Search Results

Search found 40165 results on 1607 pages for 'function pointers'.

Page 580/1607 | < Previous Page | 576 577 578 579 580 581 582 583 584 585 586 587  | Next Page >

• How to Refresh / Reload a KML layer in OpenLayers. Dynamic KML Layer.

  - by Ozaki

  TLDR See my answer below on how to refresh the layer. So far I have tried action function as follows: function RefreshKMLData(layer) { layer.loaded = false; layer.setVisibility(true); layer.redraw({ force: true }); } set interval of the function: window.setInterval(RefreshKMLData, 5000, KMLLAYER); the layer itself: var KMLLAYER = new OpenLayers.Layer.Vector("MYKMLLAYER", { projection: new OpenLayers.Projection("EPSG:4326"), strategies: [new OpenLayers.Strategy.Fixed()], protocol: new OpenLayers.Protocol.HTTP({ url: MYKMLURL, format: new OpenLayers.Format.KML({ extractStyles: true, extractAttributes: true }) }) }); the url for KMLLAYER with Math random so it doesnt cache: var MYKMLURL = var currentanchorpositionurl = 'http://' + host + '/data?_salt=' + Math.random(); I would have thought that this would Refresh the layer. As by setting its loaded to false unloads it. Visibility to true reloads it and with the Math random shouldn't allow it to cache? So has anyone done this before or know how I can get this to work? TLDR See my answer below on how to refresh the layer.

  Read the article

• jQuery $.ajax calls success handler when reuqest fails because of browser reloading

  - by Martin

  I have the following code: $.ajax({ type: "POST", url: url, data: sendable, dataType: "json", success: function(data) { if(customprocessfunc) customprocessfunc(data); }, error: function(XMLHttpRequest, textStatus, errorThrown){ // error handler here } }); I have a timer which makes AJAX requests often. If I do not receive anything in 'data', I show an error message to the user - it means, something wnet bad on the server. The problem is when user reloads the page while the AJAX call is in progress. I can see in the firebug that the AJAX call fails (URL is colored red and no HTTP status is displayed) so I expect that jQuery will stop the reuqest or at least go to the error handler. But it goes to the success handler and passes null in the 'data' variable. As a result, when user reloads the page, sometimes he can see my big red message about unknown error (because data is null). Is there any way to make jQuery abort the request on complete reloading all at least not to call my success function? I have no way to know in the success handler why the data is null - did it came empty from the server or the call was aborted because of reload.

  Read the article

• Reading from an write-only(OUT) parameter in pl/sql

  - by sqlgrasshopper5

  When I tried writing to an read-only parameter(IN) of a function, Oracle complains with an error. But that is not the case when reading from an write-only(OUT) parameter of a function. Oracle silently allows this without any error. What is the reason for this behaviour?. The following code executes without any assignment happening to "so" variable: create or replace function foo(a OUT number) return number is so number; begin so := a; --no assignment happens here a := 42; dbms_output.put_line('HiYA there'); dbms_output.put_line('VAlue:' || so); return 5; end; / declare somevar number; a number := 6; begin dbms_output.put_line('Before a:'|| a); somevar := foo(a); dbms_output.put_line('After a:' || a); end; / Here's the output I got: Before a:6 HiYA there VAlue: After a:42

  Read the article

• Handling Apache Thrift list/map Return Types in C++

  - by initzero

  First off, I'll say I'm not the most competent C++ programmer, but I'm learning, and enjoying the power of Thrift. I've implemented a Thrift Service with some basic functions that return void, i32, and list. I'm using a Python client controlled by a Django web app to make RPC calls and it works pretty well. The generated code is pretty straight forward, except for list returns: namespace cpp Remote enum N_PROTO { N_TCP, N_UDP, N_ANY } service Rcon { i32 ping() i32 KillFlows() i32 RestartDispatch() i32 PrintActiveFlows() i32 PrintActiveListeners(1:i32 proto) list<string> ListAllFlows() } The generated signatures from Rcon.h: int32_t ping(); int32_t KillFlows(); int32_t RestartDispatch(); int32_t PrintActiveFlows(); int32_t PrintActiveListeners(const int32_t proto); int64_t ListenerBytesReceived(const int32_t id); void ListAllFlows(std::vector<std::string> & _return); As you see, the ListAllFlows() function generated takes a reference to a vector of strings. I guess I expect it to return a vector of strings as laid out in the .thrift description. I'm wondering if I am meant to provide the function a vector of strings to modify and then Thrift will handle returning it to my client despite the function returning void. I can find absolutely no resources or example usages of Thrift list< types in C++. Any guidance would be appreciated.

