rtf.Replace("<%Zip%>", clientrow.Zip) txt.Rtf = txt.Rtf.Replace("<%PhoneH%>", clientrow.PhoneH) txt.Rtf = txt.Rtf.Replace("<%PhoneW%>", clientrow.PhoneW) txt.Rtf = txt.Rtf.Replace("<%Date%>", DateTime.Today.ToShortDateString) Try PDoc.PrinterSettings = printDlg.PrinterSettings PDoc.Print() prow.Printed = True adapterPrintJobs.Update(prow) Catch ex As Exception End Try End If Next prow ds.PrintJobs.Clear() Catch ex As Exception MessageBox.Show(ex.Message, "Print", MessageBoxButtons.OK, MessageBoxIcon.Error) End Try End Sub And in frmEmail i've the Following Sub Public Sub SendEmails() try adapterLettersInSchedules.Fill(ds.LettersInSchedules) adapterLetters.Fill(ds.Letters) adapterClients.Fill(ds.Clients) adapterEmailJobs.GetEmailJobsDueToday(ds.EmailJobs, False, Today) Dim ls_string As String For Each prow As MyDataSet.EmailJobsRow In ds.EmailJobs Dim lisrow As MyDataSet.LettersInSchedulesRow = ds.LettersInSchedules.FindByID(prow.LetterInScheduleID) If lisrow.Isemail = True Then Dim clientrow As MyDataSet.ClientsRow = ds.Clients.FindByClientID(prow.ClientID) Dim letterrow As MyDataSet.LettersRow = ds.Letters.FindByID(lisrow.LetterID) txt.Rtf = letterrow.LetterContents ls_string = RTF2HTML(txt.Rtf) ls_string = Mid(ls_string, 1, Len(ls_string) - 176) If ls_string = "" Then Throw New Exception("Rtf To HTML Conversion Failed") Label1.SuspendLayout() Label1.Refresh() Label1.Text = "Sending Email" If SendEmail(clientrow.Email, ls_string, letterrow.EmailSubject) Then Try prow.Emailed = True adapterEmailJobs.Update(prow) Catch ex As Exception End Try Else prow.Emailed = False adapterEmailJobs.Update(prow) End If End If Next prow Catch ex As Exception MessageBox.Show(ex.Message, "Email", MessageBoxButtons.OK, MessageBoxIcon.Error) End Try End Sub I'm running this two subs using two different Threads. Public th As New Thread(New ThreadStart(AddressOf StartFirstPrint)) Public th4 As New Thread(New ThreadStart(AddressOf sendFirstEmail)) Here is the code of StartFirstPrint and sendFirstEmail Public Sub StartFirstPrint() Do While thCont Try Dim frm As New frmPrint() 'frm.MdiParent = Me frm.StartPrinting() Catch ex As Exception End Try Loop End Sub Public Sub sendFirstEmail() Do While thCont Try Dim frmSNDEmail As New frmEmail frmSNDEmail.SendEmails() Catch ex As Exception End Try Loop End Sub the thCont is a public boolean variable that specifies when to shop those threads. Most Of the time this works very well. But some times it gives errors Like the following image I don't know why is this occurring. Please help me.

    Read the article

  • Python: How best to parse a simple grammar?

    - by Rosarch
    Ok, so I've asked a bunch of smaller questions about this project, but I still don't have much confidence in the designs I'm coming up with, so I'm going to ask a question on a broader scale. I am parsing pre-requisite descriptions for a course catalog. The descriptions almost always follow a certain form, which makes me think I can parse most of them. From the text, I would like to generate a graph of course pre-requisite relationships. (That part will be easy, after I have parsed the data.) Some sample inputs and outputs: "CS 2110" => ("CS", 2110) # 0 "CS 2110 and INFO 3300" => [("CS", 2110), ("INFO", 3300)] # 1 "CS 2110, INFO 3300" => [("CS", 2110), ("INFO", 3300)] # 1 "CS 2110, 3300, 3140" => [("CS", 2110), ("CS", 3300), ("CS", 3140)] # 1 "CS 2110 or INFO 3300" => [[("CS", 2110)], [("INFO", 3300)]] # 2 "MATH 2210, 2230, 2310, or 2940" => [[("MATH", 2210), ("MATH", 2230), ("MATH", 2310)], [("MATH", 2940)]] # 3 If the entire description is just a course, it is output directly. If the courses are conjoined ("and"), they are all output in the same list If the course are disjoined ("or"), they are in separate lists Here, we have both "and" and "or". One caveat that makes it easier: it appears that the nesting of "and"/"or" phrases is never greater than as shown in example 3. What is the best way to do this? I started with PLY, but I couldn't figure out how to resolve the reduce/reduce conflicts. The advantage of PLY is that it's easy to manipulate what each parse rule generates: def p_course(p): 'course : DEPT_CODE COURSE_NUMBER' p[0] = (p[1], int(p[2])) With PyParse, it's less clear how to modify the output of parseString(). I was considering building upon @Alex Martelli's idea of keeping state in an object and building up the output from that, but I'm not sure exactly how that is best done. def addCourse(self, str, location, tokens): self.result.append((tokens[0][0], tokens[0][1])) def makeCourseList(self, str, location, tokens): dept = tokens[0][0] new_tokens = [(dept, tokens[0][1])] new_tokens.extend((dept, tok) for tok in tokens[1:]) self.result.append(new_tokens) For instance, to handle "or" cases: def __init__(self): self.result = [] # ... self.statement = (course_data + Optional(OR_CONJ + course_data)).setParseAction(self.disjunctionCourses) def disjunctionCourses(self, str, location, tokens): if len(tokens) == 1: return tokens print "disjunction tokens: %s" % tokens How does disjunctionCourses() know which smaller phrases to disjoin? All it gets is tokens, but what's been parsed so far is stored in result, so how can the function tell which data in result corresponds to which elements of token? I guess I could search through the tokens, then find an element of result with the same data, but that feel convoluted... What's a better way to approach this problem?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • FILE_NOT_FOUND when trying to open COM port C++

    - by Moutabreath
    I am trying to open a com port for reading and writing using C++ but I can't seem to pass the first stage of actually opening it. I get an INVALID_HANDLE_VALUE on the handle with GetLastError FILE_NOT_FOUND. I have searched around the web for a couple of days I'm fresh out of ideas. I have searched through all the questions regarding COM on this website too. I have scanned through the existing ports (or so I believe) to get the name of the port right. I also tried combinations of _T("COM1") with the slashes, without the slashes, with colon, without colon and without the _T I'm using windows 7 on 64 bit machine. this is the code i got I'll be glad for any input on this void SendToCom(char* data, int len) { DWORD cbNeeded = 0; DWORD dwPorts = 0; EnumPorts(NULL, 1, NULL, 0, &cbNeeded, &dwPorts); //What will be the return value BOOL bSuccess = FALSE; LPCSTR COM1 ; BYTE* pPorts = static_cast<BYTE*>(malloc(cbNeeded)); bSuccess = EnumPorts(NULL, 1, pPorts, cbNeeded, &cbNeeded, &dwPorts); if (bSuccess){ PORT_INFO_1* pPortInfo = reinterpret_cast<PORT_INFO_1*>(pPorts); for (DWORD i=0; i<dwPorts; i++) { //If it looks like "COMX" then size_t nLen = _tcslen(pPortInfo->pName); if (nLen > 3) { if ((_tcsnicmp(pPortInfo->pName, _T("COM"), 3) == 0) ){ COM1 =pPortInfo->pName; //COM1 ="\\\\.\\COM1"; HANDLE m_hCommPort = CreateFile( COM1 , GENERIC_READ|GENERIC_WRITE, // access ( read and write) 0, // (share) 0:cannot share the COM port NULL, // security (None) OPEN_EXISTING, // creation : open_existing FILE_FLAG_OVERLAPPED, // we want overlapped operation NULL // no templates file for COM port... ); if (m_hCommPort==INVALID_HANDLE_VALUE) { DWORD err = GetLastError(); if (err == ERROR_FILE_NOT_FOUND) { MessageBox(hWnd,"ERROR_FILE_NOT_FOUND",NULL,MB_ABORTRETRYIGNORE); } else if(err == ERROR_INVALID_NAME) { MessageBox(hWnd,"ERROR_INVALID_NAME",NULL,MB_ABORTRETRYIGNORE); } else { MessageBox(hWnd,"unkown error",NULL,MB_ABORTRETRYIGNORE); } } else{ WriteAndReadPort(m_hCommPort,data); } } pPortInfo++; } } } }

    Read the article

  • C++ using cdb_read returns extra characters on some reads

    - by Moe Be
    Hi All, I am using the following function to loop through a couple of open CDB hash tables. Sometimes the value for a given key is returned along with an additional character (specifically a CTRL-P (a DLE character/0x16/0o020)). I have checked the cdb key/value pairs with a couple of different utilities and none of them show any additional characters appended to the values. I get the character if I use cdb_read() or cdb_getdata() (the commented out code below). If I had to guess I would say I am doing something wrong with the buffer I create to get the result from the cdb functions. Any advice or assistance is greatly appreciated. char* HashReducer::getValueFromDb(const string &id, vector <struct cdb *> &myHashFiles) { unsigned char hex_value[BUFSIZ]; size_t hex_len; //construct a real hex (not ascii-hex) value to use for database lookups atoh(id,hex_value,&hex_len); char *value = NULL; vector <struct cdb *>::iterator my_iter = myHashFiles.begin(); vector <struct cdb *>::iterator my_end = myHashFiles.end(); try { //while there are more databases to search and we have not found a match for(; my_iter != my_end && !value ; my_iter++) { //cerr << "\n looking for this MD5:" << id << " hex(" << hex_value << ") \n"; if (cdb_find(*my_iter, hex_value, hex_len)){ //cerr << "\n\nI found the key " << id << " and it is " << cdb_datalen(*my_iter) << " long\n\n"; value = (char *)malloc(cdb_datalen(*my_iter)); cdb_read(*my_iter,value,cdb_datalen(*my_iter),cdb_datapos(*my_iter)); //value = (char *)cdb_getdata(*my_iter); //cerr << "\n\nThe value is:" << value << " len is:" << strlen(value)<< "\n\n"; }; } } catch (...){} return value; }

    Read the article

  • VBScript Can not Select XML nodes

    - by urbanMethod
    I am trying to Select nodes from some webservice response XML to no avail. For some reason I am able to select the root node ("xmldata") however, when I try to drill deeper("xmldata/customers") everything is returned empty! Below is the a sample of the XML that is returned by the webservice. <xmldata> <customers> <customerid>22506</customerid> <firstname>Jim</firstname> <issuperadmin>N</issuperadmin> <lastname>Jones</lastname> </customers> </xmldata> and here is the code I am trying to select customerid, firstname, and lastname; ' Send the Xml oXMLHttp.send Xml_to_Send ' Validate the Xml dim xmlDoc set xmlDoc = Server.CreateObject("Msxml2.DOMDocument") xmlDoc.load (oXMLHttp.ResponseXML.text) if(len(xmlDoc.text) = 0) then Xml_Returned = "<B>ERROR in Response xml:<BR>ERROR DETAILS:</B><BR><HR><BR>" end if dim nodeList Set nodeList = xmlDoc.SelectNodes("xmldata/customers") For Each itemAttrib In nodeList dim custID, custLname, custFname custID =itemAttrib.selectSingleNode("customerid").text custLname =itemAttrib.selectSingleNode("lastname").text custFname =itemAttrib.selectSingleNode("firstname").text response.write("News Subject: " & custID) response.write("<br />News Subject: " & custLname) response.write("<br />News Date: " & custFname) Next The result of the code above is zilch! nothing is written to the page. One strange thing is if I select the root element and get its length as follows; Set nodeList = xmlDoc.SelectNodes("xmldata") Response.Write(nodeList.length) '1 is written to page It correctly determines the length of 1. However when I try the same with the next node down as follows; Set nodeList2 = xmlDoc.SelectNodes("xmldata/customers") Response.Write(nodeList.length) '0 is written to page It returns a length of 0. WHY! Please note that this isn't the only way I have attempted to access the values of these nodes. I just can not work out what I am doing wrong. Could someone please help me out. Cheers.

    Read the article

  • Vector of Object Pointers, general help and confusion

    - by Staypuft
    Have a homework assignment in which I'm supposed to create a vector of pointers to objects Later on down the load, I'll be using inheritance/polymorphism to extend the class to include fees for two-day delivery, next day air, etc. However, that is not my concern right now. The final goal of the current program is to just print out every object's content in the vector (name & address) and find it's shipping cost (weight*cost). My Trouble is not with the logic, I'm just confused on few points related to objects/pointers/vectors in general. But first my code. I basically cut out everything that does not mater right now, int main, will have user input, but right now I hard-coded two examples. #include <iostream> #include <string> #include <vector> using namespace std; class Package { public: Package(); //default constructor Package(string d_name, string d_add, string d_zip, string d_city, string d_state, double c, double w); double calculateCost(double, double); void Print(); ~Package(); private: string dest_name; string dest_address; string dest_zip; string dest_city; string dest_state; double weight; double cost; }; Package::Package() { cout<<"Constucting Package Object with default values: "<<endl; string dest_name=""; string dest_address=""; string dest_zip=""; string dest_city=""; string dest_state=""; double weight=0; double cost=0; } Package::Package(string d_name, string d_add, string d_zip, string d_city, string d_state, string r_name, string r_add, string r_zip, string r_city, string r_state, double w, double c){ cout<<"Constucting Package Object with user defined values: "<<endl; string dest_name=d_name; string dest_address=d_add; string dest_zip=d_zip; string dest_city=d_city; string dest_state=d_state; double weight=w; double cost=c; } Package::~Package() { cout<<"Deconstructing Package Object!"<<endl; delete Package; } double Package::calculateCost(double x, double y){ return x+y; } int main(){ double cost=0; vector<Package*> shipment; cout<<"Enter Shipping Cost: "<<endl; cin>>cost; shipment.push_back(new Package("tom r","123 thunder road", "90210", "Red Bank", "NJ", cost, 10.5)); shipment.push_back(new Package ("Harry Potter","10 Madison Avenue", "55555", "New York", "NY", cost, 32.3)); return 0; } So my questions are: I'm told I have to use a vector of Object Pointers, not Objects. Why? My assignment calls for it specifically, but I'm also told it won't work otherwise. Where should I be creating this vector? Should it be part of my Package Class? How do I go about adding objects into it then? Do I need a copy constructor? Why? What's the proper way to deconstruct my vector of object pointers? Any help would be appreciated. I've searched for a lot of related articles on here and I realize that my program will have memory leaks. Using one of the specialized ptrs from boost:: will not be available for me to use. Right now, I'm more concerned with getting the foundation of my program built. That way I can actually get down to the functionality I need to create. Thanks.

    Read the article

  • go programming POST FormValue can't be printed

    - by poor_programmer
    Before I being a bit of background, I am very new to go programming language. I am running go on Win 7, latest go package installer for windows. I'm not good at coding but I do like some challenge of learning a new language. I wanted to start learn Erlang but found go very interesting based on the GO I/O videos in youtube. I'm having problem with capturing POST form values in GO. I spend three hours yesterday to get go to print a POST form value in the browser and failed miserably. I don't know what I'm doing wrong, can anyone point me to the right direction? I can easily do this in another language like C#, PHP, VB, ASP, Rails etc. I have search the entire interweb and haven't found a working sample. Below is my sample code. Here is Index.html page {{ define "title" }}Homepage{{ end }} {{ define "content" }} <h1>My Homepage</h1> <p>Hello, and welcome to my homepage!</p> <form method="POST" action="/"> <p> Enter your name : <input type="text" name="username"> </P> <p> <button>Go</button> </form> <br /><br /> {{ end }} Here is the base page <!DOCTYPE html> <html lang="en"> <head> <title>{{ template "title" . }}</title> </head> <body> <section id="contents"> {{ template "content" . }} </section> <footer id="footer"> My homepage 2012 copy </footer> </body> </html> now some go code package main import ( "fmt" "http" "strings" "html/template" ) var index = template.Must(template.ParseFiles( "templates/_base.html", "templates/index.html", )) func GeneralHandler(w http.ResponseWriter, r *http.Request) { index.Execute(w, nil) if r.Method == "POST" { a := r.FormValue("username") fmt.Fprintf(w, "hi %s!",a); //<-- this variable does not rendered in the browser!!! } } func helloHandler(w http.ResponseWriter, r *http.Request) { remPartOfURL := r.URL.Path[len("/hello/"):] fmt.Fprintf(w, "Hello %s!", remPartOfURL) } func main() { http.HandleFunc("/", GeneralHandler) http.HandleFunc("/hello/", helloHandler) http.ListenAndServe("localhost:81", nil) } Thanks! PS: Very tedious to add four space before every line of code in stackoverflow especially when you are copy pasting. Didn't find it very user friendly or is there an easier way?