  Read the article

• jQuery indexOf select box manipulation

  - by kenny99

  Hi, I'm trying to figure out how to remove options from a select box when that option has been selected in an adjacent select box. Basically the user has the option to add multiple records here via select boxes, but I want to remove the list of options available to them so that, for example, they can't enter the same value in two select boxes. When an Add More button is clicked, I fade in the next select box container. A number of select boxes have been generated by PHP and I use JS to hide them. Each select box has a unique number appended to the ID, so i want to access those select boxes which contain the string "other_pet_types", then I want to iterate through the currently visible ones and build an array of the values which have been selected, which I will then remove from the list of options in the newly displayed select box. This is what I have so far, but it's definitely not right - I can't get the initial test on the ID to work. Any pointers greatly appreciated as i realise i'm pretty wide of the mark at the moment! var vals = new Array(); //build array with currently selected options $('p.mult_entries select').each(function(){ vals += $(this).val(); }); $("p.mult_entries:hidden:first").fadeIn("slow", function() { $(this).find(('select').attr('id').indexOf('other_pet_types') > 0).each(function(){ console.log($(this).val()); //as expected prints nothing - need to iterate through the options of the above select //once i extract the correct values, iterate through new select box and use inArray to remove options where that value already exists in one of previous select boxes }); });

  Read the article

• Jquery Ajax + PHP

  - by Kris.Mitchell

  I am having problems with jQuery Ajax and PHP I have my php file set up to echo the data I am gathering from a mysql database. I have verified that the database is returning something and that the string at the end of the function actually contains data. What is happening though, is that it looks like the php echo is happening before the ajax call, causing the php data to be displayed at the top of the page, and not below in proper div. I think it might have something to do with timing of the ajax and the php call, but I am not sure. So, why is the data not getting caught by the .ajax and thrown into the div? Thanks for the help! jQuery $(document).ready(function() { $.ajax({ url: "../database_functions.php", type: "GET", data: "cat=jw&sub=pi&sort=no", cache: false, success: function (html) { alert("Success!"); $('#product-list').html(html); } }); }); PHP echo "Hello World";

  Read the article

• Javascript nested functions not returning

  - by Achintha Samindika

  I'm building a phonehap application. I'm using an web sql and everything works fine till data retival. function getItemGroups(){ var items_groups = new Array(); var db = window.openDatabase("merbokDB", "1.0", "MerbokDB", 5232394); db.transaction( function(tx){ tx.executeSql('SELECT * FROM item_groups',[], function(tx,result){ if(result.rows.length > 0){ var len = result.rows.length; for (var i=0; i<len; i++){ items_groups.push(result.rows.item(i).item_group); } console.log(items_groups.join()); } } ,errorCB); }, errorCB); return items_groups; } var myproducts = getItemGroups(); My problem was when I run the code "myproducts" variable is blank. but the I can see console.log(items_groups.join()); following line printing the values in console. Is I'm wrong in the way I returning?

  Read the article

• Use string to store statement (or part of a statement), and then add it to the code

  - by Dean

  I use multidimensional arrays to store product attributes (well Virtuemart does, to be precise). When I tried to echo the sub-arrays value, if the sub-array did not exist PHP threw: Fatal error: Cannot use string offset as an array To get around this, I attempted to create a function to check on every array level if it is an actual array, and if it is empty (when trying on the whole thing at once such as: is_array($array['level1']['level2']['level3']), I got the same error if level1 or level2 are not actual arrays). This is the function ($array contains the array to check, $array_levels is an array containing the names of the sub-arrays, in the order they should apper): function check_md_array($array,$array_levels){ if(is_array($array)){ $dimension = null; //This will store the dimensions string foreach($array_levels as $level){ $dimension .= "['" . $level . "']"; //Add the current dimension to the dimensions string if(!is_array($array/* THE CONTENT OF $dimension SHOULD BE INSERTED HERE*/)){ return false; } } return true; } } How can I take the string contained in $dimensions, and insert it into the code, to be part of the statement?