    Read the article

  • How to make item view render rich (html) text in PyQt?

    - by Giorgio Gelardi
    I'm trying to translate code from this thread in python: import sys from PyQt4.QtCore import * from PyQt4.QtGui import * __data__ = [ "Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua.", "Ut enim ad minim veniam, quis nostrud exercitation ullamco laboris nisi ut aliquip ex ea commodo consequat.", "Duis aute irure dolor in reprehenderit in voluptate velit esse cillum dolore eu fugiat nulla pariatur.", "Excepteur sint occaecat cupidatat non proident, sunt in culpa qui officia deserunt mollit anim id est laborum." ] def get_html_box(text): return '''<table border="0" width="100%"><tr width="100%" valign="top"> <td width="1%"><img src="softwarecenter.png"/></td> <td><table border="0" width="100%" height="100%"> <tr><td><b><a href="http://www.google.com">titolo</a></b></td></tr> <tr><td>{0}</td></tr><tr><td align="right">88/88/8888, 88:88</td></tr> </table></td></tr></table>'''.format(text) class HTMLDelegate(QStyledItemDelegate): def paint(self, painter, option, index): model = index.model() record = model.listdata[index.row()] doc = QTextDocument(self) doc.setHtml(get_html_box(record)) doc.setTextWidth(option.rect.width()) painter.save() ctx = QAbstractTextDocumentLayout.PaintContext() ctx.clip = QRectF(0, option.rect.top(), option.rect.width(), option.rect.height()) dl = doc.documentLayout() dl.draw(painter, ctx) painter.restore() def sizeHint(self, option, index): model = index.model() record = model.listdata[index.row()] doc = QTextDocument(self) doc.setHtml(get_html_box(record)) doc.setTextWidth(option.rect.width()) return QSize(doc.idealWidth(), doc.size().height()) class MyListModel(QAbstractListModel): def __init__(self, parent=None, *args): super(MyListModel, self).__init__(parent, *args) self.listdata = __data__ def rowCount(self, parent=QModelIndex()): return len(self.listdata) def data(self, index, role=Qt.DisplayRole): return index.isValid() and QVariant(self.listdata[index.row()]) or QVariant() class MyWindow(QWidget): def __init__(self, *args): super(MyWindow, self).__init__(*args) # listview self.lv = QListView() self.lv.setModel(MyListModel(self)) self.lv.setItemDelegate(HTMLDelegate(self)) self.lv.setResizeMode(QListView.Adjust) # layout layout = QVBoxLayout() layout.addWidget(self.lv) self.setLayout(layout) if __name__ == "__main__": app = QApplication(sys.argv) w = MyWindow() w.show() sys.exit(app.exec_()) Element's size and position are not calculated correctly I guess, perhaps because I haven't understand at all the style related parts from original code. Can someone help me?

    Read the article

  • Searching for duplicate records within a text file where the duplicate is determined by only two fie

    - by plg
    First, Python Newbie; be patient/kind. Next, once a month I receive a large text file (think 7 Million records) to test for duplicate values. This is catalog information. I get 7 fields, but the two I'm interested in are a supplier code and a full orderable part number. To determine if the record is dupliacted, I compress all special characters from the part number (except . and #) and create a compressed part number. The test for duplicates becomes the supplier code and compressed part number combination. This part is fairly straight forward. Currently, I am just copying the original file with 2 new columns (compressed part and duplicate indicator). If the part is a duplicate, I put a "YES" in the last field. Now that this is done, I want to be able to go back (or better yet, at the same time) to get the previous record where there was a supplier code/compressed part number match. So far, my code looks like this: Compress Full Part to a Compressed Part and Check for Duplicates on Supplier Code and Compressed Part combination import sys import re import time ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ start=time.time() try: file1 = open("C:\Accounting\May Accounting\May.txt", "r") except IOError: print sys.stderr, "Cannot Open Read File" sys.exit(1) try: file2 = open(file1.name[0:len(file1.name)-4] + "_" + "COMPRESSPN.txt", "a") except IOError: print sys.stderr, "Cannot Open Write File" sys.exit(1) hdrList="CIGSUPPLIER|FULL_PART|PART_STATUS|ALIAS_FLAG|ACQUISITION_FLAG|COMPRESSED_PART|DUPLICATE_INDICATOR" file2.write(hdrList+chr(10)) lines_seen=set() affirm="YES" records = file1.readlines() for record in records: fields = record.split(chr(124)) if fields[0]=="CIGSupplier": continue #If incoming file has a header line, skip it file2.write(fields[0]+"|"), #Supplier Code file2.write(fields[1]+"|"), #Full_Part file2.write(fields[2]+"|"), #Part Status file2.write(fields[3]+"|"), #Alias Flag file2.write(re.sub("[$\r\n]", "", fields[4])+"|"), #Acquisition Flag file2.write(re.sub("[^0-9a-zA-Z.#]", "", fields[1])+"|"), #Compressed_Part dupechk=fields[0]+"|"+re.sub("[^0-9a-zA-Z.#]", "", fields[1]) if dupechk not in lines_seen: file2.write(chr(10)) lines_seen.add(dupechk) else: file2.write(affirm+chr(10)) print "it took", time.time() - start, "seconds." ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ file2.close() file1.close() It runs in less than 6 minutes, so I am happy with this part, even if it is not elegant. Right now, when I get my results, I import the results into Access and do a self join to locate the duplicates. Loading/querying/exporting results in Access a file this size takes around an hour, so I would like to be able to export the matched duplicates to another text file or an Excel file. Confusing enough? Thanks.

    Read the article

  • How can I obtain the IP address of my server program?

    - by Dr Dork
    Hello! This question is related to another question I just posted. I'm prepping for a simple work project and am trying to familiarize myself with the basics of socket programming in a Unix dev environment. At this point, I have some basic server side code and client side code setup to communicate. Currently, my client code successfully connects to the server code and the server code sends it a test message, then both quit out. Perfect! That's exactly what I wanted to accomplish. Now I'm playing around with the functions used to obtain info about the two environments (server and client). I'd like to obtain my server program's IP address. Here's the code I currently have to do this, but it's not working... int sockfd; unsigned int len; socklen_t sin_size; char msg[]="test message"; char buf[MAXLEN]; int st, rv; struct addrinfo hints, *serverinfo, *p; struct sockaddr_storage client; char s[INET6_ADDRSTRLEN]; char ip[INET6_ADDRSTRLEN]; //zero struct memset(&hints,0,sizeof(hints)); hints.ai_family = AF_UNSPEC; hints.ai_socktype = SOCK_STREAM; hints.ai_flags = AI_PASSIVE; //get the server info if((rv = getaddrinfo(NULL, SERVERPORT, &hints, &serverinfo ) != 0)){ perror("getaddrinfo"); exit(-1); } // loop through all the results and bind to the first we can for( p = serverinfo; p != NULL; p = p->ai_next) { //Setup the socket if( (sockfd = socket( p->ai_family, p->ai_socktype, p->ai_protocol )) == -1 ) { perror("socket"); continue; } //Associate a socket id with an address to which other processes can connect if(bind(sockfd, p->ai_addr, p->ai_addrlen) == -1){ close(sockfd); perror("bind"); continue; } break; } if( p == NULL ){ perror("Fail to bind"); } inet_ntop(p->ai_family, get_in_addr((struct sockaddr *)p->ai_addr), s, sizeof(s)); printf("Server has TCP Port %s and IP Address %s\n", SERVERPORT, s); and the output for the IP is always empty... server has TCP Port 21412 and IP Address :: any ideas for what I'm missing? thanks in advance for your help! this stuff is really complicated at first.

    Read the article

  • Socket connection to a telnet-based server hangs on read

    - by mixwhit
    I'm trying to write a simple socket-based client in Python that will connect to a telnet server. I can test the server by telnetting to its port (5007), and entering text. It responds with a NAK (error) or an AK (success), sometimes accompanied by other text. Seems very simple. I wrote a client to connect and communicate with the server, but it hangs on the first attempt to read the response. The connection is successful. Queries like getsockname and getpeername are successful. The send command returns a value that equals the number of characters I'm sending, so it seems to be sending correctly. But in the end, it always hangs when I try to read the response. I've tried using both file-based objects like readline and write (via socket.makefile), as well as using send and recv. With the file object I tried making it with "rw" and reading and writing via that object, and later tried one object for "r" and another for "w" to separate them. None of these worked. I used a packet sniffer to watch what's going on. I'm not versed in all that I'm seeing, but during a telnet session I can see my typed text and the server's text coming back. During my Python socket connection, I can see my text going to the server, but packets back don't seem to have any text in them. Any ideas on what I'm doing wrong, or any strategies to try? Here's the code I'm using (in this case, it's with send and recv): #!/usr/bin/python host = "localhost" port = 5007 msg = "HELLO EMC 1 1" msg2 = "HELLO" import socket import sys try: skt = socket.socket(socket.AF_INET, socket.SOCK_STREAM) except socket.error, e: print("Error creating socket: %s" % e) sys.exit(1) try: skt.connect((host,port)) except socket.gaierror, e: print("Address-related error connecting to server: %s" % e) sys.exit(1) except socket.error, e: print("Error connecting to socket: %s" % e) sys.exit(1) try: print(skt.send(msg)) print("SEND: %s" % msg) except socket.error, e: print("Error sending data: %s" % e) sys.exit(1) while 1: try: buf = skt.recv(1024) print("RECV: %s" % buf) except socket.error, e: print("Error receiving data: %s" % e) sys.exit(1) if not len(buf): break sys.stdout.write(buf)

    Read the article

  • factory class, wrong number of arguments being passed to subclass constructor

    - by Hugh Bothwell
    I was looking at Python: Exception in the separated module works wrong which uses a multi-purpose GnuLibError class to 'stand in' for a variety of different errors. Each sub-error has its own ID number and error format string. I figured it would be better written as a hierarchy of Exception classes, and set out to do so: class GNULibError(Exception): sub_exceptions = 0 # patched with dict of subclasses once subclasses are created err_num = 0 err_format = None def __new__(cls, *args): print("new {}".format(cls)) # DEBUG if len(args) and args[0] in GNULibError.sub_exceptions: print(" factory -> {} {}".format(GNULibError.sub_exceptions[args[0]], args[1:])) # DEBUG return super(GNULibError, cls).__new__(GNULibError.sub_exceptions[args[0]], *(args[1:])) else: print(" plain {} {}".format(cls, args)) # DEBUG return super(GNULibError, cls).__new__(cls, *args) def __init__(self, *args): cls = type(self) print("init {} {}".format(cls, args)) # DEBUG self.args = args if cls.err_format is None: self.message = str(args) else: self.message = "[GNU Error {}] ".format(cls.err_num) + cls.err_format.format(*args) def __str__(self): return self.message def __repr__(self): return '{}{}'.format(type(self).__name__, self.args) class GNULibError_Directory(GNULibError): err_num = 1 err_format = "destination directory does not exist: {}" class GNULibError_Config(GNULibError): err_num = 2 err_format = "configure file does not exist: {}" class GNULibError_Module(GNULibError): err_num = 3 err_format = "selected module does not exist: {}" class GNULibError_Cache(GNULibError): err_num = 4 err_format = "{} is expected to contain gl_M4_BASE({})" class GNULibError_Sourcebase(GNULibError): err_num = 5 err_format = "missing sourcebase argument: {}" class GNULibError_Docbase(GNULibError): err_num = 6 err_format = "missing docbase argument: {}" class GNULibError_Testbase(GNULibError): err_num = 7 err_format = "missing testsbase argument: {}" class GNULibError_Libname(GNULibError): err_num = 8 err_format = "missing libname argument: {}" # patch master class with subclass reference # (TO DO: auto-detect all available subclasses instead of hardcoding them) GNULibError.sub_exceptions = { 1: GNULibError_Directory, 2: GNULibError_Config, 3: GNULibError_Module, 4: GNULibError_Cache, 5: GNULibError_Sourcebase, 6: GNULibError_Docbase, 7: GNULibError_Testbase, 8: GNULibError_Libname } This starts out with GNULibError as a factory class - if you call it with an error number belonging to a recognized subclass, it returns an object belonging to that subclass, otherwise it returns itself as a default error type. Based on this code, the following should be exactly equivalent (but aren't): e = GNULibError(3, 'missing.lib') f = GNULibError_Module('missing.lib') print e # -> '[GNU Error 3] selected module does not exist: 3' print f # -> '[GNU Error 3] selected module does not exist: missing.lib' I added some strategic print statements, and the error seems to be in GNULibError.__new__: >>> e = GNULibError(3, 'missing.lib') new <class '__main__.GNULibError'> factory -> <class '__main__.GNULibError_Module'> ('missing.lib',) # good... init <class '__main__.GNULibError_Module'> (3, 'missing.lib') # NO! ^ why? I call the subclass constructor as subclass.__new__(*args[1:]) - this should drop the 3, the subclass type ID - and yet its __init__ is still getting the 3 anyway! How can I trim the argument list that gets passed to subclass.__init__?