  Read the article

• Jquery tabs with cookie support restore wrong tab position after page refresh.

  - by zenonych

  Hello, all. I have tricky problem which I can't completely understand... It's jquery tabs with cookie support. I've following code: $(document).ready(function() { var $tabs = $("#tabs").tabs(); $tabs.tabs('select', $.cookie("tabNumber")); $('#tabs ul li a').click(function() { $.cookie("tabNumber", $tabs.tabs('option', 'selected')); }); $('#btnSelect').click(function() { //alert($.cookie("tabNumber")); //$tabs.tabs('select', 2); $tabs.tabs('select', $.cookie("tabNumber")); }); }); So, I've 3 tabs (with positions 0,1,2) inside div named "tabs". When user selects one tab, then tab position stores in cookie. After that if user refresh page, active tab position must be restored. But each time I refresh page I get active tab in previous position (if I select 2nd tab, then after refresh I got active tab in position 1, etc.). I add some test in code (button btnSelect with onclick handler which duplicates load position functionality). So, if I uncomment and use $tabs.tabs('select', 2); Then after I click btnSelect I've got right position. Ok, that's right. Then I comment that line and uncomment next one: alert($.cookie("tabNumber")); So, I select tab, click button, get dialog message "2", and after that tab in position 1 became active. Why?? In both cases I call 'select' method with parameter 2... I know I can use aliases for tabs, but I want to understate why my code doesn't work properly.

  Read the article

• Symfony2 entity field type alternatives to "property" or "__toString()"?

  - by Polmonino

  Using Symfony2 entity field type one should specify property option: $builder->add('customers', 'entity', array( 'multiple' => true, 'class' => 'AcmeHelloBundle:Customer', 'property' => 'first', )); But sometimes this is not sufficient: think about two customers with the same name, so display the email (unique) would be mandatory. Another possibility is to implement __toString() into the model: class Customer { public $first, $last, $email; public function __toString() { return sprintf('%s %s (%s)', $this->first, $this->last, $this->email); } } The disadvances of the latter is that you are forced to display the entity the same way in all your forms. Is there any other way to make this more flexible? I mean something like a callback function: $builder->add('customers', 'entity', array( 'multiple' => true, 'class' => 'AcmeHelloBundle:Customer', 'property' => function($data) { return sprintf('%s %s (%s)', $data->first, $data->last, $data->email); }, ));

  Read the article

• jQuery Ajax loads URL multiple times, how do I unbind/rebind properly?

  - by gmoz22

  I load a SELECT element via Ajax (list of brands), get its selected value (brand id) and load another SELECT via another Ajax URL (list of templates for currently selected brand). Here's my code: $(document).ready( function() { // DO NOT cache Ajax calls $.ajaxSetup ({ cache: false }); // loader var ajax_load = "Loading..."; // Brands List URL var loadBrandUrl = "getBrandsList.php"; // Templates List URL var loadTemplateUrl = "getTemplatesList.php"; $("#brandslistSelect").html(ajax_load).load(loadBrandUrl) .ajaxComplete(function(){ // Brands select loaded /* Load Templates SELECT the first time since no .change() has happened */ var selectedBrand = $("#brandslistSelect option:selected").attr("value"); // get the value console.log(selectedBrand); // Log selected brand to console // get Templates select, commented for now since it does an infinite loop // $("#templateslistSelect").html(ajax_load).load(loadTemplateUrl, { BrandId: selectedBrand } ); /* End initial load template */ /* On interaction with the Brands SELECT */ $("#brandslistSelect").change(function () { // on interaction with select selectedBrand = $("#brandslistSelect option:selected").attr("value"); // get the value // get Templates SELECT $("#templateslistSelect").html(ajax_load).load(loadTemplateUrl, { BrandId: selectedBrand } ) }); /* End interaction with the Brands SELECT */ }); }); It returns selectedBrand in the console 3 times : selectedBrand = undefined selectedBrand = undefined selectedBrand = 101 Now, if I uncomment the following line, same output as above but it also loads the templates URL indefinitely : // $("#templateslistSelect").html(ajax_load).load(loadTemplateUrl, { BrandId: selectedBrand } ); Any idea how I could modify this code to make it work as intended? Thanks for your help stackOverflow community!

  Read the article

• mysql stored funtion usage

  - by shikhar

  I just wrote a stored function to calculate the working days between two dates. This works select CountWeekDays('2010-03-07','2010-04-07') This doesn't work select CountWeekDays(o.order_date,o.created_date) from orders o; Any idea how to make this one work ?? function definition delimiter $$; CREATE FUNCTION CountWeekDays (sdate VARCHAR(50), edate VARCHAR(50)) RETURNS INT BEGIN DECLARE wdays, tdiff, counter, thisday smallint; DECLARE newdate DATE; SET newdate := sdate; SET wdays = 0; if DATEDIFF(edate, sdate) = 0 THEN RETURN 1; END IF; if DATEDIFF(edate, sdate) < 0 THEN RETURN 0; END IF; label1: LOOP SET thisday = DAYOFWEEK(newdate); IF thisday BETWEEN 2 AND 6 THEN SET wdays := wdays + 1; END IF; SET newdate = DATE_ADD(newdate, INTERVAL 1 DAY); IF DATEDIFF(edate, newdate) < 0 THEN LEAVE label1; END IF; END LOOP label1; RETURN wdays; END

  Read the article

• waiting for a signal

  - by Umesha MS

  Hi, I am working on an application which uploads the content of the file to server. To upload the file to server I am using ‘QNetworkAccessManager’ class. Since it works as asynchronous way, I changed it to work as synchronous way by using QEventLoop. Class FileTransfer { Public : QNetworkAccessManager mNetworkManager; Void Upload(QNetworkRequest request, QIODevice *data) { responce = mNetworkManager.put(request, data); EventLoop.exec(); ReadResponce(responce); } Void Stop() { responce ->close(); } } In my sample application I have 2 windows. 1st to select the files and 2nd to show the progress. When user click on upload button in the first window, the 2nd window will be displayed and then I create the FileTransfer object and start uploading. While uploading the file if user closes the form then in the destructor of the window I call the stop of ‘FileTransfer’ after that I delete the ‘FileTransfer’ object. But here the Upload() function is not yet completed so it will crash. Please help me to: How to wait in 'stop()' function until the Upload() function is completed

  Read the article

• Iteration over a linq to sql query is very slow.

  - by devzero

  I have a view, AdvertView in my database, this view is a simple join between some tables (advert, customer, properties). Then I have a simple linq query to fetch all adverts for a customer: public IEnumerable<AdvertView> GetAdvertForCustomerID(int customerID) { var advertList = from advert in _dbContext.AdvertViews where advert.Customer_ID.Equals(customerID) select advert; return advertList; } I then wish to map this to modelItems for my MVC application: public List<AdvertModelItem> GetAdvertsByCustomer(int customerId) { List<AdvertModelItem> lstAdverts = new List<AdvertModelItem>(); List<AdvertView> adViews = _dataHandler.GetAdvertForCustomerID(customerId).ToList(); foreach(AdvertView adView in adViews) { lstAdverts.Add(_advertMapper.MapToModelClass(adView)); } return lstAdverts; } I was expecting to have some performance issues with the SQL, but the problem seems to be with the .ToList() function. I'm using ANTS performance profiler and it reports that the total runtime of the function is 1.400ms, and 850 of those is with the ToList(). So my question is, why does the tolist function take such a long time here?

  Read the article

• Noobie Jquery Question

  - by piratebill

  I've been working with Jquery fro a grand total of two hours now. Up until this point I have made this really simple FAQ page. <script type="text/javascript" src="jquery.js"></script> <script type="text/javascript"> $(document).ready(function() { $("#void").click(function(event) { event.preventDefault(); }); $('#faq').find('dd').hide().end().find('dt').click(function() { $(this).next().slideToggle(); }); }); </script> <dl id="faq"> <dt><a href="" id="void">Coffee</a></dt> <dd>- black hot drink</dd> <dt><a href="" id="void">Milk</a></dt> <dd>- white cold drink</dd> </dl> The problem is only the first item is working. My questions are, why is only the first entree working and how do I fix it? I've tried using an each() but I am unsure where to put it.

  Read the article

• qTip pop ups come in from top left of screen (on first load)

  - by franko75

  Hi, not sure if i'm set things up incorrectly - I don't seem to see anyone else with this problem, but my qTip popups (all ajax loaded content) are loading quite erratically, in that they are often animating in from off screen before appearing in the correct position. Is there a simple solution to this which I may have missed? Thanks again for your help. HTML markup: <span class="formInfo"> <a href="http://localhost/httpdocs/index.php/help/kc_dob" class="jTip" name="" id="dob_help">?</a> </span> qTip initialisation.. //set up for qtip function initQtip() { $('a.jTip').each(function() { $(this).qtip( { content: { // Set the text to an image HTML string with the correct src URL to the loading image you want to use text: '<img src="/media/images/wait.gif" alt="Loading..." />', url: $(this).attr('href') // Use the rel attribute of each element for the url to load }, position: { adjust: { screen: true // Keep the tooltip on-screen at all times } }, show: { when: 'click', solo: true // Only show one tooltip at a time }, hide: 'unfocus', style: { tip: true, // Apply a speech bubble tip to the tooltip at the designated tooltip corner border: { width: 10, radius: 10 }, width: { min: 200, max: 500 }, name: 'light' // Use the default light style } }); //prevent default event on click }).bind('click', function(event){ event.preventDefault(); return false; }); }

  Read the article

• Loading city/state from SQL Server to Google Maps?

  - by knawlejj

  I'm trying to make a small application that takes a city & state and geocodes that address to a lat/long location. Right now I am utilizing Google Map's API, ColdFusion, and SQL Server. Basically the city and state fields are in a database table and I want to take those locations and get marker put on a Google Map showing where they are. This is my code to do the geocoding, and viewing the source of the page shows that it is correctly looping through my query and placing a location ("Omaha, NE") in the address field, but no marker, or map for that matter, is showing up on the page: function codeAddress() { <cfloop query="GetLocations"> var address = document.getElementById(<cfoutput>#Trim(hometown)#,#Trim(state)#</cfoutput>).value; if (geocoder) { geocoder.geocode( {<cfoutput>#Trim(hometown)#,#Trim(state)#</cfoutput>: address}, function(results, status) { if (status == google.maps.GeocoderStatus.OK) { var marker = new google.maps.Marker({ map: map, position: results[0].geometry.location, title: <cfoutput>#Trim(hometown)#,#Trim(state)#</cfoutput> }); } else { alert("Geocode was not successful for the following reason: " + status); } }); } </cfloop> } And here is the code to initialize the map: var geocoder; var map; function initialize() { geocoder = new google.maps.Geocoder(); var latlng = new google.maps.LatLng(42.4167,-90.4290); var myOptions = { zoom: 5, center: latlng, mapTypeId: google.maps.MapTypeId.ROADMAP } var marker = new google.maps.Marker({ position: latlng, map: map, title: "Test" }); map = new google.maps.Map(document.getElementById("map_canvas"), myOptions); } I do have a map working that uses lat/long that was hard coded into the database table, but I want to be able to just use the city/state and convert that to a lat/long. Any suggestions or direction? Storing the lat/long in the database is also possible, but I don't know how to do that within SQL.

  Read the article

• HREF link that targets nothing, does not want to use hash or void(0)

  - by Mattis

  I have a link that I want to be able to click to trigger a piece of jQuery code. Currently I have <a href="#" id="foo">Link</a> and $('#foo').click(function(){ // Do stuff }); which works well. But, I have always hated using hash in this way. The page flickers and the hash is added to the page url. One alternative is to use <a href="javascript:void(0);" id="foo">Link</a> but I also dislike seeing that piece of code in the browser status bar. It looks tacky. What I'd rather have is an explanatory javascript placeholder that does nothing, like <a href="javascript:zoom();" id="foo">Link</a> which actually works, but throws an ReferenceError in the javascript console since there are no such function. What's the minimum definition of a function that does nothing? Are there any other alternatives? Should I just skip the link and use something like <span id="foo" style="cursor:pointer;cursor:hand;">Link</span> instead?

  Read the article

• Java reflection appropriateness

  - by jsn

  This may be a fairly subjective question, but maybe not. My application contains a bunch of forms that are displayed to the user at different times. Each form is a class of its own. Typically the user clicks a button, which launches a new form. I have a convenience function that builds these buttons, you call it like this: buildButton( "button text", new SelectionAdapter() { @Override public void widgetSelected( SelectionEvent e ) { showForm( new TasksForm( args... ) ); } } ); I do this dozens of times, and it's really cumbersome having to make a SelectionAdapter every time. Really all I need for the button to know is what class to instantiate when it's clicked and what arguments to give the constructor, so I built a function that I call like this instead: buildButton( "button text", TasksForm.class, args... ); Where args is an arbitrary list of objects that you could use to instantiate TasksForm normally. It uses reflection to get a constructor from the class, match the argument list, and build an instance when it needs to. Most of the time I don't have to pass any arguments to the constructor at all. The downside is obviously that if I'm passing a bad set of arguments, it can't detect that at compilation time, so if it fails, a dialog is displayed at runtime. But it won't normally fail, and it'll be easy to debug if it does. I think this is much cleaner because I come from languages where the use of function and class literals is pretty common. But if you're a normal Java programmer, would seeing this freak you out, or would you appreciate not having to scan a zillion SelectionAdapters?

  Read the article

• <input type="file"> reads only file name not full path

  - by Deep

  I am using Glassfish Server.I have seen the apache file upload to solve it...but i want to implement it in glassfish server. image.html <form action="" method="post" enctype="multipart/form-data"> Select a file: <input type="file" name="first" id="first"/> <br /> <input type="button" name="button" value="upload" id="button" /> <p id="test"></p> <img src='Unknown.png' id="profile_img" height="200px" width="150px"/> </form> test.js $(document).ready(function() { var filepath= $("#first"); $('#button').click(function() { $.ajax({ type: "post", url: "imageservlet", data: "user="+filepath.val(), success: function(msg) { $("#profile_img").attr('src',msg); $("#test").html(msg) .fadeIn("fast"); } }); }); }); imageservlet.java String user=request.getParameter("user"); out.print(user); the output is file name not full path.

  Read the article

• drupal hook_menu_alter9) for adding tabs

  - by EricP

  I want to add some tabs in the "node/%/edit" page from my module called "cssswitch". When I click "Rebuild Menus", the two new tabs are displayed, but they are displayed for ALL nodes when editing them, not just for the node "cssswitch". I want these new tabs to be displayed only when editing node of type "cssswitch". The other problem is when I clear all cache, the tabs completely dissapear from all edit pages. Below is the code I wrote. function cssswitch_menu_alter(&$items) { $node = menu_get_object(); //print_r($node); //echo $node->type; //exit(); if ($node->type == 'cssswitch') { $items['node/%/edit/schedulenew'] = array( 'title' => 'Schedule1', 'access callback'=>'user_access', 'access arguments'=>array('view cssswitch'), 'page callback' => 'cssswitch_schedule', 'page arguments' => array(1), 'type' => MENU_LOCAL_TASK, 'weight'=>4, ); $items['node/%/edit/schedulenew2'] = array( 'title' => 'Schedule2', 'access callback'=>'user_access', 'access arguments'=>array('view cssswitch'), 'page callback' => 'cssswitch_test2', 'page arguments' => array(1), 'type' => MENU_LOCAL_TASK, 'weight'=>3, ); } } function cssswitch_test(){ return 'test'; } function cssswitch_test2(){ return 'test2'; } Thanks for any help.

  Read the article

• string comparision and counting the key in target [closed]

  - by mesun

  Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

  Read the article

• JSON to javaScript array

  - by saturn_research

  I'm having a problem handling JSON data within JavaScript, specifically in regards to using the data as an array and accessing and iterating through individual values. The JSON file is structured as follows: { "head": { "vars": [ "place" , "lat" , "long" , "page" ] } , "results": { "bindings": [ { "place": { "type": "literal" , "value": "Building A" } , "lat": { "datatype": "http://www.w3.org/2001/XMLSchema#float" , "type": "typed-literal" , "value": "10.3456" } , "long": { "datatype": "http://www.w3.org/2001/XMLSchema#float" , "type": "typed-literal" , "value": "-1.2345" } , "page": { "type": "uri" , "value": "http://www.example.com/a.html" } } , { "place": { "type": "literal" , "value": "Building B" } , "lat": { "datatype": "http://www.w3.org/2001/XMLSchema#float" , "type": "typed-literal" , "value": "11.3456" } , "long": { "datatype": "http://www.w3.org/2001/XMLSchema#float" , "type": "typed-literal" , "value": "-2.2345" } , "page": { "type": "uri" , "value": "http://www.example.com/b.html" } } , { "place": { "type": "literal" , "value": "Building C" } , "lat": { "datatype": "http://www.w3.org/2001/XMLSchema#float" , "type": "typed-literal" , "value": "12.3456" } , "long": { "datatype": "http://www.w3.org/2001/XMLSchema#float" , "type": "typed-literal" , "value": "-3.2345" } , "page": { "type": "uri" , "value": "http://www.example.com/c.html" } } ] } } I want to be able to convert this into a JavaScript array as follows in order that I can iterate through it and pull out the values for each location in order: var locations = [ ['Building A',10.3456,-1.2345,'http://www.example.com/a.html'], ['Building B',11.3456,-2.2345,'http://www.example.com/b.html'], ['Building C',12.3456,-3.2345,'http://www.example.com/c.html'] ]; Does anyone have any advice on how to achieve this? I have tried the following, but it picks up the "type" within the JSON, rather than just the value: $.each(JSONObject.results.bindings, function(i, object) { $.each(object, function(property, object) { $.each(object, function(property, value) { value; }); }); }); Any help, suggestions, advice or corrections would be greatly appreciated.

  Read the article

• Adding date to multiple fields via datepicker

  - by Andy

  i have a form in drupal with jquery based date module. there are multiple fields with date picker enabled. i want to set the value of all of them (they all have class .date-popup-init) to the value of the first field (#edit-field, the 'from' date) when that field is set. my code so far: <script type="text/javascript"> var DatePicked = function() { var firstdate = $("#edit-field"); var updater = firstdate.datepicker("getDate"); $(".date-popup-init").each(function(){ $(this).datepicker("setDate", updater); }); } $(function() { $("#edit-field").datepicker({ onSelect: DatePicked }); }); </script> this seems to randomly work; it sets the date of some fields to the value of #edit-field, seemingly different fields each time. also, the form adds more datepicker-enabled fields via ajax. is there any way to ensure that all these new fields, when they load, pick up the value of #edit-field as well? disclaimer: last night was my first attempt at javascript of any kind. i have a basic idea now. the above was cobbled through countless google examples.

  Read the article

• Drupal - Search box not working - custom theme template

  - by vr3690

  Hello, I am using a customised version of search-theme-from.tpl When I use the search box, I do get transferred to the search page. But the search does not actually take place. The search box on the search results page does work though. This is my search-them-form.tpl.php file (demo : <input type="text" name="search_theme_form_keys" id="edit-search-theme-form-keys" value="Search" title="Enter the terms you wish to search for" class="logininput" height="24px" onblur="restoreSearch(this)" onfocus="clearInput(this)" /> <input type="submit" name="op" id="edit-submit" value="" class="form-submit" style="display: none;" /> <input type="hidden" name="form_token" id="edit-search-theme-form-form-token" value="<?php print drupal_get_token('search_theme_form'); ?>" /> <input type="hidden" name="form_id" id="edit-search-theme-form" value="search_theme_form" /> There is also a javascript file involved. I guess it's use is pretty clear from the code: function trim(str) { return str.replace(/^\s+|\s+$/g, ''); } function clearInput(e) { e.value=""; // clear default text when clicked e.className="longininput_onfocus"; //change class } function restoreSearch(e) { if (trim(e.value) == '') { { e.value="Search"; // reset default text onBlur e.className="logininput"; //reset class } } } What can be the problem and how can I fix it?

  Read the article

< Previous Page | 576 577 578 579 580 581 582 583 584 585 586 587  | Next Page >