    Read the article

  • Top things web developers should know about the Visual Studio 2013 release

    - by Jon Galloway
    ASP.NET and Web Tools for Visual Studio 2013 Release NotesASP.NET and Web Tools for Visual Studio 2013 Release NotesSummary for lazy readers: Visual Studio 2013 is now available for download on the Visual Studio site and on MSDN subscriber downloads) Visual Studio 2013 installs side by side with Visual Studio 2012 and supports round-tripping between Visual Studio versions, so you can try it out without committing to a switch Visual Studio 2013 ships with the new version of ASP.NET, which includes ASP.NET MVC 5, ASP.NET Web API 2, Razor 3, Entity Framework 6 and SignalR 2.0 The new releases ASP.NET focuses on One ASP.NET, so core features and web tools work the same across the platform (e.g. adding ASP.NET MVC controllers to a Web Forms application) New core features include new templates based on Bootstrap, a new scaffolding system, and a new identity system Visual Studio 2013 is an incredible editor for web files, including HTML, CSS, JavaScript, Markdown, LESS, Coffeescript, Handlebars, Angular, Ember, Knockdown, etc. Top links: Visual Studio 2013 content on the ASP.NET site are in the standard new releases area: http://www.asp.net/vnext ASP.NET and Web Tools for Visual Studio 2013 Release Notes Short intro videos on the new Visual Studio web editor features from Scott Hanselman and Mads Kristensen Announcing release of ASP.NET and Web Tools for Visual Studio 2013 post on the official .NET Web Development and Tools Blog Scott Guthrie's post: Announcing the Release of Visual Studio 2013 and Great Improvements to ASP.NET and Entity Framework Okay, for those of you who are still with me, let's dig in a bit. Quick web dev notes on downloading and installing Visual Studio 2013 I found Visual Studio 2013 to be a pretty fast install. According to Brian Harry's release post, installing over pre-release versions of Visual Studio is supported.  I've installed the release version over pre-release versions, and it worked fine. If you're only going to be doing web development, you can speed up the install if you just select Web Developer tools. Of course, as a good Microsoft employee, I'll mention that you might also want to install some of those other features, like the Store apps for Windows 8 and the Windows Phone 8.0 SDK, but they do download and install a lot of other stuff (e.g. the Windows Phone SDK sets up Hyper-V and downloads several GB's of VM's). So if you're planning just to do web development for now, you can pick just the Web Developer Tools and install the other stuff later. If you've got a fast internet connection, I recommend using the web installer instead of downloading the ISO. The ISO includes all the features, whereas the web installer just downloads what you're installing. Visual Studio 2013 development settings and color theme When you start up Visual Studio, it'll prompt you to pick some defaults. These are totally up to you -whatever suits your development style - and you can change them later. As I said, these are completely up to you. I recommend either the Web Development or Web Development (Code Only) settings. The only real difference is that Code Only hides the toolbars, and you can switch between them using Tools / Import and Export Settings / Reset. Web Development settings Web Development (code only) settings Usually I've just gone with Web Development (code only) in the past because I just want to focus on the code, although the Standard toolbar does make it easier to switch default web browsers. More on that later. Color theme Sigh. Okay, everyone's got their favorite colors. I alternate between Light and Dark depending on my mood, and I personally like how the low contrast on the window chrome in those themes puts the emphasis on my code rather than the tabs and toolbars. I know some people got pretty worked up over that, though, and wanted the blue theme back. I personally don't like it - it reminds me of ancient versions of Visual Studio that I don't want to think about anymore. So here's the thing: if you install Visual Studio Ultimate, it defaults to Blue. The other versions default to Light. If you use Blue, I won't criticize you - out loud, that is. You can change themes really easily - either Tools / Options / Environment / General, or the smart way: ctrl+q for quick launch, then type Theme and hit enter. Signing in During the first run, you'll be prompted to sign in. You don't have to - you can click the "Not now, maybe later" link at the bottom of that dialog. I recommend signing in, though. It's not hooked in with licensing or tracking the kind of code you write to sell you components. It is doing good things, like  syncing your Visual Studio settings between computers. More about that here. So, you don't have to, but I sure do. Overview of shiny new things in ASP.NET land There are a lot of good new things in ASP.NET. I'll list some of my favorite here, but you can read more on the ASP.NET site. One ASP.NET You've heard us talk about this for a while. The idea is that options are good, but choice can be a burden. When you start a new ASP.NET project, why should you have to make a tough decision - with long-term consequences - about how your application will work? If you want to use ASP.NET Web Forms, but have the option of adding in ASP.NET MVC later, why should that be hard? It's all ASP.NET, right? Ideally, you'd just decide that you want to use ASP.NET to build sites and services, and you could use the appropriate tools (the green blocks below) as you needed them. So, here it is. When you create a new ASP.NET application, you just create an ASP.NET application. Next, you can pick from some templates to get you started... but these are different. They're not "painful decision" templates, they're just some starting pieces. And, most importantly, you can mix and match. I can pick a "mostly" Web Forms template, but include MVC and Web API folders and core references. If you've tried to mix and match in the past, you're probably aware that it was possible, but not pleasant. ASP.NET MVC project files contained special project type GUIDs, so you'd only get controller scaffolding support in a Web Forms project if you manually edited the csproj file. Features in one stack didn't work in others. Project templates were painful choices. That's no longer the case. Hooray! I just did a demo in a presentation last week where I created a new Web Forms + MVC + Web API site, built a model, scaffolded MVC and Web API controllers with EF Code First, add data in the MVC view, viewed it in Web API, then added a GridView to the Web Forms Default.aspx page and bound it to the Model. In about 5 minutes. Sure, it's a simple example, but it's great to be able to share code and features across the whole ASP.NET family. Authentication In the past, authentication was built into the templates. So, for instance, there was an ASP.NET MVC 4 Intranet Project template which created a new ASP.NET MVC 4 application that was preconfigured for Windows Authentication. All of that authentication stuff was built into each template, so they varied between the stacks, and you couldn't reuse them. You didn't see a lot of changes to the authentication options, since they required big changes to a bunch of project templates. Now, the new project dialog includes a common authentication experience. When you hit the Change Authentication button, you get some common options that work the same way regardless of the template or reference settings you've made. These options work on all ASP.NET frameworks, and all hosting environments (IIS, IIS Express, or OWIN for self-host) The default is Individual User Accounts: This is the standard "create a local account, using username / password or OAuth" thing; however, it's all built on the new Identity system. More on that in a second. The one setting that has some configuration to it is Organizational Accounts, which lets you configure authentication using Active Directory, Windows Azure Active Directory, or Office 365. Identity There's a new identity system. We've taken the best parts of the previous ASP.NET Membership and Simple Identity systems, rolled in a lot of feedback and made big enhancements to support important developer concerns like unit testing and extensiblity. I've written long posts about ASP.NET identity, and I'll do it again. Soon. This is not that post. The short version is that I think we've finally got just the right Identity system. Some of my favorite features: There are simple, sensible defaults that work well - you can File / New / Run / Register / Login, and everything works. It supports standard username / password as well as external authentication (OAuth, etc.). It's easy to customize without having to re-implement an entire provider. It's built using pluggable pieces, rather than one large monolithic system. It's built using interfaces like IUser and IRole that allow for unit testing, dependency injection, etc. You can easily add user profile data (e.g. URL, twitter handle, birthday). You just add properties to your ApplicationUser model and they'll automatically be persisted. Complete control over how the identity data is persisted. By default, everything works with Entity Framework Code First, but it's built to support changes from small (modify the schema) to big (use another ORM, store your data in a document database or in the cloud or in XML or in the EXIF data of your desktop background or whatever). It's configured via OWIN. More on OWIN and Katana later, but the fact that it's built using OWIN means it's portable. You can find out more in the Authentication and Identity section of the ASP.NET site (and lots more content will be going up there soon). New Bootstrap based project templates The new project templates are built using Bootstrap 3. Bootstrap (formerly Twitter Bootstrap) is a front-end framework that brings a lot of nice benefits: It's responsive, so your projects will automatically scale to device width using CSS media queries. For example, menus are full size on a desktop browser, but on narrower screens you automatically get a mobile-friendly menu. The built-in Bootstrap styles make your standard page elements (headers, footers, buttons, form inputs, tables etc.) look nice and modern. Bootstrap is themeable, so you can reskin your whole site by dropping in a new Bootstrap theme. Since Bootstrap is pretty popular across the web development community, this gives you a large and rapidly growing variety of templates (free and paid) to choose from. Bootstrap also includes a lot of very useful things: components (like progress bars and badges), useful glyphicons, and some jQuery plugins for tooltips, dropdowns, carousels, etc.). Here's a look at how the responsive part works. When the page is full screen, the menu and header are optimized for a wide screen display: When I shrink the page down (this is all based on page width, not useragent sniffing) the menu turns into a nice mobile-friendly dropdown: For a quick example, I grabbed a new free theme off bootswatch.com. For simple themes, you just need to download the boostrap.css file and replace the /content/bootstrap.css file in your project. Now when I refresh the page, I've got a new theme: Scaffolding The big change in scaffolding is that it's one system that works across ASP.NET. You can create a new Empty Web project or Web Forms project and you'll get the Scaffold context menus. For release, we've got MVC 5 and Web API 2 controllers. We had a preview of Web Forms scaffolding in the preview releases, but they weren't fully baked for RTM. Look for them in a future update, expected pretty soon. This scaffolding system wasn't just changed to work across the ASP.NET frameworks, it's also built to enable future extensibility. That's not in this release, but should also hopefully be out soon. Project Readme page This is a small thing, but I really like it. When you create a new project, you get a Project_Readme.html page that's added to the root of your project and opens in the Visual Studio built-in browser. I love it. A long time ago, when you created a new project we just dumped it on you and left you scratching your head about what to do next. Not ideal. Then we started adding a bunch of Getting Started information to the new project templates. That told you what to do next, but you had to delete all of that stuff out of your website. It doesn't belong there. Not ideal. This is a simple HTML file that's not integrated into your project code at all. You can delete it if you want. But, it shows a lot of helpful links that are current for the project you just created. In the future, if we add new wacky project types, they can create readme docs with specific information on how to do appropriately wacky things. Side note: I really like that they used the internal browser in Visual Studio to show this content rather than popping open an HTML page in the default browser. I hate that. It's annoying. If you're doing that, I hope you'll stop. What if some unnamed person has 40 or 90 tabs saved in their browser session? When you pop open your "Thanks for installing my Visual Studio extension!" page, all eleventy billion tabs start up and I wish I'd never installed your thing. Be like these guys and pop stuff Visual Studio specific HTML docs in the Visual Studio browser. ASP.NET MVC 5 The biggest change with ASP.NET MVC 5 is that it's no longer a separate project type. It integrates well with the rest of ASP.NET. In addition to that and the other common features we've already looked at (Bootstrap templates, Identity, authentication), here's what's new for ASP.NET MVC. Attribute routing ASP.NET MVC now supports attribute routing, thanks to a contribution by Tim McCall, the author of http://attributerouting.net. With attribute routing you can specify your routes by annotating your actions and controllers. This supports some pretty complex, customized routing scenarios, and it allows you to keep your route information right with your controller actions if you'd like. Here's a controller that includes an action whose method name is Hiding, but I've used AttributeRouting to configure it to /spaghetti/with-nesting/where-is-waldo public class SampleController : Controller { [Route("spaghetti/with-nesting/where-is-waldo")] public string Hiding() { return "You found me!"; } } I enable that in my RouteConfig.cs, and I can use that in conjunction with my other MVC routes like this: public class RouteConfig { public static void RegisterRoutes(RouteCollection routes) { routes.IgnoreRoute("{resource}.axd/{*pathInfo}"); routes.MapMvcAttributeRoutes(); routes.MapRoute( name: "Default", url: "{controller}/{action}/{id}", defaults: new { controller = "Home", action = "Index", id = UrlParameter.Optional } ); } } You can read more about Attribute Routing in ASP.NET MVC 5 here. Filter enhancements There are two new additions to filters: Authentication Filters and Filter Overrides. Authentication filters are a new kind of filter in ASP.NET MVC that run prior to authorization filters in the ASP.NET MVC pipeline and allow you to specify authentication logic per-action, per-controller, or globally for all controllers. Authentication filters process credentials in the request and provide a corresponding principal. Authentication filters can also add authentication challenges in response to unauthorized requests. Override filters let you change which filters apply to a given action method or controller. Override filters specify a set of filter types that should not be run for a given scope (action or controller). This allows you to configure filters that apply globally but then exclude certain global filters from applying to specific actions or controllers. ASP.NET Web API 2 ASP.NET Web API 2 includes a lot of new features. Attribute Routing ASP.NET Web API supports the same attribute routing system that's in ASP.NET MVC 5. You can read more about the Attribute Routing features in Web API in this article. OAuth 2.0 ASP.NET Web API picks up OAuth 2.0 support, using security middleware running on OWIN (discussed below). This is great for features like authenticated Single Page Applications. OData Improvements ASP.NET Web API now has full OData support. That required adding in some of the most powerful operators: $select, $expand, $batch and $value. You can read more about OData operator support in this article by Mike Wasson. Lots more There's a huge list of other features, including CORS (cross-origin request sharing), IHttpActionResult, IHttpRequestContext, and more. I think the best overview is in the release notes. OWIN and Katana I've written about OWIN and Katana recently. I'm a big fan. OWIN is the Open Web Interfaces for .NET. It's a spec, like HTML or HTTP, so you can't install OWIN. The benefit of OWIN is that it's a community specification, so anyone who implements it can plug into the ASP.NET stack, either as middleware or as a host. Katana is the Microsoft implementation of OWIN. It leverages OWIN to wire up things like authentication, handlers, modules, IIS hosting, etc., so ASP.NET can host OWIN components and Katana components can run in someone else's OWIN implementation. Howard Dierking just wrote a cool article in MSDN magazine describing Katana in depth: Getting Started with the Katana Project. He had an interesting example showing an OWIN based pipeline which leveraged SignalR, ASP.NET Web API and NancyFx components in the same stack. If this kind of thing makes sense to you, that's great. If it doesn't, don't worry, but keep an eye on it. You're going to see some cool things happen as a result of ASP.NET becoming more and more pluggable. Visual Studio Web Tools Okay, this stuff's just crazy. Visual Studio has been adding some nice web dev features over the past few years, but they've really cranked it up for this release. Visual Studio is by far my favorite code editor for all web files: CSS, HTML, JavaScript, and lots of popular libraries. Stop thinking of Visual Studio as a big editor that you only use to write back-end code. Stop editing HTML and CSS in Notepad (or Sublime, Notepad++, etc.). Visual Studio starts up in under 2 seconds on a modern computer with an SSD. Misspelling HTML attributes or your CSS classes or jQuery or Angular syntax is stupid. It doesn't make you a better developer, it makes you a silly person who wastes time. Browser Link Browser Link is a real-time, two-way connection between Visual Studio and all connected browsers. It's only attached when you're running locally, in debug, but it applies to any and all connected browser, including emulators. You may have seen demos that showed the browsers refreshing based on changes in the editor, and I'll agree that's pretty cool. But it's really just the start. It's a two-way connection, and it's built for extensiblity. That means you can write extensions that push information from your running application (in IE, Chrome, a mobile emulator, etc.) back to Visual Studio. Mads and team have showed off some demonstrations where they enabled edit mode in the browser which updated the source HTML back on the browser. It's also possible to look at how the rendered HTML performs, check for compatibility issues, watch for unused CSS classes, the sky's the limit. New HTML editor The previous HTML editor had a lot of old code that didn't allow for improvements. The team rewrote the HTML editor to take advantage of the new(ish) extensibility features in Visual Studio, which then allowed them to add in all kinds of features - things like CSS Class and ID IntelliSense (so you type style="" and get a list of classes and ID's for your project), smart indent based on how your document is formatted, JavaScript reference auto-sync, etc. Here's a 3 minute tour from Mads Kristensen. The previous HTML editor had a lot of old code that didn't allow for improvements. The team rewrote the HTML editor to take advantage of the new(ish) extensibility features in Visual Studio, which then allowed them to add in all kinds of features - things like CSS Class and ID IntelliSense (so you type style="" and get a list of classes and ID's for your project), smart indent based on how your document is formatted, JavaScript reference auto-sync, etc. Lots more Visual Studio web dev features That's just a sampling - there's a ton of great features for JavaScript editing, CSS editing, publishing, and Page Inspector (which shows real-time rendering of your page inside Visual Studio). Here are some more short videos showing those features. Lots, lots more Okay, that's just a summary, and it's still quite a bit. Head on over to http://asp.net/vnext for more information, and download Visual Studio 2013 now to get started!

    Read the article

  • Cisco VPN Client dropping connection

    - by IT Team
    Using Windows XP and Cisco VPN client version 5.0.4.xxx to connect to a remote customer site. We are able to establish the connection and start an RDP session, but within 1-2 minutes the connection drops and the VPN connection disconnects. The PC making the connection is on a DMZ which is NATed to a public IP address. If we move the PC directly onto the internet without being on the DMZ the connection works and we don't encounter any disconnects. We use a PIX 515E running 7.2.4 and don't have any problems with similar setups connecting to other customer sites from the DMZ. The VPN setup on the client side is pretty basic, using IPSec over TCP port 10000. Not sure what device they are using on the peer, but my guess would be an ASA. Any idea as to what the problem would be? Below is the logs from the VPN client when the problem occurs. The real IP address has been changed to: RemotePeerIP. 4 14:39:30.593 09/23/09 Sev=Info/4 CM/0x63100024 Attempt connection with server "RemotePeerIP" 5 14:39:30.593 09/23/09 Sev=Info/6 CM/0x6310002F Allocated local TCP port 1942 for TCP connection. 6 14:39:30.796 09/23/09 Sev=Info/4 IPSEC/0x63700008 IPSec driver successfully started 7 14:39:30.796 09/23/09 Sev=Info/4 IPSEC/0x63700014 Deleted all keys 8 14:39:30.796 09/23/09 Sev=Info/6 IPSEC/0x6370002C Sent 256 packets, 0 were fragmented. 9 14:39:30.796 09/23/09 Sev=Info/6 IPSEC/0x63700020 TCP SYN sent to RemotePeerIP, src port 1942, dst port 10000 10 14:39:30.796 09/23/09 Sev=Info/6 IPSEC/0x6370001C TCP SYN-ACK received from RemotePeerIP, src port 10000, dst port 1942 11 14:39:30.796 09/23/09 Sev=Info/6 IPSEC/0x63700021 TCP ACK sent to RemotePeerIP, src port 1942, dst port 10000 12 14:39:30.796 09/23/09 Sev=Warning/3 IPSEC/0xA370001C Bad cTCP trailer, Rsvd 26984, Magic# 63697672h, trailer len 101, MajorVer 13, MinorVer 10 13 14:39:30.796 09/23/09 Sev=Info/4 CM/0x63100029 TCP connection established on port 10000 with server "RemotePeerIP" 14 14:39:31.296 09/23/09 Sev=Info/4 CM/0x63100024 Attempt connection with server "RemotePeerIP" 15 14:39:31.296 09/23/09 Sev=Info/6 IKE/0x6300003B Attempting to establish a connection with RemotePeerIP. 16 14:39:31.296 09/23/09 Sev=Info/4 IKE/0x63000013 SENDING ISAKMP OAK AG (SA, KE, NON, ID, VID(Xauth), VID(dpd), VID(Frag), VID(Unity)) to RemotePeerIP 17 14:39:36.296 09/23/09 Sev=Info/4 IKE/0x63000021 Retransmitting last packet! 18 14:39:36.296 09/23/09 Sev=Info/4 IKE/0x63000013 SENDING ISAKMP OAK AG (Retransmission) to RemotePeerIP 19 14:39:41.296 09/23/09 Sev=Info/4 IKE/0x63000021 Retransmitting last packet! 20 14:39:41.296 09/23/09 Sev=Info/4 IKE/0x63000013 SENDING ISAKMP OAK AG (Retransmission) to RemotePeerIP 21 14:39:46.296 09/23/09 Sev=Info/4 IKE/0x63000021 Retransmitting last packet! 22 14:39:46.296 09/23/09 Sev=Info/4 IKE/0x63000013 SENDING ISAKMP OAK AG (Retransmission) to RemotePeerIP 23 14:39:51.328 09/23/09 Sev=Info/4 IKE/0x63000017 Marking IKE SA for deletion (I_Cookie=AEFC3FFF0405BBD6 R_Cookie=0000000000000000) reason = DEL_REASON_PEER_NOT_RESPONDING 24 14:39:51.828 09/23/09 Sev=Info/4 IKE/0x6300004B Discarding IKE SA negotiation (I_Cookie=AEFC3FFF0405BBD6 R_Cookie=0000000000000000) reason = DEL_REASON_PEER_NOT_RESPONDING 25 14:39:51.828 09/23/09 Sev=Info/4 CM/0x63100014 Unable to establish Phase 1 SA with server "RemotePeerIP" because of "DEL_REASON_PEER_NOT_RESPONDING" 26 14:39:51.828 09/23/09 Sev=Info/5 CM/0x63100025 Initializing CVPNDrv 27 14:39:51.828 09/23/09 Sev=Info/4 CM/0x6310002D Resetting TCP connection on port 10000 28 14:39:51.828 09/23/09 Sev=Info/6 CM/0x63100030 Removed local TCP port 1942 for TCP connection. 29 14:39:51.828 09/23/09 Sev=Info/6 CM/0x63100046 Set tunnel established flag in registry to 0. 30 14:39:51.828 09/23/09 Sev=Info/4 IKE/0x63000001 IKE received signal to terminate VPN connection 31 14:39:52.328 09/23/09 Sev=Info/6 IPSEC/0x63700023 TCP RST sent to RemotePeerIP, src port 1942, dst port 10000 32 14:39:52.328 09/23/09 Sev=Info/4 IPSEC/0x63700014 Deleted all keys 33 14:39:52.328 09/23/09 Sev=Info/4 IPSEC/0x63700014 Deleted all keys 34 14:39:52.328 09/23/09 Sev=Info/4 IPSEC/0x63700014 Deleted all keys 35 14:39:52.328 09/23/09 Sev=Info/4 IPSEC/0x6370000A IPSec driver successfully stopped Thank you for any help you can provide.

    Read the article

  • Using SQL Execution Plans to discover the Swedish alphabet

    - by Rob Farley
    SQL Server is quite remarkable in a bunch of ways. In this post, I’m using the way that the Query Optimizer handles LIKE to keep it SARGable, the Execution Plans that result, Collations, and PowerShell to come up with the Swedish alphabet. SARGability is the ability to seek for items in an index according to a particular set of criteria. If you don’t have SARGability in play, you need to scan the whole index (or table if you don’t have an index). For example, I can find myself in the phonebook easily, because it’s sorted by LastName and I can find Farley in there by moving to the Fs, and so on. I can’t find everyone in my suburb easily, because the phonebook isn’t sorted that way. I can’t even find people who have six letters in their last name, because also the book is sorted by LastName, it’s not sorted by LEN(LastName). This is all stuff I’ve looked at before, including in the talk I gave at SQLBits in October 2010. If I try to find everyone who’s names start with F, I can do that using a query a bit like: SELECT LastName FROM dbo.PhoneBook WHERE LEFT(LastName,1) = 'F'; Unfortunately, the Query Optimizer doesn’t realise that all the entries that satisfy LEFT(LastName,1) = 'F' will be together, and it has to scan the whole table to find them. But if I write: SELECT LastName FROM dbo.PhoneBook WHERE LastName LIKE 'F%'; then SQL is smart enough to understand this, and performs an Index Seek instead. To see why, I look further into the plan, in particular, the properties of the Index Seek operator. The ToolTip shows me what I’m after: You’ll see that it does a Seek to find any entries that are at least F, but not yet G. There’s an extra Predicate in there (a Residual Predicate if you like), which checks that each LastName is really LIKE F% – I suppose it doesn’t consider that the Seek Predicate is quite enough – but most of the benefit is seen by its working out the Seek Predicate, filtering to just the “at least F but not yet G” section of the data. This got me curious though, particularly about where the G comes from, and whether I could leverage it to create the Swedish alphabet. I know that in the Swedish language, there are three extra letters that appear at the end of the alphabet. One of them is ä that appears in the word Västerås. It turns out that Västerås is quite hard to find in an index when you’re looking it up in a Swedish map. I talked about this briefly in my five-minute talk on Collation from SQLPASS (the one which was slightly less than serious). So by looking at the plan, I can work out what the next letter is in the alphabet of the collation used by the column. In other words, if my alphabet were Swedish, I’d be able to tell what the next letter after F is – just in case it’s not G. It turns out it is… Yes, the Swedish letter after F is G. But I worked this out by using a copy of my PhoneBook table that used the Finnish_Swedish_CI_AI collation. I couldn’t find how the Query Optimizer calculates the G, and my friend Paul White (@SQL_Kiwi) tells me that it’s frustratingly internal to the QO. He’s particularly smart, even if he is from New Zealand. To investigate further, I decided to do some PowerShell, leveraging the Get-SqlPlan function that I blogged about recently (make sure you also have the SqlServerCmdletSnapin100 snap-in added). I started by indicating that I was going to use Finnish_Swedish_CI_AI as my collation of choice, and that I’d start whichever letter cam straight after the number 9. I figure that this is a cheat’s way of guessing the first letter of the alphabet (but it doesn’t actually work in Unicode – luckily I’m using varchar not nvarchar. Actually, there are a few aspects of this code that only work using ASCII, so apologies if you were wanting to apply it to Greek, Japanese, etc). I also initialised my $alphabet variable. $collation = 'Finnish_Swedish_CI_AI'; $firstletter = '9'; $alphabet = ''; Now I created the table for my test. A single field would do, and putting a Clustered Index on it would suffice for the Seeks. Invoke-Sqlcmd -server . -data tempdb -query "create table dbo.collation_test (col varchar(10) collate $collation primary key);" Now I get into the looping. $c = $firstletter; $stillgoing = $true; while ($stillgoing) { I construct the query I want, seeking for entries which start with whatever $c has reached, and get the plan for it: $query = "select col from dbo.collation_test where col like '$($c)%';"; [xml] $pl = get-sqlplan $query "." "tempdb"; At this point, my $pl variable is a scary piece of XML, representing the execution plan. A bit of hunting through it showed me that the EndRange element contained what I was after, and that if it contained NULL, then I was done. $stillgoing = ($pl.ShowPlanXML.BatchSequence.Batch.Statements.StmtSimple.QueryPlan.RelOp.IndexScan.SeekPredicates.SeekPredicateNew.SeekKeys.EndRange -ne $null); Now I could grab the value out of it (which came with apostrophes that needed stripping), and append that to my $alphabet variable.   if ($stillgoing)   {  $c=$pl.ShowPlanXML.BatchSequence.Batch.Statements.StmtSimple.QueryPlan.RelOp.IndexScan.SeekPredicates.SeekPredicateNew.SeekKeys.EndRange.RangeExpressions.ScalarOperator.ScalarString.Replace("'","");     $alphabet += $c;   } Finally, finishing the loop, dropping the table, and showing my alphabet! } Invoke-Sqlcmd -server . -data tempdb -query "drop table dbo.collation_test;"; $alphabet; When I run all this, I see that the Swedish alphabet is ABCDEFGHIJKLMNOPQRSTUVXYZÅÄÖ, which matches what I see at Wikipedia. Interesting to see that the letters on the end are still there, even with Case Insensitivity. Turns out they’re not just “letters with accents”, they’re letters in their own right. I’m sure you gave up reading long ago, and really aren’t that fazed about the idea of doing this using PowerShell. I chose PowerShell because I’d already come up with an easy way of grabbing the estimated plan for a query, and PowerShell does allow for easy navigation of XML. I find the most interesting aspect of this as the fact that the Query Optimizer uses the next letter of the alphabet to maintain the SARGability of LIKE. I’m hoping they do something similar for a whole bunch of operations. Oh, and the fact that you know how to find stuff in the IKEA catalogue. Footnote: If you are interested in whether this works in other languages, you might want to consider the following screenshot, which shows that in principle, it should work with Japanese. It might be a bit harder to run this in PowerShell though, as I’m not sure how it translates. In Hiragana, the Japanese alphabet starts ?, ?, ?, ?, ?, ...

    Read the article

  • GoldenGate 12c Trail Encryption and Credentials with Oracle Wallet

    - by hamsun
    I have been asked more than once whether the Oracle Wallet supports GoldenGate trail encryption. Although GoldenGate has supported encryption with the ENCKEYS file for years, Oracle GoldenGate 12c now also supports encryption using the Oracle Wallet. This helps improve security and makes it easier to administer. Two types of wallets can be configured in Oracle GoldenGate 12c: The wallet that holds the master keys, used with trail or TCP/IP encryption and decryption, stored in the new 12c dirwlt/cwallet.sso file.   The wallet that holds the Oracle Database user IDs and passwords stored in the ‘credential store’ stored in the new 12c dircrd/cwallet.sso file.   A wallet can be created using a ‘create wallet’  command.  Adding a master key to an existing wallet is easy using ‘open wallet’ and ‘add masterkey’ commands.   GGSCI (EDLVC3R27P0) 42> open wallet Opened wallet at location 'dirwlt'. GGSCI (EDLVC3R27P0) 43> add masterkey Master key 'OGG_DEFAULT_MASTERKEY' added to wallet at location 'dirwlt'.   Existing GUI Wallet utilities that come with other products such as the Oracle Database “Oracle Wallet Manager” do not work on this version of the wallet. The default Oracle Wallet can be changed.   GGSCI (EDLVC3R27P0) 44> sh ls -ltr ./dirwlt/* -rw-r----- 1 oracle oinstall 685 May 30 05:24 ./dirwlt/cwallet.sso GGSCI (EDLVC3R27P0) 45> info masterkey Masterkey Name:                 OGG_DEFAULT_MASTERKEY Creation Date:                  Fri May 30 05:24:04 2014 Version:        Creation Date:                  Status: 1               Fri May 30 05:24:04 2014        Current   The second wallet file is used for the credential used to connect to a database, without exposing the user id or password. Once it is configured, this file can be copied so that credentials are available to connect to the source or target database.   GGSCI (EDLVC3R27P0) 48> sh cp ./dircrd/cwallet.sso $GG_EURO_HOME/dircrd GGSCI (EDLVC3R27P0) 49> sh ls -ltr ./dircrd/* -rw-r----- 1 oracle oinstall 709 May 28 05:39 ./dircrd/cwallet.sso   The encryption wallet file can also be copied to the target machine so the replicat has access to the master key to decrypt records that are encrypted in the trail. Similar to the old ENCKEYS file, the master keys wallet created on the source host must either be stored in a centrally available disk or copied to all GoldenGate target hosts. The wallet is in a platform-independent format, although it is not certified for the iSeries, z/OS, and NonStop platforms.   GGSCI (EDLVC3R27P0) 50> sh cp ./dirwlt/cwallet.sso $GG_EURO_HOME/dirwlt   The new 12c UserIdAlias parameter is used to locate the credential in the wallet so the source user id and password does not need to be stored as a parameter as long as it is in the wallet.   GGSCI (EDLVC3R27P0) 52> view param extwest extract extwest exttrail ./dirdat/ew useridalias gguamer table west.*; The EncryptTrail parameter is used to encrypt the trail using the Advanced Encryption Standard and can be used with a primary extract or pump extract. GGSCI (EDLVC3R27P0) 54> view param pwest extract pwest encrypttrail AES256 rmthost easthost, mgrport 15001 rmttrail ./dirdat/pe passthru table west.*;   Once the extracts are running, records can be encrypted using the wallet.   GGSCI (EDLVC3R27P0) 60> info extract *west EXTRACT    EXTWEST   Last Started 2014-05-30 05:26   Status RUNNING Checkpoint Lag       00:00:17 (updated 00:00:01 ago) Process ID           24982 Log Read Checkpoint  Oracle Integrated Redo Logs                      2014-05-30 05:25:53                      SCN 0.0 (0) EXTRACT    PWEST     Last Started 2014-05-30 05:26   Status RUNNING Checkpoint Lag       24:02:32 (updated 00:00:05 ago) Process ID           24983 Log Read Checkpoint  File ./dirdat/ew000004                      2014-05-29 05:23:34.748949  RBA 1483   The ‘info masterkey’ command is used to confirm the wallet contains the key after copying it to the target machine. The key is needed to decrypt the data in the trail before the replicat applies the changes to the target database.   GGSCI (EDLVC3R27P0) 41> open wallet Opened wallet at location 'dirwlt'. GGSCI (EDLVC3R27P0) 42> info masterkey Masterkey Name:                 OGG_DEFAULT_MASTERKEY Creation Date:                  Fri May 30 05:24:04 2014 Version:        Creation Date:                  Status: 1               Fri May 30 05:24:04 2014        Current   Once the replicat is running, records can be decrypted using the wallet.   GGSCI (EDLVC3R27P0) 44> info reast REPLICAT   REAST     Last Started 2014-05-30 05:28   Status RUNNING INTEGRATED Checkpoint Lag       00:00:00 (updated 00:00:02 ago) Process ID           25057 Log Read Checkpoint  File ./dirdat/pe000004                      2014-05-30 05:28:16.000000  RBA 1546   There is no need for the DecryptTrail parameter when using the Oracle Wallet, unlike when using the ENCKEYS file.   GGSCI (EDLVC3R27P0) 45> view params reast replicat reast assumetargetdefs discardfile ./dirrpt/reast.dsc, purge useridalias ggueuro map west.*, target east.*;   Once a record is inserted into the source table and committed, the encryption can be verified using logdump and then querying the target table.   AMER_SQL>insert into west.branch values (50, 80071); 1 row created.   AMER_SQL>commit; Commit complete.   The following encrypted record can be found using logdump. Logdump 40 >n 2014/05/30 05:28:30.001.154 Insert               Len    28 RBA 1546 Name: WEST.BRANCH After  Image:                                             Partition 4   G  s    0a3e 1ba3 d924 5c02 eade db3f 61a9 164d 8b53 4331 | .>...$\....?a..M.SC1   554f e65a 5185 0257                               | UO.ZQ..W  Bad compressed block, found length of  7075 (x1ba3), RBA 1546   GGS tokens: TokenID x52 'R' ORAROWID         Info x00  Length   20  4141 4157 7649 4141 4741 4141 4144 7541 4170 0001 | AAAWvIAAGAAAADuAAp..  TokenID x4c 'L' LOGCSN           Info x00  Length    7  3231 3632 3934 33                                 | 2162943  TokenID x36 '6' TRANID           Info x00  Length   10  3130 2e31 372e 3135 3031                          | 10.17.1501  The replicat automatically decrypted this record from the trail and then inserted the row to the target table using the wallet. This select verifies the row was inserted into the target database and the data is not encrypted. EURO_SQL>select * from branch where branch_number=50; BRANCH_NUMBER                  BRANCH_ZIP -------------                                   ----------    50                                              80071   Book a seat in an upcoming Oracle GoldenGate 12c: Fundamentals for Oracle course now to learn more about GoldenGate 12c new features including how to use GoldenGate with the Oracle wallet, credentials, integrated extracts, integrated replicats, the Oracle Universal Installer, and other new features. Looking for another course? View all Oracle GoldenGate training.   Randy Richeson joined Oracle University as a Senior Principal Instructor in March 2005. He is an Oracle Certified Professional (10g-12c) and a GoldenGate Certified Implementation Specialist (10-11g). He has taught GoldenGate since 2010 and also has experience teaching other technical curriculums including GoldenGate Monitor, Veridata, JD Edwards, PeopleSoft, and the Oracle Application Server.

    Read the article

< Previous Page | 52 53 54 55 56 57 58 59  | Next Page